European Commission
Public Health
Accessibility tools
Service tools
Language selector
- Current languageen
Navigation path
- European Commission
- Public health
- Reference documents
- Register
- Orphan Medicinal Products (by number)
Community Register of medicinal products
Register of designated Orphan Medicinal Products (by number)
| EU Designation | Product | Designated Orphan Indication | Sponsor | Designation date | Tradename EU Centralised Nr implemented by |
| EU/3/00/001 | Somatropin | AIDS wasting | Merck Serono Europe Limited | 8/08/2000 | |
| EU/3/00/005 | Gemtuzumab Ozogamicin | Treatment of acute myeloid leukaemia | Wyeth Europa Ltd. | 18/10/2000 | |
| EU/3/00/006 | 1,5-(Butylimino)-1,5-dideoxy, D-glucitol | Treatment of Gaucher Disease | Oxford GlycoSciences (UK) Ltd | 18/10/2000 | Zavesca EU/1/02/238/... 20/11/2002 |
| EU/3/00/007 | N-carbamyl-L-glutamic acid | Treatment of N-acetylglutamate synthetase (NAGS) deficiency | Orphan Europe S.a.r.l. | 18/10/2000 | Carbaglu EU/1/02/246/... 24/01/2003 |
| EU/3/00/010 | Anagrelide Hydrochloride | Treatment of essential thrombocythaemia | Shire Pharmaceutical Development Ltd | 29/12/2000 | Xagrid EU/1/04/295/... 16/11/2004 |
| EU/3/00/011 | Busulfan (Intravenous use) | Busilvex followed by cyclophosphamide (BuCy2) is indicated as conditioning treatment prior to conventional haematopoietic progenitor cell transplantation (HPCT) in adult patients when the combination is considered the best available option. Busilvex followed by cyclophosphamide (BuCy4) or melphalan (BuMel) is indicated as conditioning treatment prior to conventional haematopoietic progenitor cell transplantation in paediatric patients. |
Pierre Fabre Médicament | 29/12/2000 | Busilvex EU/1/03/254/... 9/07/2003 |
| EU/3/00/012 | Nitisinone | Treatment of tyrosinaemia type I | Swedish Orphan International AB | 29/12/2000 | Orfadin EU/1/04/303/... 21/02/2005 |
| EU/3/00/013 | Ethyl Eicosopentaenoate | Treatment of Huntington´s disease | Amarin Neuroscience Limited | 29/12/2000 | |
| EU/3/00/014 | Iloprost | Treatment of primary and of the following forms of secondary pulmonary hypertension: connective tissue disease pulmonary hypertension, drug-induced pulmonary hypertension, portopulmonary hypertension, pulmonary hypertension associated with congenital heart disease, chronic thromboembolic pulmonary hypertension | Bayer Schering Pharma AG | 29/12/2000 | Ventavis EU/1/03/255/... 16/09/2003 |
| EU/3/00/018 | Recombinant human acid alpha-glucosidase | Treatment of Glycogen Storage Disease type II (Pompe´s disease) | Genzyme Europe B.V. | 14/02/2001 | Myozyme EU/1/06/333/... 29/03/2006 |
| EU/3/01/019 | bosentan | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Actelion Registration Limited | 14/02/2001 | Tracleer EU/1/02/220/... 15/05/2002 |
| EU/3/01/020 | Ibuprofen | Treatment of patent ductus arteriosus | Orphan Europe S.a.r.l. | 14/02/2001 | Pedea EU/1/04/284/... 29/07/2004 |
| EU/3/01/022 | Laronidase | Treatment of Mucopolysaccharidosis, type I | Genzyme Europe B.V. | 14/02/2001 | Aldurazyme EU/1/03/253/... 10/06/2003 |
| EU/3/01/023 | Pegvisomant | Treatment of acromegaly | Pfizer Ltd | 14/02/2001 | Somavert EU/1/02/240/... 13/11/2002 |
| EU/3/01/025 | N-acetylgalactosamine-4-sulfatase | Treatment of Mucopolysaccharidosis, type VI (Maroteaux-Lamy Syndrome) | BioMarin Europe Ltd | 14/02/2001 | Naglazyme EU/1/05/324/... 24/01/2006 |
| EU/3/01/026 | L-Lysine-N-acetyl-L-cysteinate | Treatment of cystic fibrosis | LABORATOIRES SMB SA | 14/02/2001 | |
| EU/3/01/028 | Inolimomab | Treatment of Graft versus Host Disease | EUSA Pharma SAS | 5/03/2001 | |
| EU/3/01/034 | Gusperimus trihydrochloride | Treatment of Wegener’s granulomatosis | Nordic Group B.V. | 29/03/2001 | |
| EU/3/01/035 | Levodopa and Carbidopa (Gastroenteral use) | Treatment of advanced idiopathic Parkinson´s disease with severe motor fluctuations and not responding to oral treatment | Abbott Products GmbH | 10/05/2001 | |
| EU/3/01/038 | Retroviral gamma-c cDNA containing vector | Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease | GENOPOIETIC S.A.S. | 30/05/2001 | |
| EU/3/01/039 | Ecteinascidin 743 | Treatment of soft tissue sarcoma | PharmaMar S.A. | 30/05/2001 | Yondelis EU/1/07/417/... 17/09/2007 |
| EU/3/01/044 | Human Alpha1-Proteinase Inhibitor (respiratory use) | Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency | CSL Behring GmbH | 9/07/2001 | |
| EU/3/01/045 | Betaine anhydrous | Treatment of homocystinuria | Orphan Europe S.a.r.l. | 9/07/2001 | Cystadane EU/1/06/379/... 15/02/2007 |
| EU/3/01/048 | Ziconotide (intraspinal use) | Treatment of chronic pain requiring intraspinal analgesia | Eisai Limited | 9/07/2001 | Prialt EU/1/04/302/... 21/02/2005 |
| EU/3/01/049 | Ramoplanin | Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection | Vicuron Pharmaceuticals Italy srl, | 9/07/2001 | |
| EU/3/01/050 | Zinc acetate dihydrate | Treatment of Wilson´s disease | Orphan Europe S.a.r.l. | 31/07/2001 | Wilzin EU/1/04/286/... 13/10/2004 |
| EU/3/01/051 | 1,3-Propanedisulfonic acid, disodium salt | Treatment of Systemic Secondary Amyloidosis | Kiacta Europe Ltd | 31/07/2001 | |
| EU/3/01/055 | Cladribine (subcutaneous use) | Treatment of indolent non-Hodgkin´s lymphoma | Lipomed GmbH | 18/09/2001 | Litak EU/1/04/275/... 14/04/2004 |
| EU/3/01/056 | Recombinant human acid sphingomyelinase | Treatment of Niemann-Pick Disease, type B | Genzyme Europe B.V. | 19/09/2001 | |
| EU/3/01/058 | Repertaxin L-lysine salt | Prevention of delayed graft function in organ transplant | Dompé s.p.a. | 19/09/2001 | |
| EU/3/01/059 | Dexrazoxane | Treatment of anthracycline extravasations | SpePharm Holding B.V. | 19/09/2001 | Savene EU/1/06/350/... 28/07/2006 |
| EU/3/01/062 | Idebenone | Treatment of Friedreich’s ataxia | Laboratoires Takeda | 20/11/2001 | |
| EU/3/01/063 | Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) | Treatment of chronic lymphocytic leukaemia | Voisin Consulting S.A.R.L. | 20/11/2001 | |
| EU/3/01/065 | Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) | Treatment of multiple myeloma | Voisin Consulting S.A.R.L. | 20/11/2001 | |
| EU/3/01/067 | Thalidomide | Treatment of multiple myeloma | Celgene Europe Limited | 20/11/2001 | Thalidomide Celgene EU/1/08/443/... 16/04/2008 |
| EU/3/01/069 | Phenylephrine Hydrochloride | Treatment of ileal pouch anal anastomosis related faecal incontinence | S.L.A. Pharma (UK) Limited | 20/11/2001 | |
| EU/3/01/070 | Celecoxib | Treatment of Familial Adenomatous Polyposis | Pfizer Limited | 20/11/2001 | Onsenal EU/1/03/259/... 17/10/2003 |
| EU/3/01/071 | Stiripentol | Treatment of severe myoclonic epilepsy in infancy | Biocodex | 5/12/2001 | Diacomit EU/1/06/367/... 4/01/2007 |
| EU/3/01/074 | Halofuginone Hydrobromide | Treatment of systemic sclerosis | PPD Global Ltd | 11/12/2001 | |
| EU/3/01/075 | Denileukin diftitox | Treatment of cutaneous T-cell lymphoma | Eisai Limited | 11/12/2001 | |
| EU/3/01/077 | [gly2] Recombinant human glucagon-like peptide | Treatment of Short Bowel Syndrome | Nycomed Danmark ApS | 11/12/2001 | |
| EU/3/01/078 | Iduronate-2-sulfatase | Treatment of Mucopolysaccharidosis, type II (Hunter Syndrome) | Shire HGT AB | 11/12/2001 | Elaprase EU/1/06/365/... 8/01/2007 |
| EU/3/01/079 | Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid | Treatment of acute lung injury | Pharm Research Associates (UK) Limited | 4/02/2002 | |
| EU/3/01/081 | Fumagillin | Treatment of diarrhoea associated with intestinal microsporidial infection | SANOFI | 4/02/2002 | |
| EU/3/01/082 | 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine | Treatment of acute lymphoblastic leukaemia | Genzyme Europe B.V. | 5/02/2002 | Evoltra EU/1/06/334/... 29/05/2006 |
| EU/3/01/083 | Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene | Treatment of high-grade glioma with subsequent use of ganciclovir sodium | Ark Therapeutics Ltd | 6/02/2002 | |
| EU/3/01/084 | Azacitidine | Treatment of myelodysplastic syndromes | Celgene Europe Limited | 6/02/2002 | Vidaza EU/1/08/488/... 17/12/2008 |
| EU/3/02/086 | Porfimer sodium (for use with photodynamic therapy) | Treatment of high-grade dysplasia in Barrett’s Esophagus | Pinnacle Biologics B.V. | 6/03/2002 | PhotoBarr EU/1/04/272/... 25/03/2004 |
| EU/3/02/091 | TGF-beta2 specific phosphorothioate antisense oligodeoxynucleotide | Treatment of high-grade glioma | Antisense Pharma GmbH | 22/03/2002 | |
| EU/3/02/092 | 4-(3,5-bis-(hydroxy-phenyl)-1,2,4) triazol-1-yl)-benzoic acid | Treatment of chronic iron overload requiring chelation therapy | Novartis Europharm Ltd | 13/03/2002 | Exjade EU/1/06/356/... 28/08/2006 |
| EU/3/02/093 | Beclomethasone 17, 21-dipropionate (oral use) | Treatment of intestinal graft-versus-host disease | Soligenix UK Ltd | 13/03/2002 | |
| EU/3/02/094 | Chimeric IgG monoclonal antibody cG250 | Treatment of renal cell carcinoma | Wilex AG | 19/03/2002 | |
| EU/3/02/095 | Iodine (131I) chimeric IgG monoclonal antibody cG250 | Treatment of renal cell carcinoma | Wilex AG | 19/03/2002 | |
| EU/3/02/096 | Nitisinone | Treatment of alkaptonuria | Swedish Orphan International AB | 13/03/2002 | |
| EU/3/02/101 | Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein | Treatment of glioma | EUDRAC Limited | 30/04/2002 | |
| EU/3/02/102 | Mitotane | Treatment of adrenal cortical carcinoma | Laboratoire HRA Pharma | 12/06/2002 | Lysodren EU/1/04/273/... 28/04/2004 |
| EU/3/02/103 | Recombinant Human Porphobilinogen Deaminase | Treatment of acute intermittent porphyria | Zymenex A/S | 12/06/2002 | |
| EU/3/02/104 | Miltefosine | Treatment of visceral leishmaniasis | Zentaris GmbH | 12/06/2002 | |
| EU/3/02/106 | Antisense NF-Kß p65 Oligonucleotide | Treatment of active ulcerative colitis | InDex Pharmaceuticals AB | 30/07/2002 | |
| EU/3/02/107 | Purified bromelain | Treatment of partial deep dermal and full thickness burns | TEVA Pharma GmbH | 30/07/2002 | |
| EU/3/02/109 | Oregovomab | Treatment of ovarian cancer | ViRexx International Corp. Limited | 30/07/2002 | |
| EU/3/02/110 | Thymalfasin | Treatment of hepatocellular carcinoma | SciClone Pharmaceuticals Italy S.r.l | 30/07/2002 | |
| EU/3/02/111 | Benzoic acid, sodium salt | Treatment of non-ketotic hyperglycinaemia | Ethicare GmbH | 11/09/2002 | |
| EU/3/02/115 | Treatment of uremic pruritus | Toray International U.K. Limited | 11/09/2002 | ||
| EU/3/02/116 | Treatment of renal cell carcinoma | Liponova GmbH | 21/10/2002 | ||
| EU/3/02/118 | Recombinant glycoprotein gp350 of Epstein-Barr virus | Prevention of post transplantation lympho-proliferative disorders | Henogen S.A. | 22/10/2002 | |
| EU/3/02/119 | Iodine (¹³¹I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody | Treatment of glioma | Interface International Consultancy Limited | 13/11/2002 | |
| EU/3/02/120 | Duramycin | Treatment of cystic fibrosis | AOP Orphan Pharmaceuticals AG | 13/11/2002 | |
| EU/3/02/121 | 5-aminolevulinic acid hydrochloride | Intra-operative photodynamic diagnosis of residual glioma | medac Gesellschaft für klinische Spezialpräparate mbH | 13/11/2002 | Gliolan EU/1/07/413/... 7/09/2007 |
| EU/3/02/122 | Etilefrin | Treatment of low flow priapism | Laboratoires SERB | 13/11/2002 | |
| EU/3/02/124 | 3,4-diaminopyridine phosphate | Treatment of Lambert-Eaton myasthenic syndrome | BioMarin Europe Limited | 18/12/2002 | Firdapse EU/1/09/601/... 23/12/2009 |
| EU/3/02/126 | Recombinant inhibitor of human plasma kallikrein | treatment of angioedema | Dyax s.a. | 18/12/2002 | |
| EU/3/02/127 | Cholic acid | Treatment of inborn errors in primary bile acid synthesis | Laboratoires C.T.R.S | 18/12/2002 | |
| EU/3/02/128 | Carboxypeptidase G2 | Adjunctive treatment in patients at risk of methotrexate toxicity | Enact Pharma PLC | 3/02/2003 | |
| EU/3/02/129 | G17(9) gastrin-diphtheria toxoid conjugate | Treatment of pancreatic cancer | Cato Europe GmbH | 24/01/2003 | |
| EU/3/02/130 | G17(9) gastrin-diphtheria toxoid conjugate | Treatment of gastric cancer | Cato Europe GmbH | 28/01/2003 | |
| EU/3/03/132 | Caffeine citrate | Treatment of primary apnoea of premature newborns | Chiesi Farmaceutici S.P.A. | 17/02/2003 | Peyona EU/1/09/528/... 2/07/2009 |
| EU/3/03/133 | Icatibant acetate | treatment of angioedema | Jerini AG | 17/02/2003 | Firazyr EU/1/08/461/... 11/07/2008 |
| EU/3/03/134 | Iodine (123I) Serum Amyloid P | Diagnosis of the extent of histologically proven amyloidosis | Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. | 14/02/2003 | |
| EU/3/03/135 | Decitabine | Treatment of myelodysplastic syndromes | Janssen-Cilag International NV | 14/02/2003 | |
| EU/3/03/136 | Iodine (¹³¹I) tositumomab | Treatment of follicular lymphoma | GlaxoSmithKline Research & Development Limited | 14/02/2003 | |
| EU/3/03/137 | Tositumomab | Treatment of follicular lymphoma | GlaxoSmithKline Research & Development Limited | 14/02/2003 | |
| EU/3/03/139 | bosentan | Treatment of systemic sclerosis | Actelion Registration Limited | 17/03/2003 | Tracleer EU/1/02/220/... 7/06/2007 |
| EU/3/03/140 | Tobramycin (inhalation powder) | Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | Chiron Corporation Ltd | 17/03/2003 | TOBI Podhaler EU/1/10/652/... 20/07/2011 |
| EU/3/03/141 | 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine. | Treatment of acute myeloid leukaemia | Genzyme Europe BV | 8/05/2003 | |
| EU/3/03/144 | Liarozole | Treatment of congenital ichthyoses | Stiefel Laboratories (U.K.) Limited | 10/06/2003 | |
| EU/3/03/145 | Rubitecan | Treatment of pancreatic cancer | Eurogen Pharmaceuticals Limited | 10/06/2003 | |
| EU/3/03/149 | Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate | Treatment of pancreatic cancer in combination with ifosfamide | Ziel Biopharma Limited | 30/06/2003 | |
| EU/3/03/153 | Herpes simplex virus lacking infected cell protein 34.5 | Treatment of glioma | Virttu Biologics Limited | 9/07/2003 | |
| EU/3/03/154 | Hydroxyurea | Treatment of sickle cell syndrome | Addmedica | 9/07/2003 | Siklos EU/1/07/397/... 29/06/2007 |
| EU/3/03/155 | Murine anti-idiotypic antibody against OC125 antibody against CA125 antigen | Treatment of ovarian cancer | Menarini Ricerche S.p.A. | 9/07/2003 | |
| EU/3/03/156 | Prasterone | Treatment of adrenal insufficiency | Medicom Healthcare BV | 28/07/2003 | |
| EU/3/03/157 | Recombinant dog gastric lipase | Treatment of cystic fibrosis | Meristem Therapeutics S.A. | 9/07/2003 | |
| EU/3/03/160 | Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) | Treatment of retinopathy of prematurity | Gene Signal SAS | 2/10/2003 | |
| EU/3/03/161 | Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) | Treatment of neovascular glaucoma | Gene Signal SAS | 2/10/2003 | |
| EU/3/03/162 | Yttrium (90Y) antiferritin polyclonal antibodies | Treatment of Hodgkin lymphoma | Monoclonal Antibodies Therapeutics (MAT) | 2/10/2003 | |
| EU/3/03/163 | 5,6,7,8-Tetrahydrobiopterin | Treatment of hyperphenylalaninemia | Orphanetics Pharma Entwicklungs GmbH | 2/10/2003 | |
| EU/3/03/166 | Eculizumab | Treatment of paroxysmal nocturnal haemoglobinuria | Alexion Europe S.A.S. | 17/10/2003 | Soliris EU/1/07/393/... 20/06/2007 |
| EU/3/03/168 | Adjunctive treatment in hematopoietic cell transplantation | MolMed SpA | 20/10/2003 | ||
| EU/3/03/169 | Human immunoglobulin | Treatment of dermatomyositis | Orfagen | 20/10/2003 | |
| EU/3/03/170 | Human immunoglobulin | Treatment of polymyositis | Orfagen | 24/10/2003 | |
| EU/3/03/171 | Trabectedin | Treatment of ovarian cancer | Pharmamar S.A. Sociedad Unipersonal | 17/10/2003 | |
| EU/3/03/172 | Trientine dihydrochloride | Treatment of Wilson´s disease | Univar Limited | 24/10/2003 | |
| EU/3/03/173 | Vasoactive Intestinal Peptide | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Mondobiotech Laboratories AG | 22/12/2003 | |
| EU/3/03/174 | Gimatecan | Treatment of glioma | Sigma Tau Industrie Farmaceutiche Riunite S.p.A | 1/12/2003 | |
| EU/3/03/175 | Recombinant antibody derivative against human CD19 and CD3 | Treatment of mantle cell lymphoma | Micromet GmbH | 1/12/2003 | |
| EU/3/03/176 | Recombinant antibody derivative against human CD19 and CD3 | Treatment of chronic lymphocytic leukaemia | Micromet GmbH | 1/12/2003 | |
| EU/3/03/177 | 3-(4´aminoisoindoline-l´-one)-1-piperidine-2,6-dione | Treatment of multiple myeloma | Celgene Europe Limited | 12/12/2003 | Revlimid EU/1/07/391/... 14/06/2007 |
| EU/3/03/178 | Sildenafil citrate | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Pfizer Ltd | 12/12/2003 | Revatio EU/1/05/318/... 28/10/2005 |
| EU/3/03/179 | Recombinant human factor XIII (composed of two A subunits) | Treatment of hereditary factor XIII deficiency | Novo Nordisk A/S | 12/12/2003 | |
| EU/3/03/182 | 5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt | Treatment of aneurysmal subarachnoid haemorrhage | Axovan Europe Ltd | 12/12/2003 | |
| EU/3/03/183 | Temocillin sodium | Treatment of Burkholderia cepacia lung infection in cystic fibrosis | Belpharma N.V | 14/01/2004 | |
| EU/3/03/184 | Cilengitide | Treatment of glioma | Merck KGaA | 14/01/2004 | |
| EU/3/04/186 | Treosulfan | Conditioning treatment prior to haematopoietic progenitor cell transplantation | medac Gesellschaft für klinische Spezialpräparate mbH | 23/02/2004 | |
| EU/3/04/188 | N-3[[4(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl) oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) | Treatment of moderate and severe traumatic brain injury | Xytis Pharmaceuticals Limited | 23/02/2004 | |
| EU/3/04/189 | Idebenone | Treatment of Friedreich’s ataxia | Santhera Pharmaceuticals (Deutschland) GmbH | 8/03/2004 | |
| EU/3/04/190 | Ethanol (96 per cent ) (gel for injection) | Treatment of congenital lymphatic malformations | Orfagen | 8/03/2004 | |
| EU/3/04/191 | Ethanol (96 per cent ) (gel for injection) | Treatment of congenital venous malformations | Orfagen | 8/03/2004 | |
| EU/3/04/192 | 3-(4´aminoisoindoline-1´-one)-1-piperidine-2,6-dione | Treatment of myelodysplastic syndromes | Celgene Europe Limited | 8/03/2004 | |
| EU/3/04/193 | Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody | Treatment of ovarian cancer | Fresenius Biotech GmbH | 8/03/2004 | |
| EU/3/04/194 | Adeno-associated viral vector expressing lipoprotein lipase | Treatment of lipoprotein lipase deficiency | Amsterdam Molecular Therapeutics | 8/03/2004 | |
| EU/3/04/195 | 2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol | Treatment of anaplastic thyroid cancer | Dr David Chaplin | 14/04/2004 | |
| EU/3/04/197 | Treprostinil sodium (inhalation use) | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | United Therapeutics Europe Ltd | 14/04/2004 | |
| EU/3/04/198 | Human monoclonal antibody against CD4 | Treatment of cutaneous T-cell lymphoma | Genmab A/S | 14/04/2004 | |
| EU/3/04/199 | Tetrahydrobiopterin | Treatment of hyperphenylalaninemia | Merck Serono Europe Limited | 8/06/2004 | Kuvan EU/1/08/481/... 2/12/2008 |
| EU/3/04/200 | ((2-aminoethyl) carbamic acid (2R,5S,8S,11S,14R,17S,19aS)-11-(4-aminobutyl)-5-benzyl-8-(4-benzyloxy benzyl)-14-(1H-indol-3-ylmethyl)-4,7,10,13,16,19-hexaoxo-17-phenyloctadecahydro-3a,6,9,12,15,18-hexaazacyclopentacyclooctadecen-2-yl ester, di[(S)-2-aminosuccinic acid] salt | Treatment of functional gastro-entero-pancreatic endocrine tumours | Novartis Europharm Ltd | 8/06/2004 | |
| EU/3/04/201 | Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar | Prevention of stenosis in synthetic grafts used in haemodialysis | Ark Therapeutics Ltd | 8/06/2004 | |
| EU/3/04/202 | HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor | Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients | Cellcure A/S | 21/06/2004 | |
| EU/3/04/203 | 5’-CTG CCA CGT TCT CCT GC-(2’ methoxy)A-(2’ methoxy)C-(2’ methoxy)C-3’ | Treatment of myasthenia gravis | PPD Global Ltd | 21/06/2004 | |
| EU/3/04/204 | Aztreonam lysinate (inhalation use) | Treatment of gram negative bacteria lung infections in cystic fibrosis | Gilead Sciences International Limited | 21/06/2004 | Cayston EU/1/09/543/... 21/09/2009 |
| EU/3/04/205 | Suberoylanilide hydroxamic acid | Treatment of cutaneous T-cell lymphoma | Merck Sharp & Dohme Ltd | 21/06/2004 | |
| EU/3/04/206 | Muramyl tripeptide phosphatidyl ethanolamine | Treatment of osteosarcoma | IDM Pharma S.A. | 21/06/2004 | Mepact EU/1/08/502/... 6/03/2009 |
| EU/3/04/207 | Sorafenib tosylate | Treatment of renal cell carcinoma | Bayer Schering Pharma AG | 29/07/2004 | Nexavar EU/1/06/342/... 19/07/2006 |
| EU/3/04/208 | Acetylsalicylic acid | Treatment of polycythemia vera | Bayer HealthCare AG | 29/07/2004 | |
| EU/3/04/209 | Ciclosporin (inhalation use) | Prevention of graft rejection after lung transplantation | PARI Pharma GmbH | 29/07/2004 | |
| EU/3/04/210 | Ciclosporin (inhalation use) | Treatment of graft rejection after lung transplantation | PARI Pharma GmbH | 29/07/2004 | |
| EU/3/04/211 | Defibrotide | Prevention of hepatic veno-occlusive disease | Gentium S.p.A. | 29/07/2004 | |
| EU/3/04/212 | Defibrotide | Treatment of hepatic veno-occlusive disease | Gentium S.p.A. | 29/07/2004 | |
| EU/3/04/213 | Mepolizumab | Treatment of hypereosinophilic syndrome | Glaxo Group Limited | 29/07/2004 | |
| EU/3/04/214 | Midostaurin | Treatment of acute myeloid leukaemia | Novartis Europharm Ltd | 29/07/2004 | |
| EU/3/04/215 | Porfimer sodium (for use with photodynamic therapy) | Treatment of cholangiocarcinoma | Pinnacle Biologics B.V. | 29/07/2004 | |
| EU/3/04/216 | Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid | Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age | Pharm Research Associates (UK) Limited | 29/07/2004 | |
| EU/3/04/217 | Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid | Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age | Pharm Research Associates (UK) Limited | 29/07/2004 | |
| EU/3/04/219 | HLA-B27 derived peptide (amino acid 125-138) | Treatment of autoimmune uveitis | Dr Gerhild Wildner | 2/09/2004 | |
| EU/3/04/220 | Anti epidermal growth factor receptor antibody h-R3 | Treatment of glioma | Oncoscience AG | 2/09/2004 | |
| EU/3/04/222 | Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) | Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency | Eli Lilly Nederland B.V. | 2/09/2004 | |
| EU/3/04/223 | Heparin sodium | Treatment of idiopathic pulmonary fibrosis | Prof. Dr Seeger | 2/09/2004 | |
| EU/3/04/224 | Homoharringtonine | Treatment of chronic myeloid leukaemia | ChemGenex Europe SAS | 2/09/2004 | |
| EU/3/04/226 | Recombinant human interleukin-21 | Treatment of renal cell carcinoma | Quintiles Limited | 2/09/2004 | |
| EU/3/04/227 | l, 1´-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane | Treatment to mobilize progenitor cells prior to stem cell transplantation | Genzyme Europe B.V. | 20/10/2004 | Mozobil EU/1/09/537/... 31/07/2009 |
| EU/3/04/228 | Homoharringtonine | Treatment of acute myeloid leukaemia | ChemGenex Europe SAS | 20/10/2004 | |
| EU/3/04/229 | Doxorubicin polyisohexylcyanoacrylate nanoparticles | Treatment of the hepatocellular carcinoma | BioAlliance Pharma | 21/10/2004 | |
| EU/3/04/230 | Dexamethasone sodium phosphate encapsulated in human erythrocytes | Treatment of cystic fibrosis | Erydel S.p.A. | 20/10/2004 | |
| EU/3/04/231 | Deferoxamine mesilate | Treatment of traumatic spinal cord injury | SCT Spinal Cord Therapeutics GmbH | 20/10/2004 | |
| EU/3/04/232 | Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium | Treatment of glioma | Sigma Tau Industrie Farmaceutiche Riunite S.p.A | 20/10/2004 | |
| EU/3/04/233 | Adeno-associated viral vector containing the human gamma-sarcoglycan gene | Treatment of gamma-sarcoglycanopathy | Généthon | 21/10/2004 | |
| EU/3/04/234 | Sitaxentan sodium | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Encysive (UK) Limited | 21/10/2004 | Thelin EU/1/06/353/... 10/08/2006 |
| EU/3/04/240 | Rufinamide | Treatment of Lennox-Gastaut syndrome | Eisai Limited | 20/10/2004 | Inovelon EU/1/06/378/... 16/01/2007 |
| EU/3/04/241 | Pirfenidone | Treatment of idiopathic pulmonary fibrosis | InterMune UK Limited | 16/11/2004 | Esbriet EU/1/11/667/... 28/02/2011 |
| EU/3/04/242 | N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole | Treatment of mastocytosis | OxThera AB | 16/11/2004 | |
| EU/3/04/243 | Alpha-1 antitrypsin (inhalation use) | Treatment of cystic fibrosis | Innovative Drug European Associates (I.D.E.A.) Limited | 16/11/2004 | |
| EU/3/04/244 | Alpha-1 antitrypsin (inhalation use) | Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency | Innovative Drug European Associates (I.D.E.A.) Limited | 16/11/2004 | |
| EU/3/04/245 | Aplidine | Treatment of multiple myeloma | Pharma Mar SA Sociedad Unipersonal | 16/11/2004 | |
| EU/3/04/246 | Eptacog alfa (activated) | Treatment of Familial Adenomatous Polyposis | TopoTarget Germany AG | 30/11/2004 | |
| EU/3/04/248 | Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors | Treatment of multiple myeloma | CellGenix GmbH | 21/12/2004 | |
| EU/3/04/249 | Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors | Treatment of follicular lymphoma | CellGenix GmbH | 23/12/2004 | |
| EU/3/04/250 | Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors | Treatment of mantle cell lymphoma | CellGenix GmbH | 21/12/2004 | |
| EU/3/04/251 | N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole | Treatment of malignant gastro intestinal stromal tumours | Dr Geoffrey Allan | 21/12/2004 | |
| EU/3/04/257 | Recombinant human bile salt-stimulated lipase | Treatment of cystic fibrosis | Arexis AB | 26/01/2005 | |
| EU/3/04/258 | L-Asparaginase | Treatment of acute lymphoblastic leukaemia | medac Gesellschaft für klinische Spezialpräparate mbH | 26/01/2005 | |
| EU/3/04/260 | Recombinant human alpha-Mannosidase | Treatment of alpha-Mannosidosis | Zymenex A/S | 26/01/2005 | |
| EU/3/05/261 | Fluocinolone acetonide (prolonged-release intravitreal implant) | Treatment of non-infectious uveitis affecting the posterior segment of the eye | Bausch & Lomb Ireland | 7/03/2005 | |
| EU/3/05/262 | Titanium dioxide and bisoctrizole | Treatment of UV-A and visible light-induced photosensitivity disorders (chronic actinic dermatitis, cutaneous porphyrias, actinic prurigo and solar urticaria) | Orfagen | 3/03/2005 | |
| EU/3/05/263 | dimethyl sulfoxide | Treatment of severe closed traumatic brain injury | AOP Orphan Pharmaceuticals AG | 3/03/2005 | |
| EU/3/05/264 | Cholest-4-en-3-one, oxime | Treatment of 5q spinal muscular atrophies | Trophos SA | 10/03/2005 | |
| EU/3/05/265 | Ciclosporin (inhalation use) | Treatment of graft rejection after lung transplantation | Chiron Corporation Limited | 10/03/2005 | |
| EU/3/05/266 | Ciclosporin (inhalation use) | Prevention of graft rejection after lung transplantation | Chiron Corporation Limited (trading as Chiron Biopharmaceuticals) | 10/03/2005 | |
| EU/3/05/269 | Tipifarnib | Treatment of acute myeloid leukaemia | Janssen-Cilag International NV | 10/03/2005 | |
| EU/3/05/270 | Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex | Treatment of renal cell carcinoma | Antigenics Therapeutics Limited | 11/04/2005 | |
| EU/3/05/272 | Histamine dihydrochloride | Treatment of acute myeloid leukaemia | EpiCept GmbH | 11/04/2005 | Ceplene EU/1/08/477/... 7/10/2008 |
| EU/3/05/273 | Ambrisentan | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | European Medical Advisory Services Limited | 11/04/2005 | Volibris EU/1/08/451/... 21/04/2008 |
| EU/3/05/274 | Melatonin | Non-24-Hour Sleep-Wake Disorder in blind people with no light perception | ICON Clinical Research (UK) Limited | 11/04/2005 | |
| EU/3/05/275 | Estradiol Hemihydrate and Progesterone | Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age | Dr Frank Pohlandt | 11/04/2005 | |
| EU/3/05/276 | Humanized Agonistic Anti-CD28 Monoclonal Antibody | Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) | TeGenero AG | 11/04/2005 | |
| EU/3/05/277 | (3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid | Treatment of cystic fibrosis | Voisin Consulting SARL | 27/05/2005 | |
| EU/3/05/278 | (3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid | Treatment of Duchenne muscular dystrophy | PTC Therapeutics, Limited | 27/05/2005 | |
| EU/3/05/279 | (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone | Treatment of cutaneous T-cell lymphoma | Celgene Europe Limited | 27/05/2005 | |
| EU/3/05/280 | Acadesine | Treatment of B-cell chronic lymphocytic leukemia (B-CLL) | Advancell - Advanced In Vitro Cell Technologies, S.A. | 27/05/2005 | |
| EU/3/05/282 | Miltefosine | Treatment of Acanthamoeba keratitis | Orphanidis Pharma Research GmbH | 27/05/2005 | |
| EU/3/05/283 | Recombinant megakaryopoeisis-stimulating protein | Treatment of idiopathic thrombocytopenic purpura | Amgen Europe B.V. | 27/05/2005 | Nplate EU/1/08/497/... 4/02/2009 |
| EU/3/05/284 | Sodium butyrate (rectal use) | Prevention of radiation proctitis | Promefarm srl | 27/05/2005 | |
| EU/3/05/285 | Bimosiamose disodium | Treatment of acute lung injury | Revotar Biopharmaceuticals AG | 27/05/2005 | |
| EU/3/05/286 | N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole | Treatment of multiple myeloma | Dr Geoffrey Allan | 20/06/2005 | |
| EU/3/05/287 | Bovine bile extract | Treatment of pancreatic cancer | Dr Ulrich Granzer | 20/06/2005 | |
| EU/3/05/288 | 4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HC1 | Treatment of Huntington´s disease | NSAB, Filial af NeuroSearch Sweden AB, Sverige | 20/06/2005 | |
| EU/3/05/289 | Pegylated arginine deiminase | Treatment of hepatocellular carcinoma | Dr Francesco Izzo | 20/06/2005 | |
| EU/3/05/290 | Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein | Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck | Viventia Biotech (EU) Limited | 20/06/2005 | |
| EU/3/05/292 | H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 | Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) | Auris Medical Limited | 16/06/2005 | |
| EU/3/05/293 | nelarabine | Treatment of acute lymphoblastic leukaemia | Glaxo Group Limited | 16/06/2005 | Atriance EU/1/07/403/... 22/08/2007 |
| EU/3/05/294 | Soluble yeast beta-1,3/1,6-glucan | Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy | Biotec Pharmacon ASA | 16/06/2005 | |
| EU/3/05/295 | Hepatitis C Immunoglobulin | Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients | Biotest Pharma GmbH | 8/07/2005 | |
| EU/3/05/296 | Hydrocortisone (modified release tablet) | Treatment of congenital adrenal hyperplasia | Diurnal Limited | 27/07/2005 | |
| EU/3/05/297 | Adeno-associated viral vector containing a modified U7-snRNA gene | Treatment of Duchenne muscular dystrophy | Généthon | 27/07/2005 | |
| EU/3/05/298 | Mycophenolate mofetil | Treatment of Cushing’s syndrome secondary to ectopic ACTH secretion | Laboratoire HRA Pharma | 27/07/2005 | |
| EU/3/05/299 | 4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one | Treatment of pancreatic cancer | ICON Clinical Research (UK) Ltd | 27/07/2005 | |
| EU/3/05/300 | Nemorubicin hydrochloride | Treatment of hepatocellular carcinoma | Nerviano Medical Sciences Srl | 28/07/2005 | |
| EU/3/05/301 | Chimeric monoclonal antibody to shiga-toxin 1 and 2 | Treatment of shiga-toxin producing bacterial infection. | Albany Regulatory Consulting Ltd | 26/08/2005 | |
| EU/3/05/302 | Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower | Treatment of sickle cell disease | Xechem UK Ltd | 26/08/2005 | |
| EU/3/05/303 | Human autologous mesenchymal adult stem cells extracted from adipose tissue | Treatment of anal fistula | CELLERIX S.A. | 26/08/2005 | |
| EU/3/05/307 | Mecasermin | Treatment of primary growth hormone insensitivity syndrome | Ipsen Pharma | 26/08/2005 | |
| EU/3/05/310 | Treprostinil diethanolamine (oral use) | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | United Therapeutics Europe Ltd | 26/08/2005 | |
| EU/3/05/312 | (1R, 2R, 4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R, 27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxazacyclohentriacontin-3-yl]propyl}-2-methoxy-cyclohexyldimethyl-phosphinate | Treatment of soft tissue sarcoma | Merck Sharp & Dohme Limited | 26/08/2005 | |
| EU/3/05/313 | Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene | Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency | Fondazione Telethon | 26/08/2005 | |
| EU/3/05/314 | (1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol | Treatment of tuberculosis | Tibotec BVBA | 26/08/2005 | |
| EU/3/05/315 | (2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide | Treatment of progressive myoclonic epilepsies | UCB Pharma SA. | 26/08/2005 | |
| EU/3/05/316 | 2-{4-[(5,6-diphenylpyrazin-2-yl)(isopropyl)amino]butoxy}-N-(methylsulfonyl)acetamide | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Actelion Registration Ltd | 26/08/2005 | |
| EU/3/05/317 | A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein | Treatment of graft-versus-host disease | Xenikos BV | 26/08/2005 | |
| EU/3/05/318 | Recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A | Prevention of tuberculosis disease in BCG vaccinated individuals | Emergent Product Development UK Limited | 28/10/2005 | |
| EU/3/05/319 | Human Staphylococcus aureus immunoglobulin | Treatment of Staphylococcus aureus bacteremia | Biotest Pharma GmbH | 28/10/2005 | |
| EU/3/05/321 | (1R, 2R, 4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R, 27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxazacyclohentriacontin-3-yl]propyl}-2-methoxy-cyclohexyldimethyl-phosphinate | Treatment of primary malignant bone tumours | Merck Sharp & Dohme Limited | 28/10/2005 | |
| EU/3/05/323 | Bacterial lipase | Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency | Nordmark Arzneimittel GmbH u. Co. KG | 7/11/2005 | |
| EU/3/05/324 | Levamisol hydrochloride | Treatment of nephrotic syndrome | Addmedica | 28/10/2005 | |
| EU/3/05/325 | Mannitolum | Treatment of cystic fibrosis | Pharmaxis Pharmaceuticals Limited | 7/11/2005 | |
| EU/3/05/326 | Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) | Treatment of systemic sclerosis | Digna Biotech S.L. | 28/10/2005 | |
| EU/3/05/327 | Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt | Treatment of glioma | Oligovax | 28/10/2005 | |
| EU/3/05/328 | (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Celgene Europe Limited | 28/10/2005 | |
| EU/3/05/329 | Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) | Treatment of the localised scleroderma | Digna Biotech S.L. | 28/10/2005 | |
| EU/3/05/331 | Recombinant microbial lipase | Treatment of malasbsorption due to exocrine pancreatic enzyme insufficiency | Abbott Products GmbH | 28/10/2005 | |
| EU/3/05/332 | 1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine | Treatment of acute myeloid leukaemia | Vion (UK) Limited, ? i3 Research | 14/12/2005 | |
| EU/3/05/333 | Eptacog alfa (activated) | Treatment of diffuse alveolar haemorrhage | Pharmaorigin ApS | 14/12/2005 | |
| EU/3/05/334 | Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein | Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) | Edimer Ltd | 14/12/2005 | |
| EU/3/05/336 | Brostallicin | Treatment of soft tissue sarcoma | AAIPharma S.A. | 23/12/2005 | |
| EU/3/05/337 | Heparin sodium (inhalation use) | Treatment of cystic fibrosis | Vectura Group plc | 23/12/2005 | |
| EU/3/05/338 | Dasatinib | Treatment of acute lymphoblastic leukaemia | Bristol-Myers Squibb Pharma EEIG | 23/12/2005 | Sprycel EU/1/06/363/... 20/11/2006 |
| EU/3/05/339 | Dasatinib | Treatment of chronic myeloid leukaemia | Bristol-Myers Squibb Pharma EEIG | 23/12/2005 | Sprycel EU/1/06/363/... 20/11/2006 |
| EU/3/05/341 | Imexon | Treatment of ovarian cancer | ICON Clinical Research (UK) Ltd | 23/12/2005 | |
| EU/3/05/342 | Denufosol tetrasodium | Treatment of cystic fibrosis | Envestia Limited | 23/12/2005 | |
| EU/3/05/343 | Enzastaurin hydrochloride | Treatment of glioma | Eli Lilly Nederland B.V. | 23/12/2005 | |
| EU/3/05/345 | Lentiviral vector containing the human Wiskott Aldrich syndrome protein gene | Treatment of Wiskott-Aldrich syndrome | Généthon | 24/01/2006 | |
| EU/3/05/346 | E. Coli heat-shock protein 70 with bovine retinal S-antigen | Treatment of autoimmune uveitis | Biotech Tools SA | 24/01/2006 | |
| EU/3/06/349 | Apomorphine hydrochloride (inhalation use) | Treatment of off-periods in Parkinson’s disease not responding to oral treatment | Vectura Group plc | 16/02/2006 | |
| EU/3/06/350 | Alpha-1 proteinase inhibitor | Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency | Octapharma (IP) Limited | 16/02/2006 | |
| EU/3/06/351 | Miglustat | Treatment of Niemann-Pick disease, type C | Actelion Registration Ltd | 16/02/2006 | Zavesca EU/1/02/238/... 26/01/2009 |
| EU/3/06/354 | Oxalobacter formigenes strain HC-1 | Treatment of primary hyperoxaluria | OxThera AB | 17/02/2006 | |
| EU/3/06/355 | Zosuquidar trihydrochloride | Treatment of acute myeloid leukaemia | Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP | 17/02/2006 | |
| EU/3/06/356 | 4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline | Treatment of renal cell carcinoma | Prodimed S.A. | 16/02/2006 | |
| EU/3/06/359 | Adeno associated viral vector containing the human calpain 3 gene | Treatment of calpainopathy | Généthon | 6/04/2006 | |
| EU/3/06/360 | Ciclosporin | Treatment of vernal keratoconjunctivitis | Novagali Pharma SA | 6/04/2006 | |
| EU/3/06/361 | Glutathione | Treatment of cystic fibrosis | Mukoviszidose e.V. | 11/04/2006 | |
| EU/3/06/362 | Human heterologous liver cells (for infusion) | Treatment of acute liver failure | Cytonet GmbH & Co. KG | 11/04/2006 | |
| EU/3/06/363 | 4-[131I]iodo-L-phenylalanine | Treatment of glioma | Therapeia GmbH & Co. KG | 11/04/2006 | |
| EU/3/06/364 | Sorafenib tosylate | Treatment of hepatocellular carcinoma | Bayer Schering Pharma AG | 11/04/2006 | Nexavar EU/1/06/342/... 29/10/2007 |
| EU/3/06/365 | Temsirolimus | Treatment of renal cell carcinoma | Pfizer Limited | 6/04/2006 | Torisel EU/1/07/424/... 19/11/2007 |
| EU/3/06/366 | Tobramycin (liposomal) | Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | Axentis Pharma Limited | 11/04/2006 | |
| EU/3/06/367 | Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex | Treatment of solitary bone cysts | Kuros Biosurgery International AG | 11/04/2006 | |
| EU/3/06/368 | 1-deoxygalactonojirimycin hydrochloride | Treatment of Fabry disease | Amicus Therapeutics UK Limited | 22/05/2006 | |
| EU/3/06/369 | Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix | Treatment of epidermolysis bullosa | CELLERIX S.A. | 22/05/2006 | |
| EU/3/06/370 | Decitabine | Treatment of acute myeloid leukaemia | Janssen-Cilag International NV | 8/06/2006 | |
| EU/3/06/371 | Heparin sodium | Treatment of cystic fibrosis | Ockham Biotech Limited | 22/05/2006 | |
| EU/3/06/372 | Hydrocortisone (modified release tablet) | Treatment of adrenal insufficiency | ViroPharma SPRL | 22/05/2006 | Plenadren EU/1/11/715/... 3/11/2011 |
| EU/3/06/373 | Mecasermin | Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects | Ipsen Pharma | 22/05/2006 | INCRELEX EU/1/07/402/... 3/08/2007 |
| EU/3/06/374 | Methoxsalen | Treatment of Graft-versus-Host disease | Johnson & Johnson Medical Ltd | 22/05/2006 | |
| EU/3/06/375 | Nilotinib | Treatment of chronic myeloid leukaemia | Novartis Europharm Ltd | 22/05/2006 | Tasigna EU/1/07/422/... 19/11/2007 |
| EU/3/06/376 | Recombinant P-selectin glycoprotein immunoglobulin | Prevention of post transplantation graft dysfunction | RJM Consultancy Ltd | 22/05/2006 | |
| EU/3/06/379 | Diphenylcyclopropenone | Treatment of alopecia totalis | Orfagen | 29/06/2006 | |
| EU/3/06/380 | Diphenylcyclopropenone | Treatment of alopecia universalis | Orfagen | 29/06/2006 | |
| EU/3/06/381 | Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 | Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa | Voisin Consulting | 29/06/2006 | |
| EU/3/06/383 | Siplizumab | Treatment of T-cell and NK-cell neoplasms | MedImmune, LLC | 29/06/2006 | |
| EU/3/06/384 | Human telomerase reverse transcriptase peptide (611-626) | Treatment of pancreatic cancer | Gemvax A/S | 25/07/2006 | |
| EU/3/06/386 | 4-[123I]iodo-L-phenylalanine | Diagnosis of glioma | Therapeia GmbH & Co. KG | 25/07/2006 | |
| EU/3/06/387 | Amikacin sulfate (liposomal) | Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | Insmed Limited | 25/07/2006 | |
| EU/3/06/388 | Becatecarin | Treatment of cancers of the biliary tree | Helsinn Birex Pharmaceuticals Ltd | 25/07/2006 | |
| EU/3/06/389 | Lestaurtinib | Treatment of acute myeloid leukaemia | Cephalon Europe | 25/07/2006 | |
| EU/3/06/390 | 4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride | Treatment of moderate and severe traumatic brain injury | vasopharm GmbH | 28/08/2006 | |
| EU/3/06/391 | Amphotericin B (for inhalation use) | Prevention of pulmonary fungal infection in patients deemed at risk | Kendle International Ltd | 28/08/2006 | |
| EU/3/06/392 | Human monoclonal antibody against inhibitory killer cell lg-like receptors | Treatment of acute myeloid leukaemia | Innate Pharma | 28/08/2006 | |
| EU/3/06/394 | Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin | Treatment of follicular lymphoma | Biovest Europe Limited | 28/08/2006 | |
| EU/3/06/395 | Aviptadil | Treatment of acute lung injury | mondoBIOTECH Laboratories Anstalt | 28/08/2006 | |
| EU/3/06/396 | Cardiotrophin-1 | Prevention of the ischemia/reperfusion injury associated with solid organ transplantation | Digna Biotech S.L. | 28/08/2006 | |
| EU/3/06/397 | Cholest-4-en-3-one, oxime | Treatment of amyotrophic lateral sclerosis | Trophos SA | 28/08/2006 | |
| EU/3/06/399 | Mecasermin rinfabate | Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age | Premacure AB | 28/08/2006 | |
| EU/3/06/400 | Metastable technetium 99 [99mTc] demogastrin 2 | Diagnosis of medullary thyroid carcinoma | Biomedica Life Sciences SA | 28/08/2006 | |
| EU/3/06/401 | N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate | Treatment of familial amyloid polyneuropathy | Pfizer Specialty UK Limited | 28/08/2006 | |
| EU/3/06/403 | 5-(2,6-Difluoro-phenoxy)-3(R,S)-{2(S)-[2(S)-(3-methoxycarbonyl-2(S)-{3-methyl-2(S)-[(quinoline-2-carbonyl)-amino]-butyrylamino}-propionylamino)-3-methyl-butyrylamino]-propionylamino}-4-oxo-pentanoic acid methyl ester | Treatment of neonatal brain injury | CHIESI FARMACEUTICI SpA | 23/10/2006 | |
| EU/3/06/404 | Adenoviral vector containing human p53 gene | Treatment of Li Fraumeni Syndrome | Gendux Molecular Limited | 23/10/2006 | |
| EU/3/06/405 | Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) | Treatment of renal cell carcinoma | MOLOGEN AG | 23/10/2006 | |
| EU/3/06/406 | Arimoclomol | Treatment of amyotrophic lateral sclerosis | Orphazyme ApS | 26/10/2006 | |
| EU/3/06/407 | Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 | Prevention of necrotizing enterocolitis | Dr Michael Moore | 31/10/2006 | |
| EU/3/06/408 | Human cytomegalovirus immunoglobulin | Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection | Biotest Pharma GmbH | 31/10/2006 | |
| EU/3/06/409 | L-asparaginase encapsulated in erythrocytes | Treatment of acute lymphoblastic leukaemia | Erytech Pharma S.A. | 27/10/2006 | |
| EU/3/06/410 | Doxorubicin hydrochloride (liposomal) | Treatment of soft tissue sarcoma | GP-Pharm S.A. | 27/10/2006 | |
| EU/3/06/411 | Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule | Prevention of Graft-versus-Host disease | Apogenix GmbH | 31/10/2006 | |
| EU/3/06/412 | 4,7,10,13,16,19-docosahexaenoic acid | Treatment of retinitis pigmentosa | Celavista Pharmaceuticals Limited | 3/11/2006 | |
| EU/3/06/413 | Budesonide (oral use) | Treatment of Graft-versus-Host disease | Dr Falk, Pharma GmbH | 3/11/2006 | |
| EU/3/06/414 | Catumaxomab | Treatment of gastric cancer | Fresenius Biotech GmbH | 3/11/2006 | |
| EU/3/06/416 | Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' | Treatment of acute myeloid leukaemia | EleosInc Limited | 3/11/2006 | |
| EU/3/06/417 | Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) | Treatment of renal cell carcinoma | Immunservice GmbH | 27/10/2006 | |
| EU/3/06/418 | Iodine (131I) anti-tenascin monoclonal antibody 81C6 | Treatment of glioma | Biological Consulting Europe Ltd | 30/10/2006 | |
| EU/3/06/419 | Paclitaxel (liposomal) | Treatment of pancreatic cancer | MediGene AG | 31/10/2006 | |
| EU/3/06/420 | Temsirolimus | Treatment of mantle cell lymphoma | Pfizer Limited | 6/11/2006 | Torisel EU/1/07/424/... 21/08/2009 |
| EU/3/06/421 | Forodesine hydrochloride | Treatment of acute lymphoblastic leukaemia | Napp Pharmaceuticals Research Limited | 18/12/2006 | |
| EU/3/06/422 | Paclitaxel (micellar) | Treatment of ovarian cancer | Oasmia Pharmaceutical AB | 18/12/2006 | |
| EU/3/06/423 | Tazarotene | Treatment of congenital ichthyoses | Orfagen | 18/12/2006 | |
| EU/3/06/424 | Thiotepa | Conditioning treatment prior to haematopoietic progenitor cell transplantation | Adienne S.r.l. | 29/01/2007 | Tepadina EU/1/10/622/... 15/03/2010 |
| EU/3/06/425 | Complement factor H | Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system | Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. | 26/01/2007 | |
| EU/3/06/428 | Forodesine hydrochloride | Treatment of cutaneous T-cell lymphoma | Napp Pharmaceuticals Research Limited | 29/01/2007 | |
| EU/3/06/429 | Recombinant modified vaccinia Ankara expressing human 5T4 | Treatment of renal cell carcinoma | Oxford Biomedica (UK) Ltd | 26/01/2007 | |
| EU/3/07/430 | artesunate | Treatment of malaria | Pharmaorigin ApS | 20/02/2007 | |
| EU/3/07/431 | Autologous dendritic cells pulsed with autologous tumour cell lysate | Treatment of glioma | Dorian Regulatory Affairs BV | 15/02/2007 | |
| EU/3/07/432 | Ex-vivo cultured adult human mesenchymal stem cells | Treatment of Graft-versus-Host disease | Genzyme Europe BV | 20/02/2007 | |
| EU/3/07/433 | HLA class I/II binding tumour associated peptides (ADF-APO-CCN-GUC-K67-MET- MMP-MUC-RGS) | Treatment of renal cell carcinoma | Immatics Biotechnologies GmbH | 15/02/2007 | |
| EU/3/07/434 | Idebenone | Treatment of Leber's hereditary optic neuropathy | Santhera Pharmaceuticals (Deutschland) GmbH | 15/02/2007 | |
| EU/3/07/435 | Recombinant human C1-inhibitor | Prevention of delayed graft function after solid organ transplantation | Pharming Group N.V. | 20/02/2007 | |
| EU/3/07/437 | Idebenone | Treatment of Duchenne muscular dystrophy | Santhera Pharmaceuticals (Deutschland) GmbH | 20/03/2007 | |
| EU/3/07/438 | Zanolimumab | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Genmab A/S | 20/03/2007 | |
| EU/3/07/440 | Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene | Treatment of congenital alpha-1 antitrypsin deficiency | TMC Pharma Services Ltd. | 20/03/2007 | |
| EU/3/07/441 | Hydrocortisone (modified release tablet) | Treatment of adrenal insufficiency | Diurnal Limited | 20/03/2007 | |
| EU/3/07/442 | Enzastaurin hydrochloride | Treatment of diffuse large B cell lymphoma | Eli Lilly Nederland B.V. | 20/03/2007 | |
| EU/3/07/443 | Elafin | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Proteo Biotech AG | 20/03/2007 | |
| EU/3/07/444 | Pralatrexate | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Allos Therapeutics Limited | 13/04/2007 | |
| EU/3/07/445 | Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) | Prevention of corneal graft rejection | Gene Signal SAS | 17/04/2007 | |
| EU/3/07/446 | Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA | Treatment of metachromatic leukodystrophy | Fondazione Telethon | 13/04/2007 | |
| EU/3/07/447 | Nilotinib hydrochloride monohydrate | Treatment of gastro intestinal stromal tumours | Novartis Europharm Ltd | 13/04/2007 | |
| EU/3/07/448 | Talactoferrinum alfa | Treatment of renal cell carcinoma | Agennix Limited | 5/06/2007 | |
| EU/3/07/450 | 5(S)-(2´-hydroxy ethoxy)-20(S)- camptothecin | Treatment of osteosarcoma | ClinTec International Ltd | 8/06/2007 | |
| EU/3/07/451 | Cisplatin (liposomal) | Treatment of pancreatic cancer | Regulon AE | 8/06/2007 | |
| EU/3/07/452 | R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H -1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea | Treatment of gastric carcinoid | Trio Medicines Ltd | 14/06/2007 | |
| EU/3/07/453 | Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 | Treatment of haemophilia B (congenital factor IX deficiency) | Biogen Idec Limited | 8/06/2007 | |
| EU/3/07/455 | Ciclosporin | Prevention of corneal graft rejection | Novagali Pharma SA | 22/10/2007 | |
| EU/3/07/456 | Rilonacept | Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA) | Regeneron UK Limited | 10/07/2007 | Rilonacept Regeneron EU/1/09/582/... 23/10/2009 |
| EU/3/07/458 | fampridine | Treatment of Guillain-Barré syndrome | Dr Ulrich Granzer | 10/07/2007 | |
| EU/3/07/459 | 1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride | Treatment of narcolepsy | Bioprojet | 10/07/2007 | |
| EU/3/07/461 | Human plasminogen | Treatment of ligneous conjunctivitis | Kedrion S.p.A. | 3/08/2007 | |
| EU/3/07/462 | Recombinant human soluble Fc-gamma receptor Iib | Treatment of idiopathic thrombocytopenic purpura | SuppreMol GmbH | 2/08/2007 | |
| EU/3/07/463 | Pyridoxalated haemoglobin polyoxyethylene | Treatment of cardiogenic shock | Curacyte AG | 2/08/2007 | |
| EU/3/07/465 | L-threo-3,4-dihydroxyphenylserine | Treatment of orthostatic hypotension in patients with pure autonomic failure | Diamond BioPharm Limited | 2/08/2007 | |
| EU/3/07/466 | L-threo-3,4-dihydroxyphenylserine | Treatment of orthostatic hypotension in patients with multiple system atrophy | Diamond BioPharm Limited | 2/08/2007 | |
| EU/3/07/469 | Ciprofloxacin (inhalation use) | Treatment of cystic fibrosis | Bayer Schering Pharma AG | 3/08/2007 | |
| EU/3/07/470 | Human heterologous liver cells (for infusion) | Treatment of ornithine-transcarbamylase deficiency | Cytonet GmbH & Co. KG | 14/09/2007 | |
| EU/3/07/471 | Human coagulation factor X | Treatment of hereditary factor X deficiency | Bio Products Laboratory | 17/09/2007 | |
| EU/3/07/472 | Cyclo{{(E,Z)-(2s,3r,4r)-3-Hydroxy-4-Methyl-2-(Methylamino)Nona-6,8-Dienoyl}-L-2-Aminobutyryl-N-Methyl-Glycyl-N-Methyl-L-Leucyl-L-Valyl-N-Methyl-L-Leucyl-L-Alanyl-D-Alanyl-N-Methyl-L-Leucyl-N-Methyl-L-Leucyl-N-Methyl-L-Valyl} | Treatment of chronic non-infectious uveitis | Lux Biosciences GmbH | 14/09/2007 | |
| EU/3/07/473 | Aviptadil | Treatment of sarcoidosis | mondoBIOTECH Laboratories Anstalt | 14/09/2007 | |
| EU/3/07/474 | Alpha-1 proteinase inhibitor (inhalation use) | Treatment of cystic fibrosis | CSL Behring GmbH | 14/09/2007 | |
| EU/3/07/475 | Alginate oligosaccharide (G-block) fragment | Treatment of cystic fibrosis | AlgiPharma AS | 14/09/2007 | |
| EU/3/07/476 | 5´-O-(trans-9´´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine | Treatment of acute myleoid leukaemia | Clavis Pharma ASA | 14/09/2007 | |
| EU/3/07/476 | 5´-O-(trans-9´´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine | Treatment of acute myleoid leukaemia | Clavis Pharma ASA | 14/09/2007 | |
| EU/3/07/477 | 4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-ß-D-arabinofuranosyl]-2(1H)-pyrimidinone | Treatment of hepatocellular carcinoma | Interface International Consultancy Limited | 14/09/2007 | |
| EU/3/07/478 | N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide | Treatment of Hodgkin lymphoma | CanReg (Europe) Limited | 14/09/2007 | |
| EU/3/07/479 | N-adamantanyl-N'-geranyl-ethylenediamine | Treatment of tuberculosis | RLM Consulting | 14/09/2007 | |
| EU/3/07/480 | Naptumomab estafenatox | Treatment of renal cell carcinoma | Active Biotech AB | 14/09/2007 | |
| EU/3/07/481 | R-salbutamol sulphate | Treatment of cutaneous forms of lupus erythematosus | Astion Pharma A/S | 14/09/2007 | |
| EU/3/07/484 | Adenovirus associated viral vector serotype 4 containing the human RPE65 gene | Treatment of Leber's congenital amaurosis | Centre Hospitalier Universitaire de Nantes | 22/10/2007 | |
| EU/3/07/485 | Alvocidib | Treatment of chronic lymphocytic leukaemia | Sanofi Aventis | 23/10/2007 | |
| EU/3/07/486 | Adenovirus associated viral vector serotype 4 containing the human RPE65 gene | Treatment of retinitis pigmentosa | Centre Hospitalier Universitaire de Nantes | 14/11/2007 | |
| EU/3/07/487 | 4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol | Treatment of chronic lymphocytic leukaemia | BlackSwan Pharma GmbH | 14/11/2007 | |
| EU/3/07/489 | Ciclosporin | Treatment of Herpes simplex virus stromal keratitis | Novagali Pharma SA | 29/10/2007 | |
| EU/3/07/490 | Human autologous bone-forming cells derived from bone marrow stem cells | Treatment of non-traumatic osteonecrosis | Bone Therapeutics SA | 29/10/2007 | |
| EU/3/07/491 | Interferon gamma | Treatment of idiopathic pulmonary fibrosis | Foundation For Fatal Rare Diseases | 29/10/2007 | |
| EU/3/07/492 | Iodine (131I) chlorotoxin | Treatment of glioma | Biological Consulting Europe Ltd | 22/10/2007 | |
| EU/3/07/493 | Isofagomine tartrate | Treatment of Gaucher Disease | Amicus Therapeutics UK Limited | 23/10/2007 | |
| EU/3/07/494 | Lenalidomide | Treatment of chronic lymphocytic leukaemia | Celgene Europe Limited | 19/11/2007 | |
| EU/3/07/495 | Methotrexate (oral liquid) | Treatment of acute lymphoblastic leukaemia | Only for Children Pharmaceuticals | 24/10/2007 | |
| EU/3/07/496 | Mercaptopurine (oral liquid) | Treatment of acute lymphoblastic leukaemia | Only for Children Pharmaceuticals | 22/10/2007 | |
| EU/3/07/498 | Polihexanide | Treatment of Acanthamoeba keratitis | S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. | 14/11/2007 | |
| EU/3/07/499 | Terguride | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Ergonex Licensing and Regulatory Services AG | 29/11/2007 | |
| EU/3/07/500 | Recombinant human rod-derived cone viability factor | Treatment of retinitis pigmentosa | Fovea Pharmaceuticals SA | 29/11/2007 | |
| EU/3/07/501 | Olaparib | Treatment of ovarian cancer | AstraZeneca AB | 6/12/2007 | |
| EU/3/07/502 | Picoplatin | Treatment of small cell lung cancer | Kendle International Ltd | 6/12/2007 | |
| EU/3/07/503 | Recombinant human hepatitis C monoclonal antibody against C4 region of E1 | Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients | GENimmune N.V | 6/12/2007 | |
| EU/3/07/504 | Irinotecan hydrochloride (drug eluting beads) | Treatment of glioma | CellMed AG | 29/11/2007 | |
| EU/3/07/505 | Interferon beta | Treatment of acute lung injury | Faron Pharmaceuticals Limited | 29/11/2007 | |
| EU/3/07/506 | Heterologous human adult liver derived stem cells | Treatment of Crigler-Najjar syndrome | Promethera Biosciences | 29/11/2007 | |
| EU/3/07/507 | Doxorubicin hydrochloride (drug eluting beads) | Treatment of glioma | CellMed AG | 29/11/2007 | |
| EU/3/07/508 | Chimeric-anti-interleukin-6 monoclonal antibody | Treatment of Castleman’s disease | Janssen Biologics B.V. | 30/11/2007 | |
| EU/3/07/509 | Azacitidine | Treatment of acute myeloid leukaemia | Celgene Europe Limited | 29/11/2007 | Vidaza EU/1/08/488/... 17/12/2008 |
| EU/3/07/510 | artesunate | Treatment of malaria | Sigma-Tau Industrie Farmaceutiche Riunite S.p.A | 6/12/2007 | |
| EU/3/07/511 | 3-methoxy-pregnenolone | Treatment of spinal cord injury | MAPREG SAS | 4/12/2007 | |
| EU/3/07/513 | (S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine | Treatment of tuberculosis | Dr Ulrich Granzer | 29/11/2007 | |
| EU/3/07/514 | (1R, 2R)-Octanoic acid [2-(2’,3’-dihydro-benzo [1,4] dioxin-6’-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt | Treatment of Gaucher Disease | Genzyme Europe BV | 4/12/2007 | |
| EU/3/07/516 | Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 | Treatment of acute myeloid leukaemia | SymbioTec GmbH | 20/12/2007 | |
| EU/3/07/517 | N-[4-(3-amino-1H-indazol-4-yl)phenyl]-N´-(2-fluoro-5-methylphenyl) urea | Treatment of hepatocellular carcinoma | Abbott Laboratories Limited | 20/12/2007 | |
| EU/3/07/518 | Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate | Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension | Bayer Schering Pharma AG | 20/12/2007 | |
| EU/3/07/519 | Maribavir | Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk | ViroPharma SPRL | 18/12/2007 | |
| EU/3/07/520 | Human papilloma virus type 16 E6/E7 synthetic long peptides | Treatment of epithelial neoplasia of the vulva positive for human papilloma virus | ISA Therapeutics B.V. | 20/12/2007 | |
| EU/3/07/521 | H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt | Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients | Vaxon Biotech | 18/12/2007 | |
| EU/3/07/522 | (manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21°-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) | Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy | Celtic Bio-Pharma Services Ltd | 31/01/2008 | |
| EU/3/07/523 | Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide | Treatment of gastro-entero-pancreatic neuroendocrine tumours | Advanced Accelerator Applications | 31/01/2008 | |
| EU/3/07/524 | (R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole | Treatment of tuberculosis | Otsuka Novel Products GmbH | 1/02/2008 | |
| EU/3/07/525 | Iodine (131I) iobenguane | Treatment of neuroblastoma | Molecular Insight Limited | 31/01/2008 | |
| EU/3/07/526 | N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide | Treatment of acute myeloid leukaemia | CanReg (Europe) Limited | 31/01/2008 | |
| EU/3/08/529 | Tretazicar | Treatment of visceral leishmaniasis | Morvus Technology Limited | 4/02/2008 | |
| EU/3/08/530 | Heterologous human adult liver derived stem cells | Treatment of ornithinine transcarbamylase deficiency | Promethera Biosciences | 4/02/2008 | |
| EU/3/08/531 | ascorbic acid | Treatment of Charcot-Marie-Tooth disease type 1A | Murigenetics SAS | 1/04/2008 | |
| EU/3/08/532 | filgrastim | Treatment of amyotrophic lateral sclerosis | Sygnis Bioscience GmbH & Co. KG | 1/04/2008 | |
| EU/3/08/533 | Recombinant human monoclonal antibody against transforming growth factor beta-1, 2 and 3 | Treatment of idiopathic pulmonary fibrosis | Genzyme Europe BV | 1/04/2008 | |
| EU/3/08/535 | Humanised monoclonal antibody to the folate receptor alpha | Treatment of ovarian cancer | Eisai Europe Limited | 1/04/2008 | |
| EU/3/08/536 | Chimeric antibody to mesothelin | Treatment of pancreatic cancer | Eisai Europe Limited | 17/03/2008 | |
| EU/3/08/538 | Amrubicin hydrochloride | Treatment of small cell lung cancer | Celgene Europe Limited | 2/04/2008 | |
| EU/3/08/539 | Ammonium tetrathiomolybdate | Treatment of Wilson´s disease | JJGConsultancy Ltd | 1/04/2008 | |
| EU/3/08/540 | Omigapil maleate | Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). | Santhera Pharmaceuticals (Deutschland) GmbH | 8/05/2008 | |
| EU/3/08/541 | [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone | Treatment of erythropoietic protoporphyria | Clinuvel (UK) Limited | 8/05/2008 | |
| EU/3/08/542 | Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide | Treatment of acute myeloid leukaemia | Dr Ulrich Granzer | 8/05/2008 | |
| EU/3/08/543 | Sarsasapogenin | Treatment of amyotrophic lateral sclerosis | Phytopharm plc | 8/05/2008 | |
| EU/3/08/544 | Omigapil maleate | Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency | Santhera Pharmaceuticals (Deutschland) GmbH | 8/05/2008 | |
| EU/3/08/545 | [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone | Treatment of congenital erythropoietic porphyria | Clinuvel (UK) Limited | 8/05/2008 | |
| EU/3/08/546 | Alpha-1 proteinase inhibitor (inhalation use) | Treatment of congenital alpha-1 antitrypsin deficiency | Grifols Deutschland GmbH | 3/06/2008 | |
| EU/3/08/548 | Carfilzomib | Treatment of multiple myeloma | Nexus Oncology Ltd | 3/06/2008 | |
| EU/3/08/549 | NGR-human tumour necrosis factor | Treatment of malignant mesothelioma | MolMed S.p.A. | 3/06/2008 | |
| EU/3/08/550 | Nimotuzumab | Treatment of pancreatic cancer | Oncoscience AG | 3/06/2008 | |
| EU/3/08/551 | Pegylated recombinant factor VIIa | Treatment of haemophilia A | Novo Nordisk A/S | 4/06/2008 | |
| EU/3/08/552 | Pegylated recombinant factor VIIa | Treatment of haemophilia B | Novo Nordisk A/S | 3/06/2008 | |
| EU/3/08/553 | Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] | Treatment of glioma | Gregory Fryer Associates Ltd | 3/06/2008 | |
| EU/3/08/554 | Beraprost sodium (modified release tablet) | Treatment of pulmonary arterial hypertension | IDEA Innovative Drugs European Associates Limited | 10/07/2008 | |
| EU/3/08/555 | Vincristine sulphate liposomes | Treatment of acute lymphoblastic leukaemia | NDA Regulatory Science Ltd | 8/07/2008 | |
| EU/3/08/556 | N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide | Treatment of cystic fibrosis | Vertex Pharmaceuticals (U.K.) Limited | 8/07/2008 | |
| EU/3/08/557 | Sapacitabine | Treatment of myelodysplastic syndromes | Cyclacel Limited | 8/07/2008 | |
| EU/3/08/558 | Sapacitabine | Treatment of acute myeloid leukaemia | Cyclacel Limited | 10/07/2008 | |
| EU/3/08/559 | bosentan | Treatment of idiopathic pulmonary fibrosis | Actelion Registration Limited | 5/09/2008 | |
| EU/3/08/560 | (-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate | Treatment of moderate and severe closed traumatic brain injury | KeyNeurotek Pharmaceuticals AG | 5/09/2008 | |
| EU/3/08/561 | Donor lymphocyte preparation depleted of functional alloreactive T-cells | Prevention of Graft-versus-Host disease | Kiadis Pharma Netherlands B.V. | 5/09/2008 | |
| EU/3/08/562 | Topotecan hydrochloride (liposomal) | Treatment of glioma | Dr Matthias Luz | 5/09/2008 | |
| EU/3/08/563 | Recombinant derivative of C3 transferase | Treatment of traumatic spinal cord injury | Triskel EU Services | 5/09/2008 | |
| EU/3/08/564 | Avian polyclonal IgY antibody against Pseudomonas aeruginosa | Treatment of cystic fibrosis | Immunsystem I.M.S. AB | 23/09/2008 | |
| EU/3/08/565 | Drotrecogin alfa (activated) | Treatment of acute respiratory distress syndrome | Drugrecure Aps | 22/09/2008 | |
| EU/3/08/566 | Levofloxacin hemihydrate | Treatment of cystic fibrosis | Mpex London Ltd | 23/09/2008 | |
| EU/3/08/567 | Miltefosine | Treatment of cutaneous T-cell lymphoma | ExperGen Drug Development GmbH | 22/09/2008 | |
| EU/3/08/568 | N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide | Treatment of partial deep dermal and full thickness burn wounds | Creative Antibiotics Sweden AB | 22/09/2008 | |
| EU/3/08/569 | Pegylated L-asparaginase | Treatment of acute lymphoblastic leukaemia | Enzon (UK) Limited | 22/09/2008 | |
| EU/3/08/570 | Recombinant human CXCL8 mutant | Prevention of delayed graft function after solid organ transplantation | ProtAffin Biotechnologie AG | 22/09/2008 | |
| EU/3/08/571 | Recombinant human minibody against complement component C5 | Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system | Adienne S.r.l. | 22/09/2008 | |
| EU/3/08/572 | (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate | Treatment of chronic idiopathic myelofibrosis | Incyte Corporation Ltd | 7/11/2008 | |
| EU/3/08/573 | Adeno-associated viral vector containing the human alpha-sarcoglycan gene | Treatment of alpha-sarcoglycanopathy | Généthon | 7/11/2008 | |
| EU/3/08/575 | vildagliptin | Treatment of isovaleric acidaemia | Orphan Europe SARL | 7/11/2008 | |
| EU/3/08/576 | Carglumic acid | Treatment of methylmalonic acidaemia | Orphan Europe SARL | 7/11/2008 | |
| EU/3/08/577 | Carglumic acid | Treatment of propionic acidaemia | Orphan Europe SARL | 7/11/2008 | |
| EU/3/08/578 | Cysteamine hydrochloride | Treatment of cystinosis | Orphan Europe SARL | 7/11/2008 | |
| EU/3/08/579 | Ex-vivo expanded autologous human corneal epithelium containing stem cells | Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns |
Chiesi Farmaceutici S.P.A. | 7/11/2008 | |
| EU/3/08/580 | Filgrastim | Treatment of spinal cord injury | Sygnis Bioscience GmbH & Co. KG | 7/11/2008 | |
| EU/3/08/581 | Ofatumumab | Treatment of chronic lymphocytic leukaemia | Glaxo Group Limited | 7/11/2008 | Arzerra EU/1/10/625/... 19/04/2010 |
| EU/3/08/582 | Recombinant human heparan N-sulfatase | Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) | Shire Pharmaceutical Development Limited | 7/11/2008 | |
| EU/3/08/583 | Gadodiamide (liposomal) | Treatment of glioma | Dr Matthias Luz | 3/12/2008 | |
| EU/3/08/584 | Palifosfamide | Treatment of soft tissue sarcoma | Ziopharm Oncology Limited | 3/12/2008 | |
| EU/3/08/585 | Daunorubicin (liposomal) | Treatment of acute myeloid leukaemia | Diatos S. A. | 3/12/2008 | |
| EU/3/08/586 | RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´ [2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride | Treatment of Duchenne muscular dystrophy | AVI BioPharma International Ltd | 3/12/2008 | |
| EU/3/08/587 | Cenersen | Treatment of chronic lymphocytic leukaemia | EleosInc Limited | 3/12/2008 | |
| EU/3/08/588 | Recombinant human ADAMTS-13 | Treatment of thrombotic thrombocytopenic purpura | Baxter AG | 3/12/2008 | |
| EU/3/08/589 | Yttrium (90Y) edotreotide | Treatment of gastro-entero-pancreatic neuroendocrine tumours | Molecular Insight Limited | 4/12/2008 | |
| EU/3/08/590 | 2-[[3-({4-[(5-{2-[(3-Fluorophenyl)amino]-2-oxoethyl}-1H-pyrazol-3-yl)amino]-quinazolin-7-yl}oxy)propyl](ethyl)amino]ethyl dihydrogen phosphate trihydrate | Treatment of acute myeloid leukaemia | AstraZeneca AB | 5/12/2008 | |
| EU/3/08/591 | 5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole | Treatment of Duchenne muscular dystrophy | Summit (Oxford) Limited | 4/12/2008 | |
| EU/3/08/592 | Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 | Treatment of hairy cell leukaemia | MEDIMMUNE Limited | 4/12/2008 | |
| EU/3/08/593 | N2´-Deacetyl-N2´-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody | Treatment of multiple myeloma | Biotest AG | 3/12/2008 | |
| EU/3/08/594 | Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein | Treatment of hypophosphatasia | Dr Ulrich Granzer | 3/12/2008 | |
| EU/3/08/595 | Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E | Treatment of anaplastic large cell lymphoma | Seattle Genetics UK Limited | 15/01/2009 | |
| EU/3/08/596 | Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E | Treatment of Hodgkin lymphoma | Seattle Genetics UK Limited | 15/01/2009 | |
| EU/3/08/597 | 2,3,4,5 tetrahydro-2,8-dimethyl-5-[2-(6-methyl-3-pyridyl)ethyl]-1H-pyrido[4,3-b]indole dihydrochloride | Treatment of Huntington´s disease | Innovative Drug European Associates (I.D.E.A.) Limited | 20/01/2009 | |
| EU/3/08/598 | Exon 44 specific phosphorothioate oligonucleotide | Treatment of Duchenne muscular dystrophy | Prosensa Therapeutics B.V. | 27/02/2009 | |
| EU/3/08/599 | Exon 51 specific phosphorothioate oligonucleotide | Treatment of Duchenne muscular dystrophy | Glaxo Group Ltd | 27/02/2009 | |
| EU/3/08/600 | Human anti-intercellular adhesion molecule 1 monoclonal antibody | Treatment of multiple myeloma | BioInvent International AB | 20/01/2009 | |
| EU/3/08/601 | Milatuzumab | Treatment of multiple myeloma | Immunomedics GmbH | 19/01/2009 | |
| EU/3/08/602 | Milatuzumab | Treatment of chronic lymphocytic leukaemia | Immunomedics GmbH | 19/01/2009 | |
| EU/3/08/603 | Pralatrexate | Treatment of non-papillary transitional cell carcinoma of the urinary bladder | Allos Therapeutics Limited | 19/01/2009 | |
| EU/3/08/604 | Recombinant Human minibody against complement component C5 fused with RGD-motif | Prevention of the ischemia/reperfusion injury associated with solid organ transplantation | ADIENNE S.r.l. | 20/01/2009 | |
| EU/3/08/605 | Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class | Treatment of spinal cord injury | Novartis Europharm Ltd | 19/01/2009 | |
| EU/3/08/607 | Type I native bovine skin collagen | Treatment of systemic sclerosis | arGentis Autoimmune Europe Limited | 9/02/2009 | |
| EU/3/08/608 | Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 | Treatment of pancreatic cancer | Immunomedics GmbH | 6/02/2009 | |
| EU/3/08/609 | Adeno-associated viral vector serotype 5 containing the human ABCA4 gene | Treatment of Stargardt’s disease | Fondazione Telethon | 6/02/2009 | |
| EU/3/08/610 | Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt | Treatment of medullary thyroid carcinoma | TMC Pharma Services Ltd | 6/02/2009 | |
| EU/3/08/611 | Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein | Treatment of acute liver failure | Alfact Innovation SAS | 11/02/2009 | |
| EU/3/08/612 | Recombinant human proinsulin | Treatment of retinitis pigmentosa | ProRetina Therapeutics, S.L. | 11/02/2009 | |
| EU/3/09/613 | Tobramycin (inhalation use) | Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | PARI Pharma GmbH | 27/02/2009 | |
| EU/3/09/614 | Mifepristone | Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin | EXELGYN | 27/02/2009 | |
| EU/3/09/615 | N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase | Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) | Dr Ulrich Granzer | 27/02/2009 | |
| EU/3/09/616 | (6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride monohydrate | Treatment of amyotrophic lateral sclerosis | Biogen Idec Limited | 27/02/2009 | |
| EU/3/09/617 | 2,2-dimethylbutyric acid, sodium salt | Treatment of beta-thalassaemia intermedia and major | Isabelle Ramirez | 27/02/2009 | |
| EU/3/09/618 | Allogeneic ex vivo expanded umbilical cord blood cells | Treatment of acute lymphoblastic leukaemia | TEVA Pharma GmbH | 27/02/2009 | |
| EU/3/09/619 | Allogeneic ex vivo expanded umbilical cord blood cells | Treatment of acute myeloid leukaemia | TEVA Pharma GmbH | 27/02/2009 | |
| EU/3/09/620 | (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate | Treatment of myelofibrosis secondary to polycythemia vera or essential thrombocythemia | Incyte Corporation Ltd | 3/04/2009 | |
| EU/3/09/621 | 2,2-dimethylbutyric acid, sodium salt | Treatment of sickle cell disease | Isabelle Ramirez | 18/03/2009 | |
| EU/3/09/622 | N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt | Treatment of acute myeloid leukaemia | Ambit Europe Limited | 23/03/2009 | |
| EU/3/09/623 | Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene | Treatment of beta-thalassaemia intermedia and major | EGT San Rocco Italia SRL | 29/04/2009 | |
| EU/3/09/624 | Autologous tumour-derived gp96 heat shock protein-peptide complex | Treatment of glioma | Antigenics Therapeutics Limited | 29/04/2009 | |
| EU/3/09/625 | Guanabenz | Treatment of traumatic spinal cord injury | Acure Pharma AB | 29/04/2009 | |
| EU/3/09/628 | Mercaptopurine (oral suspension) | Treatment of acute lymphoblastic leukaemia | Nova Laboratories Limited | 30/04/2009 | Mercaptopurine Nova Laboratories EU/1/11/727/... 9/03/2012 |
| EU/3/09/629 | Nanobody directed towards the human A1 domain of von Willebrand factor | Treatment of thrombotic thrombocytopenic purpura | Ablynx NV | 30/04/2009 | |
| EU/3/09/630 | Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector | Treatment of dystrophic epidermolysis bullosa | Prof. Alain Hovnanian | 30/04/2009 | |
| EU/3/09/632 | Adeno-associated viral vector containing porphobilinogen deaminase gene | Treatment of acute intermittent porphyria | Amsterdam Molecular Therapeutics BV | 29/04/2009 | |
| EU/3/09/633 | L-asparaginase encapsulated in erythrocytes | Treatment of pancreatic cancer | Erytech Pharma SA | 15/05/2009 | |
| EU/3/09/634 | S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK | Treatment of pancreatic cancer | MBiotec GmbH | 15/05/2009 | |
| EU/3/09/635 | Treprostinil diethanolamine | Treatment of systemic sclerosis | United Therapeutics Europe Ltd | 15/05/2009 | |
| EU/3/09/636 | Dexamethasone phosphate (iontophoretic solution, ocular use) | Treatment of corneal graft rejection |
Interface International Consultancy Ltd | 15/05/2009 | |
| EU/3/09/637 | 2',3',5'-tri-O-acetyluridine | Treatment of 5-fluorouracil overdose | Wellstat Therapeutics EU Limited | 15/05/2009 | |
| EU/3/09/638 | Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 | Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation | Opsona Therapeutics | 15/05/2009 | |
| EU/3/09/639 | 4,6,8-trihydroxy-10-(3,7,11-trimethyldodeca-2,6,10-trienyl)-5,10-dihydrodibenzo[b,e][1,4]diazepin-11-one | Treatment of glioma | Albany Regulatory Consulting Limited | 15/05/2009 | |
| EU/3/09/640 | Pegylated recombinant human factor IX | Treatment of haemophilia B | Novo Nordisk A/S | 15/05/2009 | |
| EU/3/09/641 | Alicaforsen | Treatment of pouchitis | Atlantic Healthcare Limited | 15/05/2009 | |
| EU/3/09/642 | Chimeric-anti-interleukin-6 monoclonal antibody | Treatment of multiple myeloma | Janssen Biologics B.V. | 12/06/2009 | |
| EU/3/09/643 | Desipramine hydrochloride | Treatment of Rett syndrome | Targeon SAS | 12/06/2009 | |
| EU/3/09/645 | Octreotide chloride (lipid depot solution) | Treatment of acromegaly | Camurus AB | 12/06/2009 | |
| EU/3/09/647 | (S)-3´-(OH)-desazadesferrithiocin-polyether, magnesium salt | Treatment of chronic iron overload requiring chelation therapy | FerroKin BioSciences Ltd | 24/07/2009 | |
| EU/3/09/648 | Afamelanotide | Treatment of solar urticaria | Clinuvel UK Limited | 24/07/2009 | |
| EU/3/09/649 | Allogeneic ex vivo expanded umbilical cord blood cells | Treatment of Hodgkin lymphoma | TEVA Pharma GmbH | 24/07/2009 | |
| EU/3/09/650 | Blinatumomab | Treatment of acute lymphoblastic leukaemia | Micromet GmbH | 24/07/2009 | |
| EU/3/09/651 | Ciclosporin (eye drops, solution) | Treatment of atopic keratoconjunctivitis | Allergan Pharmaceuticals Ireland | 24/07/2009 | |
| EU/3/09/652 | Ciprofloxacin (liposomal) | Treatment of cystic fibrosis | Interface International Consultancy Ltd | 24/07/2009 | |
| EU/3/09/653 | Eculizumab | Treatment of atypical haemolytic uremic syndrome | Alexion Europe SAS | 24/07/2009 | |
| EU/3/09/654 | Hypothiocyanite / lactoferrin | Treatment of cystic fibrosis | Alaxia | 24/07/2009 | |
| EU/3/09/655 | Octocog alpha (liposomal) | Treatment of haemophilia A | Bayer Schering Pharma AG | 24/07/2009 | |
| EU/3/09/656 | Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors | Treatment of diffuse large B-cell lymphoma | CellGenix GmbH | 24/07/2009 | |
| EU/3/09/657 | Recombinant human N-acetylgalactosamine-6-sulfatase | Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) | BioMarin Europe Limited | 24/07/2009 | |
| EU/3/09/658 | Tamibarotene | Treatment of acute promyelocytic leukaemia | Eudax S.R.L. | 24/07/2009 | |
| EU/3/09/659 | Tosedostat | Treatment of acute myeloid leukaemia | Chroma Therapeutics Ltd | 24/07/2009 | |
| EU/3/09/660 | Trabedersen | Treatment of pancreatic cancer | Antisense Pharma GmbH | 24/07/2009 | |
| EU/3/09/661 | (S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate | Treatment of carcinoid tumours | Lexicon Celtic Limited | 8/10/2009 | |
| EU/3/09/663 | Adeno-associated viral vector containing modified U1 snRNA | Treatment of Duchenne muscular dystrophy | Amsterdam Molecular Therapeutics (AMT) B.V. | 8/10/2009 | |
| EU/3/09/664 | Allogeneic ex vivo expanded umbilical cord blood cells | Treatment of myelodysplastic syndromes | TEVA Pharma GmbH | 8/10/2009 | |
| EU/3/09/665 | Allogeneic ex vivo expanded umbilical cord blood cells | Treatment of chronic myeloid leukaemia | TEVA Pharma GmbH | 8/10/2009 | |
| EU/3/09/666 | Eicosapentaenoic acid | Treatment of familial adenomatous polyposis | S.L.A. Pharma (UK) Ltd | 8/10/2009 | |
| EU/3/09/667 | Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue | Treatment of anal fistula | Cellerix S.A. | 8/10/2009 | |
| EU/3/09/669 | Low molecular weight dextran sulfate | Prevention of graft rejection during pancreatic islet transplantation | TikoMed AB | 9/10/2009 | |
| EU/3/09/670 | pasireotide | Treatment of acromegaly | Novartis Europharm Ltd | 8/10/2009 | |
| EU/3/09/671 | pasireotide | Treatment of Cushing's disease | Novartis Europharm Ltd | 8/10/2009 | Signifor EU/1/12/753/... 24/04/2012 |
| EU/3/09/672 | Pomalidomide | Treatment of multiple myeloma | Celgene Europe Limited | 8/10/2009 | |
| EU/3/09/673 | Recombinant antibody construct against human CD30 and CD16A | Treatment of Hodgkin lymphoma | Affimed Therapeutics AG | 9/10/2009 | |
| EU/3/09/674 | Recombinant human serum amyloid P | Prevention of scarring post glaucoma filtration surgery | Appletree Europe S.à.r.l. | 9/10/2009 | |
| EU/3/09/675 | Sequence-modified recombinant human factor VIIa | Treatment of haemophilia A | Bayer Schering Pharma AG | 9/10/2009 | |
| EU/3/09/676 | Sequence-modified recombinant human factor VIIa | Treatment of haemophilia B | Bayer Schering Pharma AG | 8/10/2009 | |
| EU/3/09/677 | Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys | Treatment of acute lung injury | Apeptico Forschung und Entwicklung GmbH | 8/10/2009 | |
| EU/3/09/679 | 4-benzyl-2-naphtalen-1-yl-1,2,4-thiadiazolidine-3,5-dione | Treatment of progressive supranuclear palsy | NOSCIRA, S.A. | 28/10/2009 | |
| EU/3/09/680 | 5'-O-(trans-9''-octadecenoyl)-1-beta-D-2'-deoxy-2',2'-difluorocytidine | Treatment of pancreatic cancer | Clovis Oncology UK Limited | 28/10/2009 | |
| EU/3/09/681 | 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide | Treatment of Huntington´s disease | Siena Biotech SpA | 28/10/2009 | |
| EU/3/09/683 | Cholic acid | Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid | FGK Representative Service GmbH | 28/10/2009 | |
| EU/3/09/684 | Masitinib mesilate | Treatment of pancreatic cancer | AB Science | 28/10/2009 | |
| EU/3/09/685 | N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride | Treatment of pancreatic cancer | Merck KGaA | 9/11/2009 | |
| EU/3/09/686 | NGR-human tumour necrosis factor | Treatment of hepatocellular carcinoma | MolMed S.p.A. | 9/11/2009 | |
| EU/3/09/689 | Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis | Treatment of myasthenia gravis | CuraVac Europe SPRL | 9/11/2009 | |
| EU/3/09/690 | Human anthrax immunoglobulin | Post-exposure prophylaxis of inhalation anthrax disease | Emergent Sales and Marketing Germany GmbH | 9/11/2009 | |
| EU/3/09/691 | Human anthrax immunoglobulin | Treatment of inhalation anthrax disease | Emergent Sales and Marketing Germany GmbH | 5/11/2009 | |
| EU/3/09/692 | 16-base single-stranded PNA oligonucleotide linked to a 7-aminoacid peptide | Treatment of neuroblastoma | Biogenera srl | 25/11/2009 | |
| EU/3/09/693 | 1-Cyclopropyl-3-[3-(5-morpholin-4-ylmethyl-1H-benzoimidazol-2-yl)-1H-pyrazol-4-yl]-urea | Treatment of acute myeloid leukaemia | Astex Therapeutics Limited | 26/11/2009 | |
| EU/3/09/694 | 6-thioguanine (oral liquid) | Treatment of acute lymphoblastic leukaemia | Only For Children Pharmaceuticals | 26/11/2009 | |
| EU/3/09/695 | 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-1,2,4-triazolo[3,4-f][1,6]naphthyridin-3(2H)-one mono-hydrochloride | Treatment of ovarian cancer | Merck Sharp & Dohme Limited | 30/11/2009 | |
| EU/3/09/696 | Human MHC non-restricted cytotoxic T-cell line | Treatment of ovarian cancer | Abiogen Pharma S.p.A. | 30/11/2009 | |
| EU/3/09/697 | N-[6-(cis-2,6-dimethylmorpholin-4-yl)pyridine-3-yl]-2-methyl-4'-(trifluoromethoxy)[1,1'-biphenyl]-3-carboxamide | Treatment of naevoid basal cell carcinoma syndrome (Gorlin syndrome) | Novartis Europharm Limited | 25/11/2009 | |
| EU/3/09/698 | Pegylated carboxyhaemoglobin | Treatment of sickle cell disease | Voisin Consulting S.A.R.L. | 26/11/2009 | |
| EU/3/09/699 | Recombinant chimeric monoclonal antibody against CD20 | Treatment of chronic lymphocytic leukaemia | LFB-Biotechnologies | 26/11/2009 | |
| EU/3/09/700 | Vaccinia GM-CSF/TK-deactivated virus | Treatment of hepatocellular carcinoma | Transgene S.A. | 26/11/2009 | |
| EU/3/09/701 | 2-iminobiotin | Treatment of perinatal asphyxia | Neurophyxia B.V. | 28/01/2010 | |
| EU/3/09/702 | Beta-artemether / lumefantrine (powder for oral suspension) | Treatment of malaria | Dafra Pharma International NV | 28/01/2010 | |
| EU/3/09/703 | Brivudine | Treatment of pancreatic cancer | RESprotect GmbH | 28/01/2010 | |
| EU/3/09/704 | Givinostat | Treatment of systemic-onset juvenile idiopathic arthritis | Italfarmaco S.p.A | 28/01/2010 | |
| EU/3/09/705 | Human monoclonal antibody against Pseudomonas aeruginosa IATS-O1 | Treatment of pneumonia caused by serotype O1 Pseudomonas aeruginosa | Envestia Limited | 28/01/2010 | |
| EU/3/09/706 | Lithium citrate tetrahydrate (in reverse-micelle formulation) | Treatment of Huntington´s disease | Medesis Pharma | 28/01/2010 | |
| EU/3/09/707 | Macitentan | Treatment of idiopathic pulmonary fibrosis | Actelion Registration Limited | 28/01/2010 | |
| EU/3/09/708 | Pegylated recombinant phenylalanine ammonia lyase | Treatment of hyperphenylalaninaemia | BioMarin Europe Ltd | 28/01/2010 | |
| EU/3/09/709 | Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule | Treatment of glioma | Apogenix GmbH | 28/01/2010 | |
| EU/3/09/710 | Recombinant human elafin | Treatment of oesophagus carcinoma | Proteo Biotech AG | 28/01/2010 | |
| EU/3/09/711 | Recombinant human vascular endothelial growth factor | Treatment of amyotrophic lateral sclerosis | NeuroNova AB | 29/01/2010 | |
| EU/3/09/712 | Recombinant kallikrein inhibitor | Treatment of Netherton syndrome | Dermadis S.A.S. | 29/01/2010 | |
| EU/3/09/713 | Veltuzumab | Treatment of chronic lymphocytic leukaemia | Immunomedics GmbH | 29/01/2010 | |
| EU/3/09/715 | Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] | Treatment of acute lymphoblastic leukaemia | ARIAD Pharma Ltd | 2/02/2010 | |
| EU/3/09/716 | Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] | Treatment of chronic myeloid leukaemia | ARIAD Pharma Ltd | 2/02/2010 | |
| EU/3/09/717 | Ecopipam | Treatment of Lesch-Nyhan disease | Dr Alain Munoz | 3/02/2010 | |
| EU/3/09/718 | Fingolimod | Treatment of chronic inflammatory demyelinating polyneuropathy | Novartis Europharm Ltd | 2/02/2010 | |
| EU/3/09/719 | Givinostat | Treatment of polycythaemia vera | Italfarmaco S.p.A | 3/02/2010 | |
| EU/3/09/720 | Lentiviral vector containing the human ABCA4 gene | Treatment of Stargardt´s disease | Oxford Biomedica (UK) Ltd | 2/02/2010 | |
| EU/3/09/723 | Recombinant fusion protein linking human coagulation factor IX with human albumin | Treatment of haemophilia B | CSL Behring GmbH | 4/02/2010 | |
| EU/3/09/724 | Recombinant human monoclonal antibody to human interleukin (IL)-17A of the IgG1/k class | Treatment of chronic non-infectious uveitis | Novartis Europharm Ltd | 2/02/2010 | |
| EU/3/09/725 | RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´ [2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride | Treatment of Duchenne muscular dystrophy | AVI BioPharma International Ltd | 2/02/2010 | |
| EU/3/10/726 | Taliglucerase alfa | Treatment of Gaucher Disease | Protalix B.V | 23/03/2010 | |
| EU/3/10/727 | Lentiviral vector containing the human MYO7A gene | Treatment of retinitis pigmentosa in Usher syndrome 1B | Oxford Biomedica (UK) Ltd | 23/03/2010 | |
| EU/3/10/728 | Davunetide | Treatment of progressive supranuclear palsy | FGK Representative Service GmbH | 23/03/2010 | |
| EU/3/10/730 | Raloxifene hydrochloride | Treatment of hereditary haemorrhagic telangiectasia | Consejo Superior de Investigaciones Cientificas (CSIC) | 10/06/2010 | |
| EU/3/10/731 | Bafetinib | Treatment of chronic myeloid leukaemia | Eudax Srl | 10/06/2010 | |
| EU/3/10/732 | Entinostat | Treatment of Hodgkin's lymphoma | Nexus Oncology Ltd. | 10/06/2010 | |
| EU/3/10/733 | Glyceryl tri-(4-phenylbutyrate) | Treatment of carbamoyl-phosphate synthase-1 deficiency | Hyperion Therapeutics Limited | 10/06/2010 | |
| EU/3/10/734 | Glyceryl tri-(4-phenylbutyrate) | Treatment of ornithine carbamoyltransferase deficiency | Hyperion Therapeutics Limited | 10/06/2010 | |
| EU/3/10/735 | Glyceryl tri-(4-phenylbutyrate) | Treatment of citrullinaemia type 1 | Hyperion Therapeutics Limited | 10/06/2010 | |
| EU/3/10/736 | Glyceryl tri-(4-phenylbutyrate) | Treatment of argininosuccinic aciduria | Hyperion Therapeutics Limited | 10/06/2010 | |
| EU/3/10/737 | Glyceryl tri-(4-phenylbutyrate) | Treatment of hyperargininaemia | Hyperion Therapeutics Limited | 10/06/2010 | |
| EU/3/10/738 | Glyceryl tri-(4-phenylbutyrate) | Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) | Hyperion Therapeutics Limited | 10/06/2010 | |
| EU/3/10/739 | Glyceryl tri-(4-phenylbutyrate) | Treatment of citrullinaemia type 2 | Hyperion Therapeutics Limited | 10/06/2010 | |
| EU/3/10/740 | Perifosine | Treatment of multiple myeloma | Æterna Zentaris GmbH | 10/06/2010 | |
| EU/3/10/741 | Pralatrexate | Treatment of cutaneous T-cell lymphoma | Choice Pharma Limited | 10/06/2010 | |
| EU/3/10/742 | 2-methoxymethyl-2-hydroxymethyl-1-azabicyclo[2,2,2]octan-3-one | Treatment of acute myeloid leukaemia | Aprea AB | 10/06/2010 | |
| EU/3/10/744 | Adrenomedullin | Treatment of acute lung injury | Mondobiotech Laboratories AG | 9/06/2010 | |
| EU/3/10/745 | Dexamethasone (40 mg tablet) | Treatment of multiple myeloma | Laboratoires CTRS (Cell Therapies Research & Services) | 9/06/2010 | |
| EU/3/10/746 | Maytansinoid-conjugated humanised monoclonal antibody against CD56 | Treatment of Merkel cell carcinoma | ImmunoGen Europe Limited | 9/06/2010 | |
| EU/3/10/747 | N-{2-Chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N´-(5-methyl-3-isoxazolyl) urea hydrochloride monohydrate | Treatment of renal cell carcinoma | Aveo Pharma Ltd | 9/06/2010 | |
| EU/3/10/748 | Pravastatin / zoledronic acid | Treatment of Hutchinson-Gilford progeria | Prenyl BIO SAS | 9/06/2010 | |
| EU/3/10/749 | Recombinant human anti-interferon gamma monoclonal antibody | Treatment of haemophagocytic lymphohistiocytosis | NovImmune B.V. | 9/06/2010 | |
| EU/3/10/750 | Rifapentine | Treatment of tuberculosis | Sanofi Aventis | 9/06/2010 | |
| EU/3/10/751 | Synthetic double-stranded siRNA oligonucleotide directed against p53 mRNA | Prevention of delayed graft function after renal transplantation | Verius Limited | 9/06/2010 | |
| EU/3/10/752 | Velaglucerase alfa | Treatment of Gaucher disease | Shire Pharmaceuticals Ireland Limited | 9/06/2010 | VPRIV EU/1/10/646/... 26/08/2010 |
| EU/3/10/753 | 6alpha-ethyl-chenodeoxycholic acid | Treatment of primary biliary cirrhosis | Intercept Pharma | 27/07/2010 | |
| EU/3/10/754 | Heparin-activated recombinant human fibroblast growth factor 1 (on a biodegradable device made from alpha-calcium sulphate hemihydrate) | Treatment of traumatic spinal cord injury | BioArctic Neuroscience AB | 27/07/2010 | |
| EU/3/10/755 | Octenidine dihydrochloride | Prevention of late-onset sepsis in premature infants of less than or equal to 32 weeks of gestational age | Schülke & Mayr GmbH | 27/07/2010 | |
| EU/3/10/756 | Tranilast | Prevention of scarring post glaucoma filtration surgery | Altacor Ltd | 27/07/2010 | |
| EU/3/10/757 | Pomalidomide | Treatment of primary myelofibrosis | Celgene Europe Limited | 27/07/2010 | |
| EU/3/10/758 | Pomalidomide | Treatment of post-polycythaemia vera myelofibrosis | Celgene Europe Limited | 27/07/2010 | |
| EU/3/10/759 | Pomalidomide | Treatment of post-essential thrombocythaemia myelofibrosis | Celgene Europe Limited | 27/07/2010 | |
| EU/3/10/760 | (3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt | Treatment of ovarian cancer | Merck Sharp & Dohme Limited | 4/08/2010 | |
| EU/3/10/761 | 3-(6-(1-(2,2-difluorobenzo [d] [1,3] dioxol-5-yl)cyclopropanecarboxamido)-3-methylpyridin-2-yl)benzoic acid | Treatment of cystic fibrosis | Voisin Consulting SARL | 4/08/2010 | |
| EU/3/10/762 | Bosutinib | Treatment of chronic myeloid leukaemia | Pfizer Limited | 4/08/2010 | |
| EU/3/10/764 | Everolimus | Treatment of tuberous sclerosis | Novartis Europharm Ltd | 4/08/2010 | Votubia EU/1/11/710/... 2/09/2011 |
| EU/3/10/765 | Midostaurin | Treatment of mastocytosis | Novartis Europharm Ltd | 4/08/2010 | |
| EU/3/10/766 | Pyr-His-Trp-Ser-Tyr-D-Lys(doxorubicinylglutarate)-Leu-Arg-Pro-Gly-NH2, acetate salt | Treatment of ovarian cancer | Æterna Zentaris GmbH | 4/08/2010 | |
| EU/3/10/767 | 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene | Treatment of post-essential thrombocythaemia myelofibrosis | Voisin Consulting S.A.R.L. | 25/08/2010 | |
| EU/3/10/768 | 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene | Treatment of primary myelofibrosis | Voisin Consulting S.A.R.L. | 25/08/2010 | |
| EU/3/10/769 | 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene | Treatment of post-polycythaemia vera myelofibrosis | Voisin Consulting S.A.R.L. | 25/08/2010 | |
| EU/3/10/770 | 1-[2-(Benzo[1,2,5]thiadiazol-5-ylamino)-6-(2,6-dichloro-phenyl)-pyrido[2,3-d]pyrimidin-7-yl]-3-tert-butyl-urea | Treatment of acute myeloid leukaemia | Sanofi Aventis | 20/09/2010 | |
| EU/3/10/771 | Abarelix | Treatment of low-flow priapism | Speciality European Pharma Ltd | 20/09/2010 | |
| EU/3/10/772 | Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs | Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) | SANFILIPPO Therapeutics SAS | 20/09/2010 | |
| EU/3/10/773 | Allogeneic T cells encoding an exogenous TK gene | Treatment of acute myeloid leukaemia | LTKFarma | 20/09/2010 | |
| EU/3/10/774 | Allogeneic human dermal fibroblasts | Treatment of epidermolysis bullosa | Intercytex Ltd | 20/09/2010 | |
| EU/3/10/775 | Autologous bone marrow-derived mononuclear cell fraction | Treatment of thromboangiitis obliterans (Buerger's disease) | t2cure GmbH | 20/09/2010 | |
| EU/3/10/776 | Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose | Treatment of ovarian cancer | Prima Biomed GmbH | 20/09/2010 | |
| EU/3/10/777 | Cyclic pyranopterin monophosphate | Treatment of molybdenum cofactor deficiency type A | Orphatec Pharmaceuticals GmbH | 20/09/2010 | |
| EU/3/10/778 | Cysteamine bitartrate (gastroresistant) | Treatment of cystinosis | Raptor Pharmaceuticals Europe BV | 20/09/2010 | |
| EU/3/10/779 | Eflornithine | Treatment of familial adenomatous polyposis | Cancer Prevention Pharma Limited | 20/09/2010 | |
| EU/3/10/780 | Forodesine | Treatment of chronic lymphocytic leukaemia | Mundipharma Research Limited | 20/09/2010 | |
| EU/3/10/781 | Glutathione-pegylated liposomal doxorubicin hydrochloride | Treatment of glioma | to-BBB Technologies BV | 20/09/2010 | |
| EU/3/10/782 | Nafamostat mesilate | Treatment of cystic fibrosis | Mucokinetica Ltd | 20/09/2010 | |
| EU/3/10/783 | Recombinant fusion protein consisting of human coagulation factor VIII attached to the Fc domain of human IgG1 | Treatment of haemophilia A | Biogen Idec Limited | 20/09/2010 | |
| EU/3/10/784 | Recombinant porcine factor VIII (B domain deleted) | Treatment of haemophilia A | Inspiration Biopharmaceuticals EU Limited | 20/09/2010 | |
| EU/3/10/785 | Vorinostat | Treatment of malignant mesothelioma | Merck Sharp & Dohme Limited | 20/09/2010 | |
| EU/3/10/786 | Heat-killed Mycobacterium vaccae (whole cell) | Treatment of tuberculosis | Immodulon Therapeutics Ltd | 20/09/2010 | |
| EU/3/10/787 | (3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt | Treatment of mantle cell lymphoma | Merck Sharp & Dohme Limited | 1/10/2010 | |
| EU/3/10/788 | (S)-10-[(dimethylamino)methyl]-4-ethyl-9-hydroxy-4-O-[alpha-(2´´, 4´´, 5´´, 7´´-tetranitro-9´´-fluorenylideneaminooxy)propionyl]-1H-pyrano[3´, 4´, 6´, 7´]indolizino[1,2-beta]-quinoline-3, 14-(4H), 12H)-dione, hydrochloride | Treatment of hepatocellular carcinoma | TLC Biopharmaceuticals B.V. | 1/10/2010 | |
| EU/3/10/789 | 16-base single-stranded peptide nucleic acid oligonucleotide linked to a 7-amino acid peptide | Treatment of medulloblastoma | Biogenera srl | 1/10/2010 | |
| EU/3/10/791 | Ciclosporin | Treatment of moderate and severe closed traumatic brain injury | NeuroVive Pharmaceutical AB | 1/10/2010 | |
| EU/3/10/792 | Maytansinoid-conjugated humanised monoclonal antibody against CD56 | Treatment of small cell lung cancer | ImmunoGen Europe Limited | 1/10/2010 | |
| EU/3/10/793 | N-(6-(2-aminophenylamino)-6-oxohexyl)-4-methylbenzamide | Treatment of Friedreich's ataxia | Repligen Europe Limited | 1/10/2010 | |
| EU/3/10/794 | N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate | Treatment of primary myelofibrosis | Sanofi Aventis | 1/10/2010 | |
| EU/3/10/795 | Pralatrexate | Treatment of Hodgkin's lymphoma | Allos Therapeutics Limited | 1/10/2010 | |
| EU/3/10/796 | Recombinant humanised anti-human interleukin-1 beta monoclonal antibody | Treatment of Behçet's disease | Les Laboratoires Servier | 1/10/2010 | |
| EU/3/10/797 | Recombinant humanised monoclonal antibody to human Nogo-A protein of the IgG1/kappa class | Treatment of amyotrophic lateral sclerosis | Glaxo Group Limited | 1/10/2010 | |
| EU/3/10/798 | Synthetic double-stranded short interfering RNA oligonucleotide directed against proopiomelanocortin | Treatment of adrenocorticotropin-dependent Cushing´s syndrome | UKR Regulatory Affairs Ltd | 1/10/2010 | |
| EU/3/10/799 | Tecovirimat | Treatment of cowpox infection | SIGA Pharmaceuticals (Europe) Ltd | 1/10/2010 | |
| EU/3/10/802 | 2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione | Treatment of idiopathic pulmonary fibrosis | GenKyoTex Innovation S.A.S | 26/11/2010 | |
| EU/3/10/803 | Chimeric monoclonal antibody against claudin-18 splice variant 2 | Treatment of gastric cancer | GANYMED Pharmaceuticals AG | 26/11/2010 | |
| EU/3/10/804 | Methylthioninium | Treatment of progressive supranuclear palsy | Prof. Claude Wischik | 26/11/2010 | |
| EU/3/10/805 | Methylthioninium | Treatment of behavioural variant frontotemporal dementia | Prof. Claude Wischik | 26/11/2010 | |
| EU/3/10/806 | Methylthioninium | Treatment of progressive non-fluent aphasia | Prof. Claude Wischik | 26/11/2010 | |
| EU/3/10/807 | Methylthioninium | Treatment of frontotemporal dementia with parkinsonism-17 | Prof. Claude Wischik | 26/11/2010 | |
| EU/3/10/808 | Murine monoclonal antibody against CD26 | Treatment of graft-versus-host disease | ADIENNE S.r.l. | 26/11/2010 | |
| EU/3/10/809 | Nanoparticle albumin-bound paclitaxel | Treatment of pancreatic cancer | Celgene Europe Limited | 26/11/2010 | |
| EU/3/10/810 | N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate | Treatment of post-essential thrombocythaemia myelofibrosis | Sanofi Aventis | 26/11/2010 | |
| EU/3/10/811 | N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate | Treatment of post-polycythaemia vera myelofibrosis | Sanofi Aventis | 26/11/2010 | |
| EU/3/10/812 | Recombinant fusion protein consisting of the extracellular portion of human activin receptor IIB linked to the human IgG1 Fc domain | Treatment of Duchenne muscular dystrophy | Shire Pharmaceuticals Ireland Limited | 26/11/2010 | |
| EU/3/10/813 | Recombinant human arylsulfatase A | Treatment of metachromatic leukodystrophy | Shire Pharmaceuticals Ireland Limited | 26/11/2010 | |
| EU/3/10/814 | Recombinant human von Willebrand factor | Treatment of von Willebrand disease | Baxter Innovations GmbH | 26/11/2010 | |
| EU/3/10/815 | Sildenafil citrate | Treatment of postcardiotomy right ventricular failure | Pfizer Limited | 26/11/2010 | |
| EU/3/10/816 | 7-beta-hydroxycholesteryl-3-beta-oleate | Treatment of glioma | Intsel Chimos SA | 17/12/2010 | |
| EU/3/10/817 | Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene | Treatment of rhodopsin-linked retinitis pigmentosa | Genable Technologies Ltd | 17/12/2010 | |
| EU/3/10/818 | Human heterologous liver cells (for infusion) | Treatment of citrullinaemia type 1 | Cytonet GmbH & Co. KG | 17/12/2010 | |
| EU/3/10/819 | Human heterologous liver cells (for infusion) | Treatment of hyperargininaemia | Cytonet GmbH & Co. KG | 17/12/2010 | |
| EU/3/10/820 | Human heterologous liver cells (for infusion) | Treatment of argininosuccinic aciduria | Cytonet GmbH & Co. KG | 17/12/2010 | |
| EU/3/10/821 | Human heterologous liver cells (for infusion) | Treatment of carbamoyl-phosphate synthase-1 deficiency | Cytonet GmbH & Co. KG | 17/12/2010 | |
| EU/3/10/822 | Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene | Treatment of Fanconi anaemia type A | Center for Biomedical Network Research on Rare Diseases (CIBERER) | 17/12/2010 | |
| EU/3/10/823 | Lomitapide | Treatment of familial chylomicronaemia | Aegerion Pharmaceuticals | 17/12/2010 | |
| EU/3/10/824 | N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl) amino] isonicotinamide hydrochloride | Treatment of acute myeloid leukaemia | Merck KGaA | 17/12/2010 | |
| EU/3/10/825 | Ovine anti-colchicine polyclonal antibody fragments | Treatment of colchicine poisoning | Laboratoires SERB | 17/12/2010 | |
| EU/3/10/826 | Para-aminosalicylic acid | Treatment of tuberculosis | Lucane Pharma SA | 17/12/2010 | |
| EU/3/10/827 | Recombinant human lysosomal acid lipase | Treatment of lysosomal acid lipase deficiency | Synageva BioPharma Ltd. | 17/12/2010 | |
| EU/3/10/828 | Silibinin-C-2',3-dihydrogensuccinate, disodium salt | Prevention of recurrent hepatitis C in liver transplant recipients | Rottapharm S.p.A | 17/12/2010 | |
| EU/3/10/829 | Tesetaxel | Treatment of gastric cancer | Genta Development Limited | 17/12/2010 | |
| EU/3/10/830 | Veliparib | Treatment of ovarian cancer | Abbott Laboratories | 17/12/2010 | |
| EU/3/10/831 | Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin | Treatment of mantle cell lymphoma | Biovest Europe Limited | 23/02/2011 | |
| EU/3/10/832 | Deferiprone | Treatment of sickle cell disease | Apotex Europe B.V. | 23/02/2011 | |
| EU/3/10/833 | Doxorubicin hydrochloride (in heat-sensitive liposomes) | Treatment of hepatocellular carcinoma | Biological Consulting Europe Ltd | 23/02/2011 | |
| EU/3/10/834 | Human plasmin | Treatment of acute peripheral arterial occlusion | Grifols Deutschland GmbH | 23/02/2011 | |
| EU/3/10/835 | Maytansinoid-conjugated humanised monoclonal antibody against CD56 | Treatment of multiple myeloma | ImmunoGen Europe Limited | 23/02/2011 | |
| EU/3/10/836 | Paquinimod | Treatment of systemic sclerosis | Active Biotech AB | 23/02/2011 | |
| EU/3/10/840 | Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 | Treatment of acute lymphoblastic leukaemia | SymbioTec GmbH | 23/02/2011 | |
| EU/3/10/841 | Tasimelteon | Treatment of non-24-hour sleep-wake disorders in blind people with no light perception | Vanda Pharmaceuticals Limited | 23/02/2011 | |
| EU/3/10/842 | Nimorazole | Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy | Azanta A/S | 23/02/2011 | |
| EU/3/10/843 | Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix | Prevention of arteriovenous access failure in haemodialysis patients | Gregory Fryer Associates Ltd | 23/02/2011 | |
| EU/3/10/844 | Axitinib | Treatment of renal cell carcinoma | Pfizer Limited | 23/02/2011 | |
| EU/3/10/845 | Dry extract from birch bark (DER 0.1-0.2:1), extraction solvent n-heptane 95% (V/V) | Treatment of epidermolysis bullosa | Birken AG | 23/02/2011 | |
| EU/3/10/846 | Paclitaxel (aqueous gel) | Treatment of oesophagus carcinoma | BTG plc | 23/02/2011 | |
| EU/3/10/847 | Pegylated B-domain-deleted sequence-modified recombinant human factor VIII | Treatment of haemophilia A | Bayer Schering Pharma AG | 23/02/2011 | |
| EU/3/10/848 | Sodium thiosulfate | Treatment of calciphylaxis | Dr Franz Köhler Chemie GmbH | 23/02/2011 | |
| EU/3/11/849 | (S)-{8-fluoro-2-2[4-(3-methoxyphenyl)-1-piperazinyl]-3-[2-methoxy-5-(trifluoromethyl)-phenyl]-3,4-dihydro-4-quinazolinyl} acetic acid | Prevention of cytomegalovirus disease in patients with impaired cell-mediated immunity deemed at risk | AiCuris GmbH & Co. KG | 15/04/2011 | |
| EU/3/11/850 | Darinaparsin | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | ZIOPHARM Oncology Ltd | 15/04/2011 | |
| EU/3/11/851 | Glufosfamide | Treatment of pancreatic cancer | Theradex (Europe) Ltd. | 15/04/2011 | |
| EU/3/11/852 | Human anthrax monoclonal antibody | Treatment of inhalation anthrax disease | Emergent Sales and Marketing Germany GmbH | 15/04/2011 | |
| EU/3/11/853 | Ombrabulin | Treatment of soft tissue sarcoma | Sanofi Aventis | 15/04/2011 | |
| EU/3/11/854 | Vorinostat | Treatment of multiple myeloma | Merck Sharp & Dohme Limited | 15/04/2011 | |
| EU/3/11/855 | Recombinant fusion protein linking human coagulation factor VIIa with human albumin | Treatment of haemophilia A | CSL Behring GmbH | 15/04/2011 | |
| EU/3/11/856 | Recombinant thymidine phosphorylase encapsulated in autologous erythrocytes | Treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) due to thymidine phosphorylase deficiency | St George's University of London | 15/04/2011 | |
| EU/3/11/857 | Synthetic double-stranded siRNA oligonucleotide directed against transthyretin mRNA | Treatment of familial amyloid polyneuropathy | Voisin Consulting SARL | 15/04/2011 | |
| EU/3/11/858 | R-baclofen | Treatment of fragile X syndrome | Lakeside Regulatory Consulting Services Ltd | 15/04/2011 | |
| EU/3/11/859 | [N-((2S,3R,3aS,3´R,4a´R,6S,6a´R,6b´S,7aR,12a´S,12b´S,Z)-3,6,11´,12b´-tetramethyl-2´,3a,3´,4,4´,4a´,5,5´,6,6´,6a´,6b´,7,7a,7´,8´,10´,12´,12a´,12b´-icosahydro-1´H,3H-spiro[furo[3,2-b]pyridine-2,9´-naphtho[2,1-a]azulene]-3´-yl)methanesulfonamide hydrochloride] | Treatment of chondrosarcoma | Voisin Consulting S.A.R.L. | 13/05/2011 | |
| EU/3/11/860 | Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene | Treatment of Leber´s hereditary optic neuropathy | Institut de la Vision | 13/05/2011 | |
| EU/3/11/861 | 9-cis-Retinyl acetate | Treatment of Leber's congenital amaurosis | QLT Ophthalmics (UK), Ltd | 13/05/2011 | |
| EU/3/11/862 | Apomorphine hydrochloride | Treatment of moderate and severe traumatic brain injury | Dr Elkan Raphael Gamzu | 13/05/2011 | |
| EU/3/11/863 | Recombinant fusion protein linking human coagulation factor VIIa with human albumin | Treatment of haemophilia B | CSL Behring GmbH | 13/05/2011 | |
| EU/3/11/864 | Adeno-associated viral vector containing the human ARSB gene | Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) | Fondazione Telethon | 13/05/2011 | |
| EU/3/11/865 | 9-cis-Retinyl acetate | Treatment of retinitis pigmentosa | QLT Ophthalmics (UK), Ltd | 13/05/2011 | |
| EU/3/11/866 | Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2 | Treatment of acute myeloid leukaemia | Fate Therapeutics, LTD | 13/05/2011 | |
| EU/3/11/867 | Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2 | Treatment of acute myeloid leukaemia | Fate Therapeutics, LTD | 13/05/2011 | |
| EU/3/11/868 | Lenalidomide | Treatment of diffuse large B-cell lymphoma | Celgene Europe Limited | 13/05/2011 | |
| EU/3/11/869 | Lisuride hydrogen maleate | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Sinoxa Pharma UG | 13/05/2011 | |
| EU/3/11/870 | S-nitrosoglutathione | Treatment of pre-eclampsia | Salupont Consulting Ltd | 13/05/2011 | |
| EU/3/11/871 | Salirasib | Treatment of pancreatic cancer | TMC Pharma Services Ltd | 21/06/2011 | |
| EU/3/11/872 | Sulfonated monophosphorylated mannose oligosaccharide | Treatment of hepatocellular carcinoma | S-cubed Ltd | 21/06/2011 | |
| EU/3/11/873 | Human dermal fibroblasts cultured on a bioresorbable polyglactin mesh | Treatment of epidermolysis bullosa | TMC Pharma Services Ltd | 21/06/2011 | |
| EU/3/11/874 | Human embryonic stem-cell-derived retinal pigment epithelial cells | Treatment of Stargardt’s disease | TMC Pharma Services Ltd | 21/06/2011 | |
| EU/3/11/875 | Metronidazole | Treatment of pouchitis | FORMAC Pharmaceuticals NV | 21/06/2011 | |
| EU/3/11/876 | Viral vector containing DNA encoding the human SMN protein | Treatment of 5q spinal muscular atrophy | University of Sheffield | 21/06/2011 | |
| EU/3/11/877 | Adeno-associated viral vector serotype 9 containing the human sulfamidase gene | Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) | Laboratorios del Dr. Esteve, S.A. | 21/06/2011 | |
| EU/3/11/878 | Allogeneic T cells encoding an exogenous TK gene | Treatment of acute lymphoblastic leukaemia | LTKFarma | 21/06/2011 | |
| EU/3/11/879 | Chimeric monoclonal antibody against GD2 | Treatment of neuroblastoma | United Therapeutics Europe Ltd | 21/06/2011 | |
| EU/3/11/880 | Genetically modified human adenovirus encoding human PH20 hyaluronidase | Treatment of pancreatic cancer | VCN Biosciences S.L. | 21/06/2011 | |
| EU/3/11/881 | Acadesine | Treatment of multiple myeloma | Advancell - Advanced In Vitro Cell Technologies S.A. | 5/08/2011 | |
| EU/3/11/882 | Fresolimumab | Treatment of focal segmental glomerulosclerosis | Genzyme Europe BV | 5/08/2011 | |
| EU/3/11/883 | Low molecular weight dextran sulfate | Treatment for mobilisation of progenitor cells prior to stem cell transplantation | TikoMed AB | 5/08/2011 | |
| EU/3/11/884 | Methyl O-4-O-[2-[2-[2-[2-[[N-[(1R)-1-[[4-(aminoiminomethyl)phenyl]methyl]-2-oxo-2-(1-piperidinyl)ethyl]-N2-[(4-methoxy-2,3,6-trimethylphenyl)sulfonyl]-L-a-asparaginyl-4-aminobutanoyl-N6-[5-[(3aS,4S,6aR)-hexahydro-2-oxo-1H-thieno[3,4-d]imidazol-4-yl]-1-oxopentyl]-L-lysyl]amino]ethoxy]ethoxy]ethoxy]ethyl]-2,3-di-O-methyl-6-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-ß-D-glucopyranuronosyl-(1->4)-O-2,3,6-tri-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-a-L-idopyranuronosyl-(1->4)-3-O-methyl-a-D-glucopyranoside 2,6-bis(hydrogen sulfate) octasodium salt | Prevention of ischaemia/reperfusion injury associated with solid organ transplantation | Endotis Pharma | 5/08/2011 | |
| EU/3/11/885 | Mixture of seven synthetic fragments consisting of p21 RAS peptides | Treatment of pancreatic cancer | Targovax AS | 5/08/2011 | |
| EU/3/11/886 | N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt | Treatment of post-polycythaemia vera myelofibrosis | YM BioSciences (UK) Limited | 5/08/2011 | |
| EU/3/11/887 | N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt | Treatment of post-essential thrombocythaemia myelofibrosis | YM BioSciences (UK) Limited | 5/08/2011 | |
| EU/3/11/888 | N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt | Treatment of primary myelofibrosis | YM BioSciences (UK) Limited | 5/08/2011 | |
| EU/3/11/889 | Pegylated recombinant Erwinia chrysanthemi L-asparaginase | Treatment of acute lymphoblastic leukaemia | EUSA Pharma SAS | 5/08/2011 | |
| EU/3/11/890 | Peretinoin | Treatment of hepatocellular carcinoma | Kowa Pharmaceutical Europe Co. Ltd. | 5/08/2011 | |
| EU/3/11/891 | Human anthrax monoclonal antibody | Post-exposure prophylaxis of inhalation anthrax disease | Emergent Sales and Marketing Germany GmbH | 5/08/2011 | |
| EU/3/11/892 | 5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride | Treatment of 5q spinal muscular atrophy | Repligen Europe Limited | 30/08/2011 | |
| EU/3/11/893 | Cardiotrophin-1 | Treatment of acute liver failure | Digna Biotech S.L. | 30/08/2011 | |
| EU/3/11/894 | Everolimus | Treatment of gastric cancer | Novartis Europharm Ltd | 30/08/2011 | |
| EU/3/11/895 | Hydroxy-propyl-beta-cyclodextrin | Treatment of Niemann-Pick disease, type C | Susan French | 30/08/2011 | |
| EU/3/11/896 | Multilamellar microvesicle comprising phosphatidylcholine, sphingomyelin, phosphatidylethanolamine, phosphatidylserine, phospatidylinositol and cholesterol | Treatment of cystic fibrosis | Lamellar Biomedical Ltd | 30/08/2011 | |
| EU/3/11/897 | N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide | Treatment of tuberculosis | Pfizer Limited | 30/08/2011 | |
| EU/3/11/898 | Sirolimus | Treatment of chronic non-infectious uveitis | Santen Oy | 30/08/2011 | |
| EU/3/11/899 | 2,2'-{2-[(1R)-1-({[(2,5-dichlorobenzoyl)amino]acetyl}amino)-3-methylbutyl]-5-oxo-1,3,2-dioxaborolane-4,4-diyl}diacetic acid | Treatment of multiple myeloma | Takeda Global Research and Development Centre (Europe) Ltd. | 27/09/2011 | |
| EU/3/11/900 | 20-pentaerythritol poly (oxy-1,2-ethanediyl)-carboxymethyl-glycinate-7-ethyl-10-hydroxycamptothecine 10-[1,4'-bipiperidine]-1'-carboxylate | Treatment of ovarian cancer | Nektar Therapeutics UK Ltd | 27/09/2011 | |
| EU/3/11/901 | Dinaciclib | Treatment of chronic lymphocytic leukaemia | Merck Sharp & Dohme Limited | 27/09/2011 | |
| EU/3/11/902 | Eflornithine | Treatment of neuroblastoma | Cancer Prevention Pharma Limited | 27/09/2011 | |
| EU/3/11/903 | Genetically modified Lactococcus lactis bacteria containing the human trefoil factor 1 gene | Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy | ActoGeniX N.V. | 27/09/2011 | |
| EU/3/11/904 | Heterologous human adult liver-derived stem cells | Treatment of ornithine transcarbamylase deficiency | Fresenius Medical Care Deutschland GmbH | 27/09/2011 | |
| EU/3/11/905 | Kifunensine | Treatment of alpha-sarcoglycanopathy | Généthon | 27/09/2011 | |
| EU/3/11/906 | Kifunensine | Treatment of beta-sarcoglycanopathy | Généthon | 27/09/2011 | |
| EU/3/11/907 | Kifunensine | Treatment of delta-sarcoglycanopathy | Généthon | 27/09/2011 | |
| EU/3/11/908 | Kifunensine | Treatment of gamma-sarcoglycanopathy | Généthon | 27/09/2011 | |
| EU/3/11/909 | Macitentan | Treatment of pulmonary arterial hypertension | Actelion Registration Limited | 27/09/2011 | |
| EU/3/11/910 | NH2-Cys-Ser-Ser-Val-Thr-Ala-Trp-Thr-Thr-Gly-Cys-Gly-CONH2 | Treatment of traumatic spinal cord injury | PHARMAXON | 27/09/2011 | |
| EU/3/11/911 | Recombinant human galactocerebrosidase | Treatment of globoid cell leukodystrophy (Krabbe disease) | ACE BioSciences A/S | 27/09/2011 | |
| EU/3/11/912 | Reparixin | Prevention of graft rejection in pancreatic islet transplantation | Dompé S.p.A. | 27/09/2011 | |
| EU/3/11/913 | Resminostat | Treatment of hepatocellular carcinoma | 4SC AG | 27/09/2011 | |
| EU/3/11/914 | Smilagenin | Treatment of amyotrophic lateral sclerosis | Phytopharm plc | 27/09/2011 | |
| EU/3/11/915 | 1-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl]thieno[3,2-c]pyridin-3-yl}phenyl)-3-(3-fluorophenyl)urea | Treatment of acute myeloid leukaemia | Abbott Laboratories | 27/10/2011 | |
| EU/3/11/916 | 2-hydroxyoleic acid | Treatment of glioma | Lipopharma Therapeutics SL | 27/10/2011 | |
| EU/3/11/917 | Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene | Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) | Institut Pasteur | 27/10/2011 | |
| EU/3/11/918 | Brivanib alaninate | Treatment of hepatocellular carcinoma | Bristol-Myers Squibb Pharma EEIG | 27/10/2011 | |
| EU/3/11/919 | Clonidine hydrochloride | Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy | BioAlliance Pharma | 27/10/2011 | |
| EU/3/11/920 | Gallium (68Ga)-pasireotide tetraxetan | Diagnosis of gastro-entero-pancreatic neuroendocrine tumours | OctreoPharm Sciences GmbH | 27/10/2011 | |
| EU/3/11/921 | Glycosylation independent lysosomal targeting tagged recombinant human acid alpha glucosidase | Treatment of glycogen storage disease type II (Pompe's disease) | BioMarin Europe Ltd. | 27/10/2011 | |
| EU/3/11/922 | Human platelet antigen-1a immunoglobulin | Prevention of fetal and neonatal alloimmune thrombocytopenia due to human platelet antigen-1a incompatibility | Prophylix Pharma AS | 27/10/2011 | |
| EU/3/11/923 | L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-, complex with keyhole limpet haemocyanin | Treatment of glioma | Orphix Consulting GmbH | 27/10/2011 | |
| EU/3/11/924 | Lenalidomide | Treatment of mantle cell lymphoma | Celgene Europe Limited | 27/10/2011 | |
| EU/3/11/925 | Mifepristone | Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin | Voisin Consulting SARL | 27/10/2011 | |
| EU/3/11/926 | Recombinant human minibody against complement component C5 | Treatment of primary membranoproliferative glomerulonephritis | ADIENNE S.r.l. | 27/10/2011 | |
| EU/3/11/927 | Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol, sodium salt and palmitic acid | Treatment of cystic fibrosis | Pharm Research Associates (UK) Limited | 27/10/2011 | |
| EU/3/11/928 | Cysteamine | Treatment of cystic fibrosis | NovaBiotics Ltd | 9/12/2011 | |
| EU/3/11/929 | Adeno-associated viral vector serotype 8 containing the human AIPL1 gene | Treatment of Leber’s congenital amaurosis type 4 | Fondazione Telethon | 9/12/2011 | |
| EU/3/11/930 | Resminostat | Treatment of Hodgkin's lymphoma | 4SC AG | 9/12/2011 | |
| EU/3/11/931 | Plerixafor | Adjunctive treatment to cytotoxic therapy in acute myeloid leukaemia | Genzyme Europe B.V. | 9/12/2011 | |
| EU/3/11/932 | Pegylated proline-interferon alpha-2b | Treatment of polycythaemia vera | AOP Orphan Pharmaceuticals AG | 9/12/2011 | |
| EU/3/11/933 | Nanoliposomal irinotecan | Treatment of pancreatic cancer | Merrimack Pharmaceuticals UK Limited | 9/12/2011 | |
| EU/3/11/934 | 4-[[9-[(3S)-tetrahydro-3-furanyl]-8-[(2,4,6-trifluorophenyl)amino]-9H-purin-2-yl]amino]-trans-cyclohexanol | Treatment of idiopathic pulmonary fibrosis | Celgene Europe Ltd | 9/12/2011 | |
| EU/3/11/935 | Interferon gamma | Treatment of Friedreich's ataxia | Prof. Roberto Testi | 9/12/2011 | |
| EU/3/11/936 | Human haptoglobin | Treatment of sickle cell disease | Bio Products Laboratory Ltd | 9/12/2011 | |
| EU/3/11/937 | Alpha-tocotrienol quinone | Treatment of Leigh syndrome | Edison Orphan Pharma BV | 9/12/2011 | |
| EU/3/11/938 | Adeno-associated viral vector containing the human factor IX gene | Treatment of haemophilia B | Amsterdam Molecular Therapeutics BV | 11/01/2012 | |
| EU/3/11/939 | Brentuximab vedotin | Treatment of cutaneous T-cell lymphoma | Takeda Global Research and Development Centre (Europe) Ltd | 11/01/2012 | |
| EU/3/11/940 | Chimeric locked nucleic acid-deoxynucleoside phosphorothioate-linked oligonucleotide directed against microRNA-451 | Treatment of polycythaemia vera | Miragen Therapeutics Europe Ltd | 11/01/2012 | |
| EU/3/11/941 | Lipopolysaccharide of Ochrobactrum intermedium | Prevention of sepsis in at-risk premature infants of less than or equal to 32 weeks of gestational age | Diomune S.L. | 11/01/2012 | |
| EU/3/11/942 | Liposomal combination of cytarabine and daunorubicin | Treatment of acute myeloid leukaemia | Celator (UK) Ltd | 11/01/2012 | |
| EU/3/11/943 | Mogamulizumab | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | ProStrakan Limited | 11/01/2012 | |
| EU/3/11/944 | N,N'-bis(2-mercaptoethyl)isophthalamide | Treatment of mercury toxicity | CTI Science Limited | 11/01/2012 | |
| EU/3/11/945 | Ornithine phenylacetate | Treatment of acute liver failure | Dr Ulrich Granzer | 11/01/2012 | |
| EU/3/11/946 | Recombinant homodimer of the human annexin V | Prevention of ischaemia/reperfusion injury associated with solid organ transplantation | Astellas Pharma Europe B.V. | 11/01/2012 | |
| EU/3/11/947 | Recombinant protein consisting of modified human growth hormone releasing hormone and the translocation and endopeptidase domains of botulinum toxin serotype D | Treatment of acromegaly | Syntaxin Limited | 11/01/2012 | |
| EU/3/11/948 | Sodium phenylbutyrate | Treatment of 5q spinal muscular atrophy | GMP-Orphan SAS | 11/01/2012 | |
| EU/3/12/949 | Sodium phenylbutyrate | Treatment of citrullinaemia type 1 | Lucane Pharma SA | 9/02/2012 | |
| EU/3/12/950 | Sodium phenylbutyrate | Treatment of ornithine transcarbamylase deficiency | Lucane Pharma SA | 9/02/2012 | |
| EU/3/12/951 | Sodium phenylbutyrate | Treatment of carbamoyl-phosphate synthase-1 deficiency | Lucane Pharma SA | 9/02/2012 | |
| EU/3/12/952 | Nimorazole maleate | Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy | Conventia Medical LLP | 9/02/2012 | |
| EU/3/12/953 | (1S,3S)-3-amino-4-(difluoromethylene) cyclopentanecarboxylic acid hydrochloride | Treatment of West syndrome | Catalent Pharma Solutions Limited | 9/02/2012 | |
| EU/3/12/954 | S[+] apomorphine | Treatment of amyotrophic lateral sclerosis | University of Sheffield | 9/02/2012 | |
| EU/3/12/955 | Doxycycline hyclate | Treatment of familial amyloid polyneuropathy | Giampaolo Merlini | 2/04/2012 | |
| EU/3/12/956 | Human monoclonal antibody against Fas ligand | Treatment of pemphigus | PinCell s.r.l. | 9/02/2012 | |
| EU/3/12/957 | Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene | Treatment of X-linked chronic granulomatous disease | Généthon | 9/02/2012 | |
| EU/3/12/958 | N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine and folic acid | Diagnosis of positive folate receptor status in ovarian cancer | Endocyte Europe B.V. | 9/02/2012 | |
| EU/3/12/959 | Vincaleukoblastin-23-oic acid, O4-deacetyl-2-[(2-mercaptoethoxy)carbonyl]hydrazide, disulfide with N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-L-gamma-glutamyl-L-alpha-aspartyl-L-arginyl-L-alpha-aspartyl-L-alpha-aspartyl-L-cysteine | Treatment of ovarian cancer | Endocyte Europe B.V. | 9/02/2012 | |
| EU/3/12/960 | Glucagon | Treatment of congenital hyperinsulinism | Biodel UK Limited | 5/03/2012 | |
| EU/3/12/961 | Doxycycline hyclate | Treatment of systemic amyloidosis caused by beta-2 microglobulin | Giampaolo Merlini | 5/03/2012 | |
| EU/3/12/964 | Oleylphosphocholine | Treatment of leishmaniasis | Dafra Pharma International NV | 23/04/2012 | |
| EU/3/12/965 | Ketoconazole | Treatment of Cushing’s syndrome | Laboratoire HRA Pharma | 23/04/2012 | |
| EU/3/12/966 | (1-methyl-2-nitro-1H-imidazole-5-yl)methyl N,N'-bis(2-bromoethyl) diamidophosphate | Treatment of soft tissue sarcoma | Nexus Oncology Ltd. | 5/03/2012 | |
| EU/3/12/967 | Sodium nitrite | Treatment of pulmonary arterial hypertension | FGK Representative Service GmbH | 5/03/2012 | |
| EU/3/12/968 | Human monoclonal antibody targeting Staphylococcus aureus alpha-toxin | Treatment of pneumonia caused by Staphylococcus aureus | Envestia Limited | 5/03/2012 | |
| EU/3/12/970 | 6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2(3H)-one | Treatment of amyotrophic lateral sclerosis | ICON Clinical Research (UK) Limited | 5/03/2012 | |
| EU/3/12/971 | Heterologous human adult liver-derived stem cells | Treatment of carbamoyl-phosphate synthase-1 deficiency | Fresenius Medical Care Deutschland GmbH | 5/03/2012 | |
| EU/3/12/972 | Sialic acid | Treatment of hereditary inclusion body myopathy | NDA Regulatory Science Ltd | 5/03/2012 | |
| EU/3/12/973 | Recombinant human beta-glucuronidase | Treatment of mucopolysaccharidosis type VII (Sly syndrome) | NDA Regulatory Science Ltd | 21/03/2012 | |
| EU/3/12/974 | Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene | Treatment of primary hyperoxaluria type 1 | Amsterdam Molecular Therapeutics BV | 21/03/2012 | |
| EU/3/12/975 | Carbetocin | Treatment of Prader-Willi syndrome | Ferring Pharmaceuticals A/S | 21/03/2012 | |
| EU/3/12/976 | Antisense oligonucleotide targeted to the SMN2 gene | Treatment of 5q spinal muscular atrophy | Isis USA Ltd | 2/04/2012 | |
| EU/3/12/977 | Linsitinib | Treatment of adrenal cortical carcinoma | Astellas Pharma Europe B.V. | 2/04/2012 | |
| EU/3/12/978 | Melatonin | Treatment of perinatal asphyxia | Dr Nicola J Robertson | 2/04/2012 | |
| EU/3/12/979 | Sodium thiosulfate | Treatment of calciphylaxis | Aptiv Solutions (UK) Limited | 2/04/2012 | |
| EU/3/12/980 | Genistein sodium salt dihydrate | Treatment of mucopolysaccharidosis type III (Sanfilippo syndrome) | Axcentua Pharmaceuticals AB | 2/04/2012 | |
| EU/3/12/981 | Adenovirus associated viral vector serotype 2 containing the human RPE65 gene | Treatment of Leber’s congenital amaurosis | Alan Boyd Consultants Ltd | 2/04/2012 | |
| EU/3/12/982 | Dipalmitoylphosphatidylcholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol, sodium salt, synthetic surfactant protein C analogue and synthetic surfactant protein B analogue | Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age | Chiesi Farmaceutici S.P.A. | 2/04/2012 | |
| EU/3/12/983 | Heterologous human adult liver-derived stem cells | Treatment of acute liver failure | Fresenius Medical Care Deutschland GmbH | 26/04/2012 | |
| EU/3/12/984 | 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4 d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one | Treatment of chronic lymphocytic leukaemia | Nexus Oncology Ltd. | 26/04/2012 | |
| EU/3/12/985 | Recombinant human methionine proinsulin | Treatment of retinitis pigmentosa | ProRetina Therapeutics, S.L. | 26/04/2012 | |
| EU/3/12/986 | Pomalidomide | Treatment of systemic sclerosis | Celgene Europe Limited | 26/04/2012 | |
| EU/3/12/987 | (E)-2,4,6-trimethoxystyryl-3-carboxymethylamino-4-methoxybenzyl-sulfone sodium salt | Treatment of myelodysplastic syndromes | JJGConsultancy Ltd | 26/04/2012 | |
| EU/3/12/988 | Halofuginone Hydrobromide | Treatment of Duchenne muscular dystrophy | Biological Consulting Europe Ltd | 26/04/2012 | |
| EU/3/12/989 | 2-Allyl-1-[6-(1-hydroxy-1-methylethyl)pyridin-2-yl]-6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-1,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin-3-one | Treatment of ovarian cancer | Merck Sharp & Dohme Limited | 26/04/2012 | |
| EU/3/12/990 | Vosaroxin | Treatment of acute myeloid leukaemia | Sunesis Europe Ltd | 26/04/2012 | |
| EU/3/12/991 | Exon 45 specific phosphorothioate oligonucleotide | Treatment of Duchenne muscular dystrophy | Prosensa Therapeutics B.V. | 26/04/2012 | |
| EU/3/12/992 | Exon 53 specific phosphorothioate oligonucleotide | Treatment of Duchenne muscular dystrophy | Prosensa Therapeutics B.V. | 26/04/2012 | |
| EU/3/12/993 | N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide | Treatment of neurofibromatosis type 2 | Sirius Regulatory Consulting Limited | 26/04/2012 | |
| EU/3/12/995 | Pegylated recombinant factor VIII | Treatment of haemophilia A | Novo Nordisk A/S | 26/04/2012 |