Navigation path

Pharmaceuticals - Community Register


Register of designated Orphan Medicinal Products (by number)

EU Designation Product Designated Orphan Indication Sponsor Designation date Tradename
EU Centralised Nr
Implemented on
EU/3/00/001 Somatropin AIDS wasting Merck Serono Europe Limited 08/08/2000
EU/3/00/005 Gemtuzumab Ozogamicin Treatment of acute myeloid leukaemia Pfizer Limited 18/10/2000 Mylotarg
EU/3/00/013 Ethyl Eicosopentaenoate Treatment of Huntington's disease Amarin Neuroscience Limited 29/12/2000
EU/3/01/026 L-Lysine-N-acetyl-L-cysteinate Treatment of cystic fibrosis LABORATOIRES SMB SA 14/02/2001
EU/3/01/028 Inolimomab Treatment of Graft versus Host Disease ElsaLys Biotech SAS 05/03/2001
EU/3/01/034 Gusperimus trihydrochloride Treatment of Wegener’s granulomatosis Nordic Group B.V. 29/03/2001
EU/3/01/038 Retroviral gamma-c cDNA containing vector Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease GENOPOIETIC S.A.S. 30/05/2001
EU/3/01/044 Human Alpha1-Proteinase Inhibitor (respiratory use) Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency CSL Behring GmbH 09/07/2001
EU/3/01/049 Ramoplanin Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection Vicuron Pharmaceuticals Italy srl, 09/07/2001
EU/3/01/051 1,3-Propanedisulfonic acid, disodium salt Treatment of Systemic Secondary Amyloidosis C.T. Phinco S.à.r.l. 31/07/2001
EU/3/01/056 Recombinant human acid sphingomyelinase Treatment of Niemann-Pick disease Genzyme Europe B.V. 19/09/2001
EU/3/01/058 Repertaxin L-lysine salt Prevention of delayed graft function in organ transplant Dompé farmaceutici S.p.A. 19/09/2001
EU/3/01/062 Idebenone Treatment of Friedreich’s ataxia Laboratoires Takeda 20/11/2001
EU/3/01/069 Phenylephrine Hydrochloride Treatment of ileal pouch anal anastomosis related faecal incontinence S.L.A. Pharma (UK) Limited 20/11/2001
EU/3/01/074 Halofuginone Hydrobromide Treatment of systemic sclerosis PPD Global Ltd 11/12/2001
EU/3/01/075 Denileukin diftitox Treatment of cutaneous T-cell lymphoma Eisai Limited 11/12/2001
EU/3/01/077 [gly2] Recombinant human glucagon-like peptide Treatment of Short Bowel Syndrome Shire Pharmaceuticals Ireland Limited 11/12/2001 Revestive
EU/3/01/079 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Treatment of acute lung injury Pharm Research Associates (UK) Limited 04/02/2002
EU/3/01/083 Adenovirus-mediated Herpes simplex Virus-thymidine kinase gene Treatment of high-grade glioma with subsequent use of ganciclovir sodium Gliotherapy Limited 06/02/2002
EU/3/01/084 Azacitidine Treatment of myelodysplastic syndromes Celgene Europe Limited 06/02/2002 Vidaza
EU/3/02/091 TGF-beta2 specific phosphorothioate antisense oligodeoxynucleotide Treatment of high-grade glioma Dr Ulrich Granzer 22/03/2002
EU/3/02/093 Beclomethasone 17, 21-dipropionate (oral use) Treatment of intestinal graft-versus-host disease Soligenix UK Ltd 13/03/2002
EU/3/02/094 Chimeric IgG monoclonal antibody cG250 Treatment of renal cell carcinoma Heidelberg Pharma AG 19/03/2002
EU/3/02/096 Nitisinone Treatment of alkaptonuria Swedish Orphan Biovitrum AB (publ) 13/03/2002
EU/3/02/103 Recombinant Human Porphobilinogen Deaminase Treatment of acute intermittent porphyria Zymenex A/S 12/06/2002
EU/3/02/104 Miltefosine Treatment of visceral leishmaniasis Zentaris GmbH 12/06/2002
EU/3/02/106 Antisense NF-K p65 Oligonucleotide Treatment of active ulcerative colitis InDex Pharmaceuticals AB 30/07/2002
EU/3/02/107 Purified bromelain Treatment of partial deep dermal and full thickness burns MediWound Germany GmbH 30/07/2002 NexoBrid
EU/3/02/109 Oregovomab Treatment of ovarian cancer ViRexx International Corp. Limited 30/07/2002
EU/3/02/110 Thymalfasin Treatment of hepatocellular carcinoma SciClone Pharmaceuticals Italy S.r.l 30/07/2002
EU/3/02/111 Benzoic acid, sodium salt Treatment of non-ketotic hyperglycinaemia Lucane Pharma SA 11/09/2002
EU/3/02/115 (-)-17-(cyclopropylmethyl)-3,14 -dihydroxy-4,5 a-epoxy-6-[N-methyl-trans-3-(3-furyl) acrylamido] morphinan hydrochloride Treatment of uremic pruritus Toray International Europe GmbH 11/09/2002
EU/3/02/116 Autologous renal cell tumor vaccine Treatment of renal cell carcinoma Liponova GmbH 21/10/2002
EU/3/02/118 Recombinant glycoprotein gp350 of Epstein-Barr virus Prevention of post transplantation lympho-proliferative disorders Henogen S.A. 22/10/2002
EU/3/02/120 Duramycin Treatment of cystic fibrosis AOP Orphan Pharmaceuticals AG 13/11/2002
EU/3/02/122 Etilefrin Treatment of low flow priapism Laboratoires SERB 13/11/2002
EU/3/02/124 3,4-diaminopyridine phosphate Treatment of Lambert-Eaton myasthenic syndrome BioMarin Europe Ltd 18/12/2002 Firdapse
EU/3/02/127 Cholic acid Treatment of inborn errors in primary bile acid synthesis Laboratoires CTRS 18/12/2002 Orphacol
EU/3/02/128 Carboxypeptidase G2 Adjunctive treatment in patients at risk of methotrexate toxicity BTG Management Services Limited 03/02/2003
EU/3/02/129 G17(9) gastrin-diphtheria toxoid conjugate Treatment of pancreatic cancer Cato Europe GmbH 24/01/2003
EU/3/02/130 G17(9) gastrin-diphtheria toxoid conjugate Treatment of gastric cancer Cato Europe GmbH 28/01/2003
EU/3/03/132 Caffeine citrate Treatment of primary apnoea of premature newborns Chiesi Farmaceutici S.p.A. 17/02/2003 Peyona
EU/3/03/133 Icatibant acetate treatment of angioedema Shire Orphan Therapies GmbH 17/02/2003 Firazyr
EU/3/03/135 Decitabine Treatment of myelodysplastic syndromes Janssen-Cilag International NV 14/02/2003
EU/3/03/140 Tobramycin (inhalation powder) Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Novartis Europharm Limited 17/03/2003 TOBI Podhaler
EU/3/03/145 Rubitecan Treatment of pancreatic cancer Eurogen Pharmaceuticals Limited 10/06/2003
EU/3/03/149 Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate Treatment of pancreatic cancer in combination with ifosfamide Pharmacyte Biotech Europe Limited 30/06/2003
EU/3/03/153 Herpes simplex virus lacking infected cell protein 34.5 Treatment of glioma Virttu Biologics Limited 09/07/2003
EU/3/03/156 Prasterone Treatment of adrenal insufficiency Medicom Healthcare BV 28/07/2003
EU/3/03/157 Recombinant dog gastric lipase Treatment of cystic fibrosis Meristem Therapeutics S.A. 09/07/2003
EU/3/03/160 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Treatment of retinopathy of prematurity Gene Signal SAS 02/10/2003
EU/3/03/161 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Treatment of neovascular glaucoma Gene Signal SAS 02/10/2003
EU/3/03/162 Yttrium (90Y) antiferritin polyclonal antibodies Treatment of Hodgkin lymphoma Mablife 02/10/2003
EU/3/03/163 5,6,7,8-Tetrahydrobiopterin Treatment of hyperphenylalaninemia Orphanetics Pharma Entwicklungs GmbH 02/10/2003
EU/3/03/166 Eculizumab Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe SAS 17/10/2003 Soliris
EU/3/03/168 Herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes Adjunctive treatment in hematopoietic cell transplantation MolMed S.p.A. 20/10/2003 Zalmoxis
EU/3/03/171 Trabectedin Treatment of ovarian cancer Pharma Mar S.A. 17/10/2003 Yondelis
EU/3/03/172 Trientine dihydrochloride Treatment of Wilson's disease Univar BV 24/10/2003
EU/3/03/173 Vasoactive Intestinal Peptide Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension mondoBIOTECH Laboratories AG 22/12/2003
EU/3/03/174 Gimatecan Treatment of glioma Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 01/12/2003
EU/3/03/175 Recombinant antibody derivative against human CD19 and CD3 Treatment of mantle cell lymphoma Amgen Europe B.V. 01/12/2003
EU/3/03/176 Recombinant antibody derivative against human CD19 and CD3 Treatment of chronic lymphocytic leukaemia Amgen Europe B.V. 01/12/2003
EU/3/03/182 5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt Treatment of aneurysmal subarachnoid haemorrhage Idorsia Pharmaceuticals Deutschland GmbH 12/12/2003
EU/3/03/183 Temocillin sodium Treatment of Burkholderia cepacia lung infection in cystic fibrosis Eumedica N.V. 14/01/2004
EU/3/04/186 Treosulfan Conditioning treatment prior to haematopoietic progenitor cell transplantation medac Gesellschaft für klinische Spezialpräparate mbH 23/02/2004
EU/3/04/188 N-3[[4(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl) oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) Treatment of moderate and severe traumatic brain injury Xytis Pharmaceuticals Limited 23/02/2004
EU/3/04/189 Idebenone Treatment of Friedreich’s ataxia Santhera Pharmaceuticals (Deutschland) GmbH 08/03/2004
EU/3/04/192 3-(4'aminoisoindoline-1'-one)-1-piperidine-2,6-dione Treatment of myelodysplastic syndromes Celgene Europe Limited 08/03/2004 Revlimid
EU/3/04/193 Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody Treatment of ovarian cancer Neovii Biotech GmbH 08/03/2004
EU/3/04/194 Adeno-associated viral vector expressing lipoprotein lipase Treatment of lipoprotein lipase deficiency uniQure Biopharma B.V. 08/03/2004 Glybera
EU/3/04/195 2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol Treatment of anaplastic thyroid cancer Diamond BioPharm Limited 14/04/2004
EU/3/04/197 Treprostinil sodium (inhalation use) Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 14/04/2004
EU/3/04/198 Human monoclonal antibody against CD4 Treatment of cutaneous T-cell lymphoma TenX Biopharma Ltd 14/04/2004
EU/3/04/199 Tetrahydrobiopterin Treatment of hyperphenylalaninemia BioMarin International Limited 08/06/2004 Kuvan
EU/3/04/201 Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar Prevention of stenosis in synthetic grafts used in haemodialysis Finvector Vision Therapies Limited 08/06/2004
EU/3/04/202 HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients Cellcure A/S 21/06/2004
EU/3/04/204 Aztreonam lysinate (inhalation use) Treatment of gram negative bacteria lung infections in cystic fibrosis Gilead Sciences Ireland UC 21/06/2004 Cayston
EU/3/04/206 Muramyl tripeptide phosphatidyl ethanolamine Treatment of osteosarcoma Takeda France SAS 21/06/2004 Mepact
EU/3/04/208 Acetylsalicylic acid Treatment of polycythemia vera Bayer HealthCare AG 29/07/2004
EU/3/04/209 Ciclosporin (inhalation use) Prevention of graft rejection after lung transplantation Breath Therapeutics GmbH 29/07/2004
EU/3/04/210 Ciclosporin (inhalation use) Treatment of bronchiolitis obliterans syndrome Breath Therapeutics GmbH 29/07/2004
EU/3/04/211 Defibrotide Prevention of hepatic veno-occlusive disease Gentium S.r.I. 29/07/2004
EU/3/04/212 Defibrotide Treatment of hepatic veno-occlusive disease Gentium S.r.I. 29/07/2004 Defitelio
EU/3/04/213 Mepolizumab Treatment of hypereosinophilic syndrome GlaxoSmithKline Trading Services Limited 29/07/2004
EU/3/04/214 Midostaurin Treatment of acute myeloid leukaemia Novartis Europharm Limited 29/07/2004 Rydapt
EU/3/04/216 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
EU/3/04/217 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
EU/3/04/219 HLA-B27 derived peptide (amino acid 125-138) Treatment of autoimmune uveitis Dr Gerhild Wildner 02/09/2004
EU/3/04/220 Anti epidermal growth factor receptor antibody h-R3 Treatment of glioma Oncoscience AG 02/09/2004
EU/3/04/222 Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency TRX Services Limited 02/09/2004
EU/3/04/227 l, 1'-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane Treatment to mobilize progenitor cells prior to stem cell transplantation Genzyme Europe B.V. 20/10/2004 Mozobil
EU/3/04/229 Doxorubicin polyisohexylcyanoacrylate nanoparticles Treatment of the hepatocellular carcinoma Onxeo 21/10/2004
EU/3/04/230 Dexamethasone sodium phosphate encapsulated in human erythrocytes Treatment of cystic fibrosis Erydel S.p.A. 20/10/2004
EU/3/04/232 Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium Treatment of glioma Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 20/10/2004
EU/3/04/240 Rufinamide Treatment of Lennox-Gastaut syndrome Eisai Limited 20/10/2004 Inovelon
EU/3/04/241 Pirfenidone Treatment of idiopathic pulmonary fibrosis Roche Registration GmbH 16/11/2004 Esbriet
EU/3/04/242 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of mastocytosis AB Science S.A. 16/11/2004
EU/3/04/243 Alpha-1 antitrypsin (inhalation use) Treatment of cystic fibrosis Triskel EU Services Ltd 16/11/2004
EU/3/04/244 Alpha-1 antitrypsin (inhalation use) Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Kamada BioPharma Limited 16/11/2004
EU/3/04/245 Aplidine Treatment of multiple myeloma Pharma Mar S.A. 16/11/2004
EU/3/04/248 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of multiple myeloma CellGenix GmbH 21/12/2004
EU/3/04/249 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of follicular lymphoma CellGenix GmbH 23/12/2004
EU/3/04/250 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of mantle cell lymphoma CellGenix GmbH 21/12/2004
EU/3/04/251 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of malignant gastro intestinal stromal tumours AB Science S.A. 21/12/2004
EU/3/04/260 Recombinant human a-Mannosidase Treatment of α-Mannosidosis Chiesi Farmaceutici S.p.A. 26/01/2005 Lamzede
EU/3/05/261 Fluocinolone acetonide (prolonged-release intravitreal implant) Treatment of non-infectious uveitis affecting the posterior segment of the eye Bausch & Lomb Ireland 07/03/2005
EU/3/05/263 dimethyl sulfoxide Treatment of severe closed traumatic brain injury AOP Orphan Pharmaceuticals AG 03/03/2005
EU/3/05/264 Cholest-4-en-3-one, oxime Treatment of 5q spinal muscular atrophy Roche Registration Limited 10/03/2005
EU/3/05/269 Tipifarnib Treatment of acute myeloid leukaemia TMC Pharma Services Ltd 10/03/2005
EU/3/05/270 Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex Treatment of renal cell carcinoma Antigenics Therapeutics Limited 11/04/2005
EU/3/05/272 Histamine dihydrochloride Treatment of acute myeloid leukaemia Noventia Pharma Srl 11/04/2005 Ceplene
EU/3/05/275 Estradiol Hemihydrate and Progesterone Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age Dr Frank Pohlandt 11/04/2005
EU/3/05/276 Humanized Agonistic Anti-CD28 Monoclonal Antibody Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) TeGenero AG 11/04/2005
EU/3/05/278 (3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid Treatment of Duchenne muscular dystrophy PTC Therapeutics International Limited 27/05/2005 Translarna
EU/3/05/279 (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone Treatment of cutaneous T-cell lymphoma Celgene Europe Limited 27/05/2005
EU/3/05/280 Acadesine Treatment of B-cell chronic lymphocytic leukemia (B-CLL) Advancell - Advanced In Vitro Cell Technologies S.A. 27/05/2005
EU/3/05/282 Miltefosine Treatment of Acanthamoeba keratitis Orpha-Devel Handels und Vertriebs GmbH 27/05/2005
EU/3/05/283 Recombinant megakaryopoeisis-stimulating protein Treatment of idiopathic thrombocytopenic purpura Amgen Europe B.V. 27/05/2005 Nplate
EU/3/05/284 Sodium butyrate (rectal use) Prevention of radiation proctitis Promefarm srl 27/05/2005
EU/3/05/285 Bimosiamose disodium Treatment of acute lung injury Revotar Biopharmaceuticals AG 27/05/2005
EU/3/05/286 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of multiple myeloma Dr Geoffrey Allan 20/06/2005
EU/3/05/287 Bovine bile extract Treatment of pancreatic cancer Dr Ulrich Granzer 20/06/2005
EU/3/05/288 4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HCl Treatment of Huntington's disease Teva GmbH 20/06/2005
EU/3/05/289 Pegylated arginine deiminase Treatment of hepatocellular carcinoma Dr Francesco Izzo 20/06/2005
EU/3/05/290 Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck Viventia Biotech (EU) Limited 20/06/2005
EU/3/05/292 H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Auris Medical Limited 16/06/2005
EU/3/05/294 Soluble yeast beta-1,3/1,6-glucan Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Biotec Pharmacon ASA 16/06/2005
EU/3/05/295 Hepatitis C Immunoglobulin Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 08/07/2005
EU/3/05/296 Hydrocortisone (modified release tablet) Treatment of congenital adrenal hyperplasia Diurnal Limited 27/07/2005
EU/3/05/297 Adeno-associated viral vector containing a modified U7-snRNA gene Treatment of Duchenne muscular dystrophy Généthon 27/07/2005
EU/3/05/299 4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one Treatment of pancreatic cancer ICON Clinical Research (U.K.) Limited 27/07/2005
EU/3/05/300 Nemorubicin hydrochloride Treatment of hepatocellular carcinoma Nerviano Medical Sciences Srl 28/07/2005
EU/3/05/301 Chimeric monoclonal antibody to shiga-toxin 1 and 2 Treatment of shiga-toxin producing bacterial infection. Albany Regulatory Consulting Limited 26/08/2005
EU/3/05/302 Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower Treatment of sickle cell disease Xechem UK Ltd 26/08/2005
EU/3/05/303 Human autologous mesenchymal adult stem cells extracted from adipose tissue Treatment of anal fistula TiGenix S.A.U. 26/08/2005
EU/3/05/307 Mecasermin Treatment of primary growth hormone insensitivity syndrome Ipsen Pharma 26/08/2005
EU/3/05/310 Treprostinil diethanolamine (oral use) Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 26/08/2005
EU/3/05/313 Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency GlaxoSmithKline Trading Services Limited 26/08/2005 Strimvelis
EU/3/05/314 (1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol Treatment of tuberculosis Janssen-Cilag International NV 26/08/2005 Sirturo
EU/3/05/315 (2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide Treatment of progressive myoclonic epilepsies UCB Pharma S.A. 26/08/2005
EU/3/05/317 A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein Treatment of graft-versus-host disease Xenikos B.V. 26/08/2005
EU/3/05/319 Human Staphylococcus aureus immunoglobulin Treatment of Staphylococcus aureus bacteremia Biotest Pharma GmbH 28/10/2005
EU/3/05/323 Bacterial lipase Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Nordmark Arzneimittel GmbH u. Co. KG 07/11/2005
EU/3/05/324 Levamisol hydrochloride Treatment of nephrotic syndrome ACE Pharmaceuticals BV 28/10/2005
EU/3/05/325 Mannitolum Treatment of cystic fibrosis Pharmaxis Pharmaceuticals Limited 07/11/2005 Bronchitol
EU/3/05/326 Peptide 144 TGF- 1 inhibitor (TSLDASIIWAMMQN) Treatment of systemic sclerosis Digna Biotech S.L. 28/10/2005
EU/3/05/327 Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt Treatment of glioma Oligovax 28/10/2005
EU/3/05/328 (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Celgene Europe Limited 28/10/2005
EU/3/05/329 Peptide 144 TGF- 1 inhibitor (TSLDASIIWAMMQN) Treatment of the localised scleroderma Digna Biotech S.L. 28/10/2005
EU/3/05/332 1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine Treatment of acute myeloid leukaemia Vion (UK) Limited, ℅ i3 Research 14/12/2005
EU/3/05/333 Eptacog alfa (activated) Treatment of diffuse alveolar haemorrhage Savara ApS 14/12/2005
EU/3/05/334 Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) Edimer Ltd 14/12/2005
EU/3/05/341 Imexon Treatment of ovarian cancer ICON Clinical Research (U.K.) Limited 23/12/2005
EU/3/05/343 Enzastaurin hydrochloride Treatment of glioma Isabelle Ramirez 23/12/2005
EU/3/05/346 E. Coli heat-shock protein 70 with bovine retinal S-antigen Treatment of autoimmune uveitis Biotech Tools SA 24/01/2006
EU/3/06/349 Apomorphine hydrochloride (inhalation use) Treatment of off-periods in Parkinson’s disease not responding to oral treatment Vectura Group plc 16/02/2006
EU/3/06/350 Alpha-1 proteinase inhibitor Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Octapharma (IP) Limited 16/02/2006
EU/3/06/351 Miglustat Treatment of Niemann-Pick disease, type C Actelion Registration Ltd 16/02/2006 Zavesca
EU/3/06/354 Oxalobacter formigenes strain HC-1 Treatment of primary hyperoxaluria OxThera AB 17/02/2006
EU/3/06/355 Zosuquidar trihydrochloride Treatment of acute myeloid leukaemia Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP 17/02/2006
EU/3/06/356 4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline Treatment of renal cell carcinoma Prodimed S.A. 16/02/2006
EU/3/06/360 Ciclosporin Treatment of vernal keratoconjunctivitis Santen Oy 06/04/2006
EU/3/06/362 Human heterologous liver cells (for infusion) Treatment of acute liver failure Promethera Biosciences 11/04/2006
EU/3/06/363 4-[131I]iodo-L-phenylalanine Treatment of glioma Therapeia GmbH & Co. KG 11/04/2006
EU/3/06/367 Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex Treatment of solitary bone cysts Kuros Biosurgery International AG 11/04/2006
EU/3/06/368 1-deoxygalactonojirimycin hydrochloride Treatment of Fabry disease Amicus Therapeutics UK Ltd 22/05/2006 Galafold
EU/3/06/369 Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix Treatment of epidermolysis bullosa Biodan Yelah S.L. 22/05/2006
EU/3/06/370 Decitabine Treatment of acute myeloid leukaemia Janssen-Cilag International NV 08/06/2006 Dacogen
EU/3/06/371 Heparin sodium Treatment of cystic fibrosis Ockham Biotech Limited 22/05/2006
EU/3/06/372 Hydrocortisone (modified release tablet) Treatment of adrenal insufficiency Shire Services BVBA 22/05/2006 Plenadren
EU/3/06/374 Methoxsalen Treatment of Graft-versus-Host disease Therakos (UK) Limited 22/05/2006
EU/3/06/375 Nilotinib Treatment of chronic myeloid leukaemia Novartis Europharm Limited 22/05/2006 Tasigna
EU/3/06/376 Recombinant P-selectin glycoprotein immunoglobulin Prevention of post transplantation graft dysfunction RJM Consultancy Ltd 22/05/2006
EU/3/06/381 Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa Envestia Limited 29/06/2006
EU/3/06/384 Human telomerase reverse transcriptase peptide (611-626) Treatment of pancreatic cancer Gemvax A/S 25/07/2006
EU/3/06/386 4-[123I]iodo-L-phenylalanine Diagnosis of glioma Therapeia GmbH & Co. KG 25/07/2006
EU/3/06/387 Amikacin sulfate (liposomal) Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Insmed Limited 25/07/2006
EU/3/06/388 Becatecarin Treatment of cancers of the biliary tree Helsinn Birex Pharmaceuticals Ltd 25/07/2006
EU/3/06/390 4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride Treatment of moderate and severe traumatic brain injury vasopharm GmbH 28/08/2006
EU/3/06/391 Amphotericin B (for inhalation use) Prevention of pulmonary fungal infection in patients deemed at risk Novartis Europharm Limited 28/08/2006
EU/3/06/394 Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin Treatment of follicular lymphoma Biovest Europe Limited 28/08/2006
EU/3/06/395 Aviptadil Treatment of acute lung injury mondoBIOTECH Laboratories Anstalt 28/08/2006
EU/3/06/396 Cardiotrophin-1 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation Digna Biotech S.L. 28/08/2006
EU/3/06/399 Mecasermin rinfabate Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Premacure AB 28/08/2006
EU/3/06/400 Metastable technetium 99 [99mTc] demogastrin 2 Diagnosis of medullary thyroid carcinoma Biomedica Life Sciences SA 28/08/2006
EU/3/06/401 N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate Treatment of familial amyloid polyneuropathy Pfizer Limited 28/08/2006 Vyndaqel
EU/3/06/404 Adenoviral vector containing human p53 gene Treatment of Li Fraumeni Syndrome Gendux Molecular Limited 23/10/2006
EU/3/06/405 Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) Treatment of renal cell carcinoma MOLOGEN AG 23/10/2006
EU/3/06/406 Arimoclomol Treatment of amyotrophic lateral sclerosis Orphazyme ApS 26/10/2006
EU/3/06/407 Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 Prevention of necrotizing enterocolitis Dr Michael Moore 31/10/2006
EU/3/06/408 Human cytomegalovirus immunoglobulin Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Biotest Pharma GmbH 31/10/2006
EU/3/06/409 L-asparaginase encapsulated in erythrocytes Treatment of acute lymphoblastic leukaemia ERYtech Pharma S.A. 27/10/2006
EU/3/06/410 Doxorubicin hydrochloride (liposomal) Treatment of soft tissue sarcoma GP-Pharm S.A. 27/10/2006
EU/3/06/411 Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule Prevention of Graft-versus-Host disease Apogenix AG 31/10/2006
EU/3/06/412 4,7,10,13,16,19-docosahexaenoic acid Treatment of retinitis pigmentosa Natac Pharma S.L. 03/11/2006
EU/3/06/413 Budesonide (oral use) Treatment of Graft-versus-Host disease Dr Falk Pharma GmbH 03/11/2006
EU/3/06/414 Catumaxomab Treatment of gastric cancer Neovii Biotech GmbH 03/11/2006
EU/3/06/416 Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' Treatment of acute myeloid leukaemia EleosInc Limited 03/11/2006
EU/3/06/417 Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) Treatment of renal cell carcinoma Immunservice GmbH 27/10/2006
EU/3/06/419 Paclitaxel (liposomal) Treatment of pancreatic cancer SynCore Biotechnology Europe GmbH 31/10/2006
EU/3/06/420 Temsirolimus Treatment of mantle cell lymphoma Pfizer Limited 06/11/2006 Torisel
EU/3/06/421 Forodesine hydrochloride Treatment of acute lymphoblastic leukaemia Napp Pharmaceuticals Research Limited 18/12/2006
EU/3/06/422 Paclitaxel (micellar) Treatment of ovarian cancer Oasmia Pharmaceutical AB 18/12/2006
EU/3/06/424 Thiotepa Conditioning treatment prior to haematopoietic progenitor cell transplantation ADIENNE S.r.l. 29/01/2007 Tepadina
EU/3/06/428 Forodesine hydrochloride Treatment of cutaneous T-cell lymphoma Napp Pharmaceuticals Research Limited 29/01/2007
EU/3/06/429 Recombinant modified vaccinia Ankara expressing human 5T4 Treatment of renal cell carcinoma Oxford Biomedica (UK) Ltd 26/01/2007
EU/3/07/430 artesunate Treatment of malaria ACE Pharmaceuticals BV 20/02/2007
EU/3/07/431 Autologous dendritic cells pulsed with autologous tumour cell lysate Treatment of glioma Northwest Biotherapeutics GmbH 15/02/2007
EU/3/07/432 Ex-vivo cultured adult human mesenchymal stem cells Treatment of Graft-versus-Host disease Voisin Consulting S.A.R.L. 20/02/2007
EU/3/07/434 Idebenone Treatment of Leber's hereditary optic neuropathy Santhera Pharmaceuticals (Deutschland) GmbH 15/02/2007 Raxone
EU/3/07/435 Recombinant human C1-inhibitor Prevention of delayed graft function after solid organ transplantation Pharming Group N.V. 20/02/2007
EU/3/07/437 Idebenone Treatment of Duchenne muscular dystrophy Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2007
EU/3/07/438 Zanolimumab Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) TenX Biopharma Ltd 20/03/2007
EU/3/07/440 Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene Treatment of congenital alpha-1 antitrypsin deficiency TMC Pharma Services Ltd 20/03/2007
EU/3/07/441 Hydrocortisone (modified release tablet) Treatment of adrenal insufficiency Diurnal Limited 20/03/2007
EU/3/07/442 Enzastaurin hydrochloride Treatment of diffuse large B cell lymphoma Isabelle Ramirez 20/03/2007
EU/3/07/443 Elafin Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Proteo Biotech AG 20/03/2007
EU/3/07/444 Pralatrexate Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Allos Therapeutics Limited 13/04/2007
EU/3/07/445 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Prevention of corneal graft rejection Gene Signal SAS 17/04/2007
EU/3/07/446 Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA Treatment of metachromatic leukodystrophy GlaxoSmithKline Trading Services Limited 13/04/2007
EU/3/07/448 Talactoferrinum alfa Treatment of renal cell carcinoma Agennix Limited 05/06/2007
EU/3/07/451 Cisplatin (liposomal) Treatment of pancreatic cancer Regulon AE 08/06/2007
EU/3/07/452 R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H -1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea Treatment of gastric carcinoid Trio Medicines Ltd 14/06/2007
EU/3/07/453 Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 Treatment of haemophilia B (congenital factor IX deficiency) Swedish Orphan Biovitrum AB (publ) 08/06/2007 ALPROLIX
EU/3/07/455 Ciclosporin Prevention of corneal graft rejection SANTEN S.A.S. 22/10/2007
EU/3/07/459 1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride Treatment of narcolepsy Bioprojet Pharma 10/07/2007 Wakix
EU/3/07/461 Human plasminogen Treatment of ligneous conjunctivitis Kedrion S.p.A. 03/08/2007
EU/3/07/462 Recombinant human soluble Fc-gamma receptor IIb Treatment of idiopathic thrombocytopenic purpura Baxalta Innovations GmbH 02/08/2007
EU/3/07/463 Pyridoxalated haemoglobin polyoxyethylene Treatment of cardiogenic shock Curacyte AG 02/08/2007
EU/3/07/465 L-threo-3,4-dihydroxyphenylserine Treatment of orthostatic hypotension in patients with pure autonomic failure H. Lundbeck A/S 02/08/2007
EU/3/07/466 L-threo-3,4-dihydroxyphenylserine Treatment of orthostatic hypotension in patients with multiple system atrophy H. Lundbeck A/S 02/08/2007
EU/3/07/469 Ciprofloxacin (inhalation use) Treatment of cystic fibrosis Bayer AG 03/08/2007
EU/3/07/470 Human heterologous liver cells (for infusion) Treatment of ornithine-transcarbamylase deficiency Promethera Biosciences 14/09/2007
EU/3/07/471 Human coagulation factor X Treatment of hereditary factor X deficiency Bio Products Laboratory Ltd 17/09/2007 Coagadex
EU/3/07/473 Aviptadil Treatment of sarcoidosis mondoBIOTECH Laboratories Anstalt 14/09/2007
EU/3/07/474 Alpha-1 proteinase inhibitor (inhalation use) Treatment of cystic fibrosis CSL Behring GmbH 14/09/2007
EU/3/07/475 Alginate oligosaccharide (G-block) fragment Treatment of cystic fibrosis AlgiPharma AS 14/09/2007
EU/3/07/476 5'-O-(trans-9'-octadecenoyl)-1--D-arabinofuranosyl cytosine Treatment of acute myleoid leukaemia Aqualis ASA 14/09/2007
EU/3/07/477 4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]--D-arabinofuranosyl]-2(1H)-pyrimidinone Treatment of hepatocellular carcinoma Interface International Consultancy Limited 14/09/2007
EU/3/07/478 N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Treatment of Hodgkin lymphoma ICON Clinical Research Limited 14/09/2007
EU/3/07/479 N-adamantanyl-N'-geranyl-ethylenediamine Treatment of tuberculosis RLM Consulting 14/09/2007
EU/3/07/480 Naptumomab estafenatox Treatment of renal cell carcinoma Active Biotech AB 14/09/2007
EU/3/07/481 R-salbutamol sulphate Treatment of cutaneous forms of lupus erythematosus Astion Pharma A/S 14/09/2007
EU/3/07/484 Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Treatment of Leber's congenital amaurosis HORAMA SA 22/10/2007
EU/3/07/485 Alvocidib Treatment of chronic lymphocytic leukaemia Chiltern Clinical Research International GmbH 23/10/2007
EU/3/07/486 Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Treatment of retinitis pigmentosa HORAMA SA 14/11/2007
EU/3/07/487 4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol Treatment of chronic lymphocytic leukaemia BlackSwan Pharma GmbH 14/11/2007
EU/3/07/489 Ciclosporin Treatment of Herpes simplex virus stromal keratitis SANTEN S.A.S. 29/10/2007
EU/3/07/490 Human autologous bone-forming cells derived from bone marrow stem cells Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 29/10/2007
EU/3/07/491 Interferon gamma Treatment of idiopathic pulmonary fibrosis mondoBIOTECH Laboratories AG 29/10/2007
EU/3/07/492 Iodine (131I) chlorotoxin Treatment of glioma Eisai Europe Limited 22/10/2007
EU/3/07/493 Isofagomine tartrate Treatment of Gaucher Disease Amicus Therapeutics UK Ltd 23/10/2007
EU/3/07/494 Lenalidomide Treatment of chronic lymphocytic leukaemia Celgene Europe Limited 19/11/2007
EU/3/07/495 Methotrexate (oral liquid) Treatment of acute lymphoblastic leukaemia Orbona Pharma Ltd 24/10/2007
EU/3/07/496 Mercaptopurine (oral liquid) Treatment of acute lymphoblastic leukaemia Orbona Pharma Ltd 22/10/2007
EU/3/07/498 Polihexanide Treatment of Acanthamoeba keratitis S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. 14/11/2007
EU/3/07/499 Terguride Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Ergonex Licensing and Regulatory Services AG 29/11/2007
EU/3/07/503 Recombinant human hepatitis C monoclonal antibody against C4 region of E1 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 06/12/2007
EU/3/07/505 Interferon beta Treatment of acute lung injury Faron Pharmaceuticals Limited 29/11/2007
EU/3/07/506 Heterologous human adult liver derived stem cells Treatment of Crigler-Najjar syndrome Promethera Biosciences 29/11/2007
EU/3/07/508 Chimeric-anti-interleukin-6 monoclonal antibody Treatment of Castleman’s disease Janssen-Cilag International NV 30/11/2007 Sylvant
EU/3/07/509 Azacitidine Treatment of acute myeloid leukaemia Celgene Europe Limited 29/11/2007 Vidaza
EU/3/07/510 artesunate Treatment of malaria Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 06/12/2007
EU/3/07/511 3-methoxy-pregnenolone Treatment of spinal cord injury MAPREG SAS 04/12/2007
EU/3/07/513 (S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine Treatment of tuberculosis FGK Representative Service GmbH 29/11/2007
EU/3/07/514 (1R, 2R)-Octanoic acid [2-(2,3-dihydro-benzo [1,4] dioxin-6-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt Treatment of Gaucher Disease Genzyme Europe B.V. 04/12/2007 Cerdelga
EU/3/07/516 Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 Treatment of acute myeloid leukaemia Xenetic Biosciences Plc 20/12/2007
EU/3/07/518 Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension Bayer AG 20/12/2007 Adempas
EU/3/07/519 Maribavir Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk Shire Pharmaceuticals Ireland Limited 18/12/2007
EU/3/07/520 Human papilloma virus type 16 E6/E7 synthetic long peptides Treatment of epithelial neoplasia of the vulva positive for human papilloma virus ISA Therapeutics B.V. 20/12/2007
EU/3/07/521 H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients Vaxon Biotech 18/12/2007
EU/3/07/522 (manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21a-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Best Regulatory Consulting Ltd 31/01/2008
EU/3/07/523 Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide Treatment of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 31/01/2008 Lutathera
EU/3/07/524 (R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole Treatment of tuberculosis Otsuka Novel Products GmbH 01/02/2008 Deltyba
EU/3/07/525 Iodine (131I) iobenguane Treatment of neuroblastoma Molecular Insight Limited 31/01/2008
EU/3/07/526 N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Treatment of acute myeloid leukaemia ICON Clinical Research Limited 31/01/2008
EU/3/08/529 Tretazicar Treatment of visceral leishmaniasis Morvus Technology Limited 04/02/2008
EU/3/08/530 Heterologous human adult liver derived stem cells Treatment of ornithinine transcarbamylase deficiency Promethera Biosciences 04/02/2008
EU/3/08/531 ascorbic acid Treatment of Charcot-Marie-Tooth disease type 1A Murigenetics SAS 01/04/2008
EU/3/08/532 filgrastim Treatment of amyotrophic lateral sclerosis NeuroVision Pharma GmbH 01/04/2008
EU/3/08/535 Humanised monoclonal antibody to the folate receptor alpha Treatment of ovarian cancer Eisai Europe Limited 01/04/2008
EU/3/08/539 Ammonium tetrathiomolybdate Treatment of Wilson's disease JJGConsultancy Ltd 01/04/2008
EU/3/08/540 Omigapil maleate Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). Santhera Pharmaceuticals (Deutschland) GmbH 08/05/2008
EU/3/08/541 [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone Treatment of erythropoietic protoporphyria Clinuvel UK Limited 08/05/2008 Scenesse
EU/3/08/542 Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide Treatment of acute myeloid leukaemia Dr Ulrich Granzer 08/05/2008
EU/3/08/544 Omigapil maleate Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency Santhera Pharmaceuticals (Deutschland) GmbH 08/05/2008
EU/3/08/545 [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone Treatment of congenital erythropoietic porphyria Clinuvel UK Limited 08/05/2008
EU/3/08/546 Alpha-1 proteinase inhibitor (inhalation use) Treatment of congenital alpha-1 antitrypsin deficiency Grifols Deutschland GmbH 03/06/2008
EU/3/08/548 Carfilzomib Treatment of multiple myeloma Amgen Europe B.V. 03/06/2008 Kyprolis
EU/3/08/549 NGR-human tumour necrosis factor Treatment of malignant mesothelioma MolMed S.p.A. 03/06/2008
EU/3/08/550 Nimotuzumab Treatment of pancreatic cancer Oncoscience AG 03/06/2008
EU/3/08/553 Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] Treatment of glioma Pharma Gateway AB 03/06/2008
EU/3/08/554 Beraprost sodium (modified release tablet) Treatment of pulmonary arterial hypertension IDEA Innovative Drug European Associates Limited 10/07/2008
EU/3/08/555 Vincristine sulphate liposomes Treatment of acute lymphoblastic leukaemia NDA Regulatory Science Ltd 08/07/2008
EU/3/08/556 N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 08/07/2008 Kalydeco
EU/3/08/557 Sapacitabine Treatment of myelodysplastic syndromes Cyclacel Limited 08/07/2008
EU/3/08/558 Sapacitabine Treatment of acute myeloid leukaemia Cyclacel Limited 10/07/2008
EU/3/08/560 (-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate Treatment of moderate and severe closed traumatic brain injury KeyNeurotek Pharmaceuticals AG 05/09/2008
EU/3/08/561 Donor lymphocyte preparation depleted of functional alloreactive T-cells Prevention of Graft-versus-Host disease Kiadis Pharma Netherlands B.V. 05/09/2008
EU/3/08/562 Topotecan hydrochloride (liposomal) Treatment of glioma Dr Matthias Luz 05/09/2008
EU/3/08/563 Recombinant derivative of C3 transferase Treatment of traumatic spinal cord injury Vertex Pharmaceuticals (Europe) Limited 05/09/2008
EU/3/08/564 Avian polyclonal IgY antibody against Pseudomonas aeruginosa Treatment of cystic fibrosis Immunsystem I.M.S. AB 23/09/2008
EU/3/08/565 Drotrecogin alfa (activated) Treatment of acute respiratory distress syndrome Savara ApS 22/09/2008
EU/3/08/567 Miltefosine Treatment of cutaneous T-cell lymphoma ExperGen Drug Development GmbH 22/09/2008
EU/3/08/568 N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide Treatment of partial deep dermal and full thickness burn wounds Creative Antibiotics Sweden AB 22/09/2008
EU/3/08/569 Pegylated L-asparaginase Treatment of acute lymphoblastic leukaemia Sigma-Tau Rare Diseases, S.A. 22/09/2008
EU/3/08/570 Recombinant human CXCL8 mutant Prevention of delayed graft function after solid organ transplantation ProtAffin Biotechnologie AG 22/09/2008
EU/3/08/571 Recombinant human minibody against complement component C5 Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system ADIENNE S.r.l. 22/09/2008
EU/3/08/575 Carglumic acid Treatment of isovaleric acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
EU/3/08/576 Carglumic acid Treatment of methylmalonic acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
EU/3/08/577 Carglumic acid Treatment of propionic acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
EU/3/08/578 Cysteamine hydrochloride Treatment of cystinosis Orphan Europe S.A.R.L. 07/11/2008 Cystadrops
EU/3/08/579 Ex-vivo expanded autologous human corneal epithelium containing stem cells Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns Chiesi Farmaceutici S.p.A. 07/11/2008 Holoclar
EU/3/08/580 Filgrastim Treatment of spinal cord injury NeuroVision Pharma GmbH 07/11/2008
EU/3/08/581 Ofatumumab Treatment of chronic lymphocytic leukaemia Novartis Europharm Limited 07/11/2008 Arzerra
EU/3/08/582 Recombinant human heparan N-sulfatase Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) Shire Pharmaceutical Development Limited 07/11/2008
EU/3/08/583 Gadodiamide (liposomal) Treatment of glioma Dr Matthias Luz 03/12/2008
EU/3/08/585 Daunorubicin (liposomal) Treatment of acute myeloid leukaemia Diatos S. A. 03/12/2008
EU/3/08/586 RNA, [P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a?5')(C-m5U-C-C-A-A-C-A-m5U-C-A-A-G-G-A-A-G-A-m5U-G-G-C-A-m5U-m5U-m5U-C-m5U-A-G), P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy] ethoxy]carbonyl]-1-piperazinyl]-N,Ndimethylaminophosphonamidate Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 03/12/2008
EU/3/08/587 Cenersen Treatment of chronic lymphocytic leukaemia EleosInc Limited 03/12/2008
EU/3/08/588 Recombinant human ADAMTS-13 Treatment of thrombotic thrombocytopenic purpura Baxalta Innovations GmbH 03/12/2008
EU/3/08/591 5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole Treatment of Duchenne muscular dystrophy Summit (Oxford) Limited 04/12/2008
EU/3/08/592 Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 Treatment of hairy cell leukaemia MedImmune Ltd 04/12/2008
EU/3/08/593 N2'-Deacetyl-N2'-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody Treatment of multiple myeloma Biotest AG 03/12/2008
EU/3/08/594 Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein Treatment of hypophosphatasia Alexion Europe SAS 03/12/2008 Strensiq
EU/3/08/595 Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E Treatment of anaplastic large cell lymphoma Takeda Pharma A/S 15/01/2009 ADCETRIS
EU/3/08/596 Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E Treatment of Hodgkin lymphoma Takeda Pharma A/S 15/01/2009 ADCETRIS
EU/3/08/598 Exon 44 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy BioMarin International Limited 27/02/2009
EU/3/08/599 Exon 51 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy BioMarin International Limited 27/02/2009
EU/3/08/600 Human anti-intercellular adhesion molecule1 monoclonal antibody Treatment of multiple myeloma BioInvent International AB 20/01/2009
EU/3/08/601 Milatuzumab Treatment of multiple myeloma Immunomedics GmbH 19/01/2009
EU/3/08/602 Milatuzumab Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 19/01/2009
EU/3/08/603 Pralatrexate Treatment of non-papillary transitional cell carcinoma of the urinary bladder Allos Therapeutics Limited 19/01/2009
EU/3/08/604 Recombinant Human minibody against complement component C5 fused with RGD-motif Prevention of the ischemia/reperfusion injury associated with solid organ transplantation ADIENNE S.r.l. 20/01/2009
EU/3/08/605 Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class Treatment of spinal cord injury Novartis Europharm Limited 19/01/2009
EU/3/08/607 Type I native bovine skin collagen Treatment of systemic sclerosis arGentis Autoimmune Europe Limited 09/02/2009
EU/3/08/608 Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 Treatment of pancreatic cancer Immunomedics GmbH 06/02/2009
EU/3/08/610 Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt Treatment of medullary thyroid carcinoma Ipsen Pharma 06/02/2009 Cometriq
EU/3/08/611 Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein Treatment of acute liver failure Alfact Innovation SAS 11/02/2009
EU/3/08/612 Recombinant human proinsulin Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 11/02/2009
EU/3/09/614 Mifepristone Treatment of hypercortisolism (Cushing's syndrome) of endogenous origin EXELGYN 27/02/2009
EU/3/09/615 N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) Dr Ulrich Granzer 27/02/2009
EU/3/09/616 (6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride monohydrate Treatment of amyotrophic lateral sclerosis Knopp Neurosciences Sub Ltd 27/02/2009
EU/3/09/617 2,2-dimethylbutyric acid, sodium salt Treatment of beta-thalassaemia intermedia and major Isabelle Ramirez 27/02/2009
EU/3/09/621 2,2-dimethylbutyric acid, sodium salt Treatment of sickle cell disease Isabelle Ramirez 18/03/2009
EU/3/09/622 N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt Treatment of acute myeloid leukaemia Daiichi Sankyo Europe GmbH 23/03/2009
EU/3/09/623 Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene Treatment of beta-thalassaemia intermedia and major EGT San Rocco Italia SRL 29/04/2009
EU/3/09/624 Autologous tumour-derived gp96 heat shock protein-peptide complex Treatment of glioma Antigenics Therapeutics Limited 29/04/2009
EU/3/09/625 Guanabenz Treatment of traumatic spinal cord injury Acure Pharma AB 29/04/2009
EU/3/09/628 Mercaptopurine (oral suspension) Treatment of acute lymphoblastic leukaemia Nova Laboratories Limited 30/04/2009 Xaluprine
EU/3/09/629 Nanobody directed towards the human A1 domain of von Willebrand factor Treatment of thrombotic thrombocytopenic purpura Ablynx N.V. 30/04/2009
EU/3/09/630 Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector Treatment of dystrophic epidermolysis bullosa Prof. Alain Hovnanian 30/04/2009
EU/3/09/632 Adeno-associated viral vector containing porphobilinogen deaminase gene Treatment of acute intermittent porphyria uniQure Biopharma B.V. 29/04/2009
EU/3/09/633 L-asparaginase encapsulated in erythrocytes Treatment of pancreatic cancer ERYtech Pharma S.A. 15/05/2009
EU/3/09/634 S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK Treatment of pancreatic cancer MBiotec GmbH 15/05/2009
EU/3/09/635 Treprostinil diethanolamine Treatment of systemic sclerosis United Therapeutics Europe Ltd 15/05/2009
EU/3/09/637 2',3',5'-tri-O-acetyluridine Treatment of 5-fluorouracil overdose Wellstat Therapeutics EU Limited 15/05/2009
EU/3/09/638 Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation Opsona Therapeutics Limited 15/05/2009
EU/3/09/641 Alicaforsen Treatment of pouchitis Atlantic Pharmaceuticals (Holdings) Ltd 15/05/2009
EU/3/09/645 Octreotide chloride (lipid depot solution) Treatment of acromegaly Novartis Europharm Limited 12/06/2009
EU/3/09/647 (S)-3'-(OH)-desazadesferrithiocin-polyether, magnesium salt Treatment of chronic iron overload requiring chelation therapy Shire Pharmaceutical Development Limited 24/07/2009
EU/3/09/648 Afamelanotide Treatment of solar urticaria Clinuvel UK Limited 24/07/2009
EU/3/09/650 Blinatumomab Treatment of acute lymphoblastic leukaemia Amgen Europe B.V. 24/07/2009 Blincyto
EU/3/09/651 Ciclosporin (eye drops, solution) Treatment of atopic keratoconjunctivitis Allergan Pharmaceuticals Ireland 24/07/2009
EU/3/09/652 Ciprofloxacin (liposomal) Treatment of cystic fibrosis Aradigm Limited 24/07/2009
EU/3/09/653 Eculizumab Treatment of atypical haemolytic uremic syndrome Alexion Europe SAS 24/07/2009 Soliris
EU/3/09/654 Hypothiocyanite / lactoferrin Treatment of cystic fibrosis Alaxia 24/07/2009
EU/3/09/656 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of diffuse large B-cell lymphoma CellGenix GmbH 24/07/2009
EU/3/09/657 Recombinant human N-acetylgalactosamine-6-sulfatase Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) BioMarin Europe Ltd 24/07/2009 Vimizim
EU/3/09/659 Tosedostat Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 24/07/2009
EU/3/09/660 Trabedersen Treatment of pancreatic cancer Dr Ulrich Granzer 24/07/2009
EU/3/09/661 (S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate Treatment of carcinoid syndrome Ipsen Pharma 08/10/2009 Xermelo
EU/3/09/663 Adeno-associated viral vector containing modified U1 snRNA Treatment of Duchenne muscular dystrophy uniQure Biopharma B.V. 08/10/2009
EU/3/09/666 Eicosapentaenoic acid Treatment of familial adenomatous polyposis S.L.A. Pharma (UK) Limited 08/10/2009
EU/3/09/667 Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue Treatment of anal fistula Takeda Pharma A/S 08/10/2009 Alofisel
EU/3/09/669 Low molecular weight dextran sulfate Prevention of graft rejection during pancreatic islet transplantation TikoMed AB 09/10/2009
EU/3/09/670 pasireotide Treatment of acromegaly Novartis Europharm Limited 08/10/2009 Signifor
EU/3/09/671 pasireotide Treatment of Cushing's disease Novartis Europharm Limited 08/10/2009 Signifor
EU/3/09/672 Pomalidomide Treatment of multiple myeloma Celgene Europe Limited 08/10/2009 Imnovid
EU/3/09/673 Recombinant antibody construct against human CD30 and CD16A Treatment of Hodgkin lymphoma Affimed GmbH 09/10/2009
EU/3/09/677 Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys Treatment of acute lung injury Apeptico Forschung und Entwicklung GmbH 08/10/2009
EU/3/09/681 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide Treatment of Huntington's disease AOP Orphan Pharmaceuticals AG 28/10/2009
EU/3/09/683 Cholic acid Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid Retrophin Europe Limited 28/10/2009 Kolbam
EU/3/09/684 Masitinib mesilate Treatment of pancreatic cancer AB Science S.A. 28/10/2009
EU/3/09/685 N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride Treatment of pancreatic cancer Merck KGaA 09/11/2009
EU/3/09/686 NGR-human tumour necrosis factor Treatment of hepatocellular carcinoma MolMed S.p.A. 09/11/2009
EU/3/09/689 Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis Treatment of myasthenia gravis CuraVac Europe SA 09/11/2009
EU/3/09/692 16-base single-stranded PNA oligonucleotide linked to a 7-aminoacid peptide Treatment of neuroblastoma Biogenera SpA 25/11/2009
EU/3/09/693 1-Cyclopropyl-3-[3-(5-morpholin-4-ylmethyl-1H-benzoimidazol-2-yl)-1H-pyrazol-4-yl]-urea Treatment of acute myeloid leukaemia Astex Therapeutics Limited 26/11/2009
EU/3/09/694 6-thioguanine (oral liquid) Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 26/11/2009
EU/3/09/695 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-1,2,4-triazolo[3,4-f][1,6]naphthyridin-3(2H)-one mono-hydrochloride Treatment of ovarian cancer Merck Sharp & Dohme Limited 30/11/2009
EU/3/09/696 Human MHC non-restricted cytotoxic T-cell line Treatment of ovarian cancer Galileo Research S.r.l. 30/11/2009
EU/3/09/698 Pegylated carboxyhaemoglobin Treatment of sickle cell disease Voisin Consulting S.A.R.L. 26/11/2009
EU/3/09/699 Recombinant chimeric monoclonal antibody against CD20 Treatment of chronic lymphocytic leukaemia LFB-Biotechnologies 26/11/2009
EU/3/09/700 Vaccinia GM-CSF/TK-deactivated virus Treatment of hepatocellular carcinoma Transgene S.A. 26/11/2009
EU/3/09/701 2-iminobiotin Treatment of perinatal asphyxia Neurophyxia B.V. 28/01/2010
EU/3/09/702 Beta-artemether / lumefantrine (powder for oral suspension) Treatment of malaria Dafra Pharma International NV 28/01/2010
EU/3/09/703 Brivudine Treatment of pancreatic cancer RESprotect GmbH 28/01/2010
EU/3/09/705 Human monoclonal antibody against Pseudomonas aeruginosa IATS-O1 Treatment of pneumonia caused by serotype O1 Pseudomonas aeruginosa Envestia Limited 28/01/2010
EU/3/09/706 Lithium citrate tetrahydrate (in reverse-micelle formulation) Treatment of Huntington's disease Medesis Pharma 28/01/2010
EU/3/09/707 Macitentan Treatment of idiopathic pulmonary fibrosis Actelion Registration Ltd 28/01/2010
EU/3/09/708 Pegylated recombinant phenylalanine ammonia lyase Treatment of hyperphenylalaninaemia BioMarin International Limited 28/01/2010
EU/3/09/709 Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule Treatment of glioma Apogenix AG 28/01/2010
EU/3/09/710 Recombinant human elafin Treatment of oesophagus carcinoma Proteo Biotech AG 28/01/2010
EU/3/09/711 Recombinant human vascular endothelial growth factor Treatment of amyotrophic lateral sclerosis Newron Sweden AB 29/01/2010
EU/3/09/712 Recombinant kallikrein inhibitor Treatment of Netherton syndrome Dermadis S.A.S. 29/01/2010
EU/3/09/713 Veltuzumab Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 29/01/2010
EU/3/09/715 Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] Treatment of acute lymphoblastic leukaemia Incyte Biosciences UK Ltd 02/02/2010 Iclusig
EU/3/09/716 Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] Treatment of chronic myeloid leukaemia Incyte Biosciences UK Ltd 02/02/2010 Iclusig
EU/3/09/717 Ecopipam Treatment of Lesch-Nyhan disease Dr Alain Munoz 03/02/2010
EU/3/09/719 Givinostat Treatment of polycythaemia vera Italfarmaco S.p.A. 03/02/2010
EU/3/09/720 Lentiviral vector containing the human ABCA4 gene Treatment of Stargardt's disease Sanofi-Aventis groupe 02/02/2010
EU/3/09/723 Recombinant fusion protein linking human coagulation factor IX with human albumin Treatment of haemophilia B CSL Behring GmbH 04/02/2010 IDELVION
EU/3/09/725 RNA, [P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a?5') (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5' [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3'[2'a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl--alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl--alanyl-L-arginyl-6-aminohexanoyl--alanyl], octahydrochloride Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 02/02/2010
EU/3/10/726 Taliglucerase alfa Treatment of Gaucher Disease Pfizer Limited 23/03/2010
EU/3/10/727 Lentiviral vector containing the human MYO7A gene Treatment of retinitis pigmentosa in Usher syndrome 1B Sanofi-Aventis groupe 23/03/2010
EU/3/10/730 Raloxifene hydrochloride Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 10/06/2010
EU/3/10/732 Entinostat Treatment of Hodgkin's lymphoma Syndax Limited 10/06/2010
EU/3/10/733 Glyceryl tri-(4-phenylbutyrate) Treatment of carbamoyl-phosphate synthase-1 deficiency Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/3/10/734 Glyceryl tri-(4-phenylbutyrate) Treatment of ornithine carbamoyltransferase deficiency Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/3/10/735 Glyceryl tri-(4-phenylbutyrate) Treatment of citrullinaemia type 1 Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/3/10/736 Glyceryl tri-(4-phenylbutyrate) Treatment of argininosuccinic aciduria Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/3/10/737 Glyceryl tri-(4-phenylbutyrate) Treatment of hyperargininaemia Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/3/10/738 Glyceryl tri-(4-phenylbutyrate) Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/3/10/739 Glyceryl tri-(4-phenylbutyrate) Treatment of citrullinaemia type 2 Horizon Pharma Ireland Limited 10/06/2010
EU/3/10/741 Pralatrexate Treatment of cutaneous T-cell lymphoma Allos Therapeutics Limited 10/06/2010
EU/3/10/742 2-methoxymethyl-2-hydroxymethyl-1-azabicyclo[2,2,2]octan-3-one Treatment of acute myeloid leukaemia Aprea Therapeutics AB 10/06/2010
EU/3/10/744 Adrenomedullin Treatment of acute lung injury mondoBIOTECH Laboratories AG 09/06/2010
EU/3/10/748 Pravastatin / zoledronic acid Treatment of Hutchinson-Gilford progeria Prenyl BIO SAS 09/06/2010
EU/3/10/749 Recombinant human anti-interferon gamma monoclonal antibody Treatment of haemophagocytic lymphohistiocytosis NovImmune B.V. 09/06/2010
EU/3/10/750 Rifapentine Treatment of tuberculosis Sanofi-Aventis groupe 09/06/2010
EU/3/10/751 Synthetic double-stranded siRNA oligonucleotide directed against p53 mRNA Prevention of delayed graft function after renal transplantation ProductLife Limited 09/06/2010
EU/3/10/752 Velaglucerase alfa Treatment of Gaucher disease Shire Pharmaceuticals Ireland Limited 09/06/2010 VPRIV
EU/3/10/753 6alpha-ethyl-chenodeoxycholic acid Treatment of primary biliary cirrhosis Intercept Pharma Ltd 27/07/2010 OCALIVA
EU/3/10/754 Heparin-activated recombinant human fibroblast growth factor 1 (on a biodegradable device made from alpha-calcium sulphate hemihydrate) Treatment of traumatic spinal cord injury Bioarctic AB 27/07/2010
EU/3/10/755 Octenidine dihydrochloride Prevention of late-onset sepsis in premature infants of less than or equal to 32 weeks of gestational age Schülke & Mayr GmbH 27/07/2010
EU/3/10/756 Tranilast Prevention of scarring post glaucoma filtration surgery Altacor Ltd 27/07/2010
EU/3/10/760 (3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt Treatment of ovarian cancer TESARO U.K. Limited 04/08/2010 Zejula
EU/3/10/764 Everolimus Treatment of tuberous sclerosis Novartis Europharm Limited 04/08/2010 Votubia
EU/3/10/765 Midostaurin Treatment of mastocytosis Novartis Europharm Limited 04/08/2010 Rydapt
EU/3/10/767 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene Treatment of post-essential thrombocythaemia myelofibrosis CTI Life Sciences Ltd 25/08/2010
EU/3/10/768 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene Treatment of primary myelofibrosis CTI Life Sciences Ltd 25/08/2010
EU/3/10/769 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene Treatment of post-polycythaemia vera myelofibrosis CTI Life Sciences Ltd 25/08/2010
EU/3/10/772 Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) LYSOGENE 20/09/2010
EU/3/10/773 Allogeneic T cells encoding an exogenous TK gene Treatment of acute myeloid leukaemia LTKFarma 20/09/2010
EU/3/10/774 Allogeneic human dermal fibroblasts Treatment of epidermolysis bullosa Intercytex Ltd 20/09/2010
EU/3/10/775 Autologous bone marrow-derived mononuclear cell fraction Treatment of thromboangiitis obliterans (Buerger's disease) t2cure GmbH 20/09/2010
EU/3/10/776 Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose Treatment of ovarian cancer Prima Biomed GmbH 20/09/2010
EU/3/10/777 Cyclic pyranopterin monophosphate Treatment of molybdenum cofactor deficiency type A Alexion Europe SAS 20/09/2010
EU/3/10/778 Cysteamine bitartrate (gastroresistant) Treatment of cystinosis Chiesi Farmaceutici S.p.A. 20/09/2010 Procysbi
EU/3/10/779 Eflornithine Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 20/09/2010
EU/3/10/780 Forodesine Treatment of chronic lymphocytic leukaemia Mundipharma Research Limited 20/09/2010
EU/3/10/782 Nafamostat mesilate Treatment of cystic fibrosis Mucokinetica Ltd 20/09/2010
EU/3/10/786 Heat-killed Mycobacterium vaccae (whole cell) Treatment of tuberculosis Immodulon Therapeutics Ltd 20/09/2010
EU/3/10/787 (3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt Treatment of mantle cell lymphoma TESARO U.K. Limited 01/10/2010
EU/3/10/788 (S)-10-[(dimethylamino)methyl]-4-ethyl-9-hydroxy-4-O-[alpha-(2'', 4'', 5'', 7''-tetranitro-9''-fluorenylideneaminooxy)propionyl]-1H-pyrano[3', 4', 6', 7']indolizino[1,2-beta]-quinoline-3, 14-(4H), 12H)-dione, hydrochloride Treatment of hepatocellular carcinoma TLC Biopharmaceuticals B.V. 01/10/2010
EU/3/10/789 16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide Treatment of medulloblastoma Biogenera SpA 01/10/2010
EU/3/10/791 Ciclosporin Treatment of moderate and severe closed traumatic brain injury NeuroVive Pharmaceutical AB 01/10/2010
EU/3/10/793 N-(6-(2-aminophenylamino)-6-oxohexyl)-4-methylbenzamide Treatment of Friedreich's ataxia Repligen Europe Limited 01/10/2010
EU/3/10/794 N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate Treatment of primary myelofibrosis SynteractHCR Deutschland GmbH 01/10/2010
EU/3/10/795 Pralatrexate Treatment of Hodgkin's lymphoma Allos Therapeutics Limited 01/10/2010
EU/3/10/796 Recombinant humanised anti-human interleukin-1 beta monoclonal antibody Treatment of Behçet's disease XOMA UK Limited 01/10/2010
EU/3/10/798 Synthetic double-stranded short interfering RNA oligonucleotide directed against proopiomelanocortin Treatment of adrenocorticotropin-dependent Cushing's syndrome Diurnal Limited 01/10/2010
EU/3/10/802 2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione Treatment of idiopathic pulmonary fibrosis Genkyotex S.A. 26/11/2010
EU/3/10/803 Chimeric monoclonal antibody against claudin-18 splice variant 2 Treatment of gastric cancer Astellas Pharma Europe B.V. 26/11/2010
EU/3/10/804 Methylthioninium Treatment of progressive supranuclear palsy TauRx Therapeutics Europe Ltd 26/11/2010
EU/3/10/805 Methylthioninium Treatment of behavioural variant frontotemporal dementia TauRx Therapeutics Europe Ltd 26/11/2010
EU/3/10/806 Methylthioninium Treatment of progressive non-fluent aphasia TauRx Therapeutics Europe Ltd 26/11/2010
EU/3/10/807 Methylthioninium Treatment of frontotemporal dementia with parkinsonism-17 TauRx Therapeutics Europe Ltd 26/11/2010
EU/3/10/808 Murine monoclonal antibody against CD26 Treatment of graft-versus-host disease ADIENNE S.r.l. 26/11/2010
EU/3/10/810 N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate Treatment of post-essential thrombocythaemia myelofibrosis SynteractHCR Deutschland GmbH 26/11/2010
EU/3/10/811 N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate Treatment of post-polycythaemia vera myelofibrosis SynteractHCR Deutschland GmbH 26/11/2010
EU/3/10/813 Recombinant human arylsulfatase A Treatment of metachromatic leukodystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
EU/3/10/814 Recombinant human von Willebrand factor Treatment of von Willebrand disease Baxalta Innovations GmbH 26/11/2010
EU/3/10/815 Sildenafil citrate Treatment of postcardiotomy right ventricular failure Pfizer Limited 26/11/2010
EU/3/10/816 7-beta-hydroxycholesteryl-3-beta-oleate Treatment of glioma Intsel Chimos SA 17/12/2010
EU/3/10/817 Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene Treatment of rhodopsin-linked retinitis pigmentosa Spark Therapeutics Ireland Ltd 17/12/2010
EU/3/10/818 Human heterologous liver cells (for infusion) Treatment of citrullinaemia type 1 Promethera Biosciences 17/12/2010
EU/3/10/819 Human heterologous liver cells (for infusion) Treatment of hyperargininaemia Promethera Biosciences 17/12/2010
EU/3/10/820 Human heterologous liver cells (for infusion) Treatment of argininosuccinic aciduria Promethera Biosciences 17/12/2010
EU/3/10/821 Human heterologous liver cells (for infusion) Treatment of carbamoyl-phosphate synthase-1 deficiency Promethera Biosciences 17/12/2010
EU/3/10/822 Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene Treatment of Fanconi anaemia type A Consorcio Centro de Investigación Biomédica en Red M.P. 17/12/2010
EU/3/10/823 Lomitapide Treatment of familial chylomicronaemia Aegerion Pharmaceuticals Limited 17/12/2010
EU/3/10/824 N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl) amino] isonicotinamide hydrochloride Treatment of acute myeloid leukaemia Merck KGaA 17/12/2010
EU/3/10/825 Ovine anti-colchicine polyclonal antibody fragments Treatment of colchicine poisoning Laboratoires SERB 17/12/2010
EU/3/10/826 Para-aminosalicylic acid Treatment of tuberculosis Lucane Pharma SA 17/12/2010 Granupas
EU/3/10/827 Recombinant human lysosomal acid lipase Treatment of lysosomal acid lipase deficiency Alexion Europe SAS 17/12/2010 Kanuma
EU/3/10/828 Silibinin-C-2',3-dihydrogensuccinate, disodium salt Prevention of recurrent hepatitis C in liver transplant recipients Rottapharm S.p.A 17/12/2010
EU/3/10/829 Tesetaxel Treatment of gastric cancer Genta Development Limited 17/12/2010
EU/3/10/830 Veliparib Treatment of ovarian cancer AbbVie Deutschland GmbH & Co. KG 17/12/2010
EU/3/10/831 Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin Treatment of mantle cell lymphoma Biovest Europe Limited 23/02/2011
EU/3/10/832 Deferiprone Treatment of sickle cell disease Apotex Europe B.V. 23/02/2011
EU/3/10/833 Doxorubicin hydrochloride (in heat-sensitive liposomes) Treatment of hepatocellular carcinoma Biological Consulting Europe Ltd 23/02/2011
EU/3/10/836 Paquinimod Treatment of systemic sclerosis Active Biotech AB 23/02/2011
EU/3/10/840 Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 Treatment of acute lymphoblastic leukaemia Xenetic Biosciences Plc 23/02/2011
EU/3/10/841 Tasimelteon Treatment of non-24-hour sleep-wake disorders in blind people with no light perception Vanda Pharmaceuticals Limited 23/02/2011 Hetlioz
EU/3/10/842 Nimorazole Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Azanta A/S 23/02/2011
EU/3/10/845 Dry extract from birch bark (DER 0.1-0.2:1), extraction solvent n-heptane 95% (V/V) Treatment of epidermolysis bullosa Birken AG 23/02/2011
EU/3/10/846 Paclitaxel (aqueous gel) Treatment of oesophagus carcinoma BTG plc 23/02/2011
EU/3/10/847 Pegylated B-domain-deleted sequence-modified recombinant human factor VIII Treatment of haemophilia A Bayer AG 23/02/2011
EU/3/10/848 Sodium thiosulfate Treatment of calciphylaxis Dr Franz Köhler Chemie GmbH 23/02/2011
EU/3/11/849 (S)-{8-fluoro-2-2[4-(3-methoxyphenyl)-1-piperazinyl]-3-[2-methoxy-5-(trifluoromethyl)-phenyl]-3,4-dihydro-4-quinazolinyl} acetic acid Prevention of cytomegalovirus disease in patients with impaired cell-mediated immunity deemed at risk Merck Sharp & Dohme Limited 15/04/2011 PREVYMIS
EU/3/11/850 Darinaparsin Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) IDEA Innovative Drug European Associates Limited 15/04/2011
EU/3/11/851 Glufosfamide Treatment of pancreatic cancer Theradex (Europe) Ltd 15/04/2011
EU/3/11/855 Recombinant fusion protein linking human coagulation factor VIIa with human albumin Treatment of haemophilia A CSL Behring GmbH 15/04/2011
EU/3/11/856 Recombinant thymidine phosphorylase encapsulated in autologous erythrocytes Treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) due to thymidine phosphorylase deficiency St George's University of London 15/04/2011
EU/3/11/857 Synthetic double-stranded siRNA oligonucleotide directed against transthyretin mRNA Treatment of transthyretin-mediated amyloidosis Alnylam UK Limited 15/04/2011
EU/3/11/858 R-baclofen Treatment of fragile X syndrome Lakeside Regulatory Consulting Services Ltd 15/04/2011
EU/3/11/860 Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene Treatment of Leber's hereditary optic neuropathy GenSight- Biologics 13/05/2011
EU/3/11/861 9-cis-Retinyl acetate Treatment of Leber's congenital amaurosis QLT Ophthalmics (UK), Ltd 13/05/2011
EU/3/11/862 Apomorphine hydrochloride Treatment of moderate and severe traumatic brain injury Dr Elkan Raphael Gamzu 13/05/2011
EU/3/11/863 Recombinant fusion protein linking human coagulation factor VIIa with human albumin Treatment of haemophilia B CSL Behring GmbH 13/05/2011
EU/3/11/864 Adeno-associated viral vector containing the human ARSB gene Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Fondazione Telethon 13/05/2011
EU/3/11/865 9-cis-Retinyl acetate Treatment of retinitis pigmentosa QLT Ophthalmics (UK), Ltd 13/05/2011
EU/3/11/868 Lenalidomide Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 13/05/2011
EU/3/11/869 Lisuride hydrogen maleate Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Sinoxa Pharma GmbH 13/05/2011
EU/3/11/870 S-nitrosoglutathione Treatment of pre-eclampsia Salupont Consulting Ltd 13/05/2011
EU/3/11/872 Sulfonated monophosphorylated mannose oligosaccharide Treatment of hepatocellular carcinoma S-cubed Ltd 21/06/2011
EU/3/11/874 Human embryonic stem-cell-derived retinal pigment epithelial cells Treatment of Stargardt’s disease Astellas Pharma Europe B.V. 21/06/2011
EU/3/11/875 Metronidazole Treatment of pouchitis Avivia Projects BV 21/06/2011
EU/3/11/876 Viral vector containing DNA encoding the human SMN protein Treatment of 5q spinal muscular atrophy University of Sheffield 21/06/2011
EU/3/11/877 Adeno-associated viral vector serotype 9 containing the human sulfamidase gene Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Laboratorios del Dr Esteve, S.A. 21/06/2011
EU/3/11/878 Allogeneic T cells encoding an exogenous TK gene Treatment of acute lymphoblastic leukaemia LTKFarma 21/06/2011
EU/3/11/880 Genetically modified human adenovirus encoding human PH20 hyaluronidase Treatment of pancreatic cancer VCN Biosciences S.L. 21/06/2011
EU/3/11/881 Acadesine Treatment of multiple myeloma Advancell - Advanced In Vitro Cell Technologies S.A. 05/08/2011
EU/3/11/883 Low molecular weight dextran sulfate Treatment for mobilisation of progenitor cells prior to stem cell transplantation TikoMed AB 05/08/2011
EU/3/11/884 Methyl O-4-O-[2-[2-[2-[2-[[N-[(1R)-1-[[4-(aminoiminomethyl)phenyl]methyl]-2-oxo-2-(1-piperidinyl)ethyl]-N2-[(4-methoxy-2,3,6-trimethylphenyl)sulfonyl]-L-a-asparaginyl-4-aminobutanoyl-N6-[5-[(3aS,4S,6aR)-hexahydro-2-oxo-1H-thieno[3,4-d]imidazol-4-yl]-1-oxopentyl]-L-lysyl]amino]ethoxy]ethoxy]ethoxy]ethyl]-2,3-di-O-methyl-6-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl--D-glucopyranuronosyl-(1->4)-O-2,3,6-tri-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-a-L-idopyranuronosyl-(1->4)-3-O-methyl-a-D-glucopyranoside 2,6-bis(hydrogen sulfate) octasodium salt Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Endotis Pharma 05/08/2011
EU/3/11/885 Mixture of seven synthetic fragments consisting of p21 RAS peptides Treatment of pancreatic cancer Targovax ASA 05/08/2011
EU/3/11/886 N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt Treatment of post-polycythaemia vera myelofibrosis Gilead Sciences International Limited 05/08/2011
EU/3/11/887 N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt Treatment of post-essential thrombocythaemia myelofibrosis Gilead Sciences International Limited 05/08/2011
EU/3/11/888 N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt Treatment of primary myelofibrosis Gilead Sciences International Limited 05/08/2011
EU/3/11/889 Pegylated recombinant Erwinia chrysanthemi L-asparaginase Treatment of acute lymphoblastic leukaemia Jazz Pharmaceuticals France SAS 05/08/2011
EU/3/11/890 Peretinoin Treatment of hepatocellular carcinoma Kowa Pharmaceutical Europe Co. Ltd 05/08/2011
EU/3/11/892 5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride Treatment of 5q spinal muscular atrophy Repligen Europe Limited 30/08/2011
EU/3/11/893 Cardiotrophin-1 Treatment of acute liver failure Digna Biotech S.L. 30/08/2011
EU/3/11/895 Hydroxy-propyl-beta-cyclodextrin Treatment of Niemann-Pick disease, type C Medical Need Europe AB 30/08/2011
EU/3/11/896 Multilamellar microvesicle comprising phosphatidylcholine, sphingomyelin, phosphatidylethanolamine, phosphatidylserine, phospatidylinositol and cholesterol Treatment of cystic fibrosis Lamellar Biomedical Ltd 30/08/2011
EU/3/11/897 N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide Treatment of tuberculosis RLM Consulting 30/08/2011
EU/3/11/898 Sirolimus Treatment of chronic non-infectious uveitis Santen Oy 30/08/2011
EU/3/11/899 2,2'-{2-[(1R)-1-({[(2,5-dichlorobenzoyl)amino]acetyl}amino)-3-methylbutyl]-5-oxo-1,3,2-dioxaborolane-4,4-diyl}diacetic acid Treatment of multiple myeloma Takeda Pharma A/S 27/09/2011 Ninlaro
EU/3/11/900 20-pentaerythritol poly (oxy-1,2-ethanediyl)-carboxymethyl-glycinate-7-ethyl-10-hydroxycamptothecine 10-[1,4'-bipiperidine]-1'-carboxylate Treatment of ovarian cancer Nektar Therapeutics UK Ltd 27/09/2011
EU/3/11/901 Dinaciclib Treatment of chronic lymphocytic leukaemia Merck Sharp & Dohme Limited 27/09/2011
EU/3/11/902 Eflornithine Treatment of neuroblastoma Cancer Prevention Pharma Limited 27/09/2011
EU/3/11/903 Genetically modified Lactococcus lactis bacteria containing the human trefoil factor 1 gene Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Intrexon Actobiotics N.V. 27/09/2011
EU/3/11/904 Heterologous human adult liver-derived stem cells Treatment of ornithine transcarbamylase deficiency Fresenius Medical Care Deutschland GmbH 27/09/2011
EU/3/11/909 Macitentan Treatment of pulmonary arterial hypertension Actelion Registration Ltd 27/09/2011 Opsumit
EU/3/11/910 NH2-Cys-Ser-Ser-Val-Thr-Ala-Trp-Thr-Thr-Gly-Cys-Gly-CONH2 Treatment of traumatic spinal cord injury PHARMAXON 27/09/2011
EU/3/11/911 Recombinant human galactocerebrosidase Treatment of globoid cell leukodystrophy (Krabbe disease) ACE BioSciences A/S 27/09/2011
EU/3/11/912 Reparixin Prevention of graft rejection in pancreatic islet transplantation Dompé farmaceutici S.p.A. 27/09/2011
EU/3/11/913 Resminostat Treatment of hepatocellular carcinoma 4SC AG 27/09/2011
EU/3/11/914 Smilagenin Treatment of amyotrophic lateral sclerosis QRC Consultants Ltd 27/09/2011
EU/3/11/916 2-hydroxyoleic acid Treatment of glioma Lipopharma Therapeutics SL 27/10/2011
EU/3/11/917 Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Institut Pasteur 27/10/2011
EU/3/11/919 Clonidine hydrochloride Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Monopar Therapeutics SARL 27/10/2011
EU/3/11/920 Gallium (68Ga)-pasireotide tetraxetan Diagnosis of gastro-entero-pancreatic neuroendocrine tumours OctreoPharm Sciences GmbH 27/10/2011
EU/3/11/921 Glycosylation independent lysosomal targeting tagged recombinant human acid alpha glucosidase Treatment of glycogen storage disease type II (Pompe's disease) BioMarin Europe Ltd 27/10/2011
EU/3/11/922 Human platelet antigen-1a immunoglobulin Prevention of fetal and neonatal alloimmune thrombocytopenia due to human platelet antigen-1a incompatibility Prophylix Pharma AS 27/10/2011
EU/3/11/923 L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-, complex with keyhole limpet haemocyanin Treatment of glioma Orphix Consulting GmbH 27/10/2011
EU/3/11/924 Lenalidomide Treatment of mantle cell lymphoma Celgene Europe Limited 27/10/2011 Revlimid
EU/3/11/925 Mifepristone Treatment of hypercortisolism (Cushing's syndrome) of endogenous origin Dr Ulrich Granzer 27/10/2011
EU/3/11/926 Recombinant human minibody against complement component C5 Treatment of primary membranoproliferative glomerulonephritis ADIENNE S.r.l. 27/10/2011
EU/3/11/927 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol, sodium salt and palmitic acid Treatment of cystic fibrosis Pharm Research Associates (UK) Limited 27/10/2011
EU/3/11/928 Cysteamine Treatment of cystic fibrosis NovaBiotics Ltd 09/12/2011
EU/3/11/930 Resminostat Treatment of Hodgkin's lymphoma 4SC AG 09/12/2011
EU/3/11/932 Pegylated proline-interferon alpha-2b Treatment of polycythaemia vera AOP Orphan Pharmaceuticals AG 09/12/2011
EU/3/11/933 Nanoliposomal irinotecan Treatment of pancreatic cancer Baxalta Innovations GmbH 09/12/2011 Onivyde
EU/3/11/935 Interferon gamma Treatment of Friedreich's ataxia Horizon Pharma Ireland Limited 09/12/2011
EU/3/11/936 Human haptoglobin Treatment of sickle cell disease Bio Products Laboratory Ltd 09/12/2011
EU/3/11/937 Alpha-tocotrienol quinone Treatment of Leigh syndrome Edison Orphan Pharma BV 09/12/2011
EU/3/11/938 Adeno-associated viral vector containing the human factor IX gene Treatment of haemophilia B uniQure Biopharma B.V. 11/01/2012
EU/3/11/939 Brentuximab vedotin Treatment of cutaneous T-cell lymphoma Takeda Pharma A/S 11/01/2012 ADCETRIS
EU/3/11/941 Lipopolysaccharide of Ochrobactrum intermedium Prevention of sepsis in at-risk premature infants of less than or equal to 32 weeks of gestational age Diomune S.L. 11/01/2012
EU/3/11/942 Liposomal combination of cytarabine and daunorubicin Treatment of acute myeloid leukaemia Jazz Pharmaceuticals Ireland Ltd 11/01/2012
EU/3/11/943 Mogamulizumab Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Kyowa Kirin Limited 11/01/2012
EU/3/11/944 N,N'-bis(2-mercaptoethyl)isophthalamide Treatment of mercury toxicity NBMI Science Limited 11/01/2012
EU/3/11/945 Ornithine phenylacetate Treatment of acute liver failure Mallinckrodt Pharmaceuticals Ireland Limited 11/01/2012
EU/3/12/952 Nimorazole maleate Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Conventia Medical LLP 09/02/2012
EU/3/12/953 (1S,3S)-3-amino-4-(difluoromethylene) cyclopentanecarboxylic acid hydrochloride Treatment of West syndrome Catalent Pharma Solutions Limited 09/02/2012
EU/3/12/954 S[+] apomorphine Treatment of amyotrophic lateral sclerosis University of Sheffield 09/02/2012
EU/3/12/955 Doxycycline hyclate Treatment of familial amyloid polyneuropathy Giampaolo Merlini 02/04/2012
EU/3/12/956 Human monoclonal antibody against Fas ligand Treatment of pemphigus PinCell s.r.l. 09/02/2012
EU/3/12/957 Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene Treatment of X-linked chronic granulomatous disease Généthon 09/02/2012
EU/3/12/960 Glucagon Treatment of congenital hyperinsulinism Biodel UK Limited 05/03/2012
EU/3/12/961 Doxycycline hyclate Treatment of systemic amyloidosis caused by beta-2 microglobulin Giampaolo Merlini 05/03/2012
EU/3/12/963 Chlormethine Treatment of cutaneous T-cell lymphoma Actelion Registration Ltd 22/05/2012 Ledaga
EU/3/12/964 Oleylphosphocholine Treatment of leishmaniasis Oblita Therapeutics 23/04/2012
EU/3/12/965 Ketoconazole Treatment of Cushing’s syndrome Laboratoire HRA Pharma 23/04/2012 Ketoconazole HRA
EU/3/12/967 Sodium nitrite Treatment of pulmonary arterial hypertension FGK Representative Service GmbH 05/03/2012
EU/3/12/968 Human monoclonal antibody targeting Staphylococcus aureus alpha-toxin Treatment of pneumonia caused by Staphylococcus aureus Global Regulatory Limited 05/03/2012
EU/3/12/969 Allogeneic human dendritic cells derived from a CD34+ progenitor cell line Treatment of acute myeloid leukaemia DCPrime BV 22/05/2012
EU/3/12/970 6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2(3H)-one Treatment of amyotrophic lateral sclerosis Pharma Gateway AB 05/03/2012
EU/3/12/971 Heterologous human adult liver-derived stem cells Treatment of carbamoyl-phosphate synthase-1 deficiency Fresenius Medical Care Deutschland GmbH 05/03/2012
EU/3/12/972 Sialic acid Treatment of GNE myopathy Ultragenyx Germany GmbH 05/03/2012
EU/3/12/973 Recombinant human beta-glucuronidase Treatment of mucopolysaccharidosis type VII (Sly syndrome) Ultragenyx Germany GmbH 21/03/2012
EU/3/12/974 Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene Treatment of primary hyperoxaluria type 1 uniQure Biopharma B.V. 21/03/2012
EU/3/12/975 Carbetocin Treatment of Prader-Willi syndrome Voisin Consulting S.A.R.L. 21/03/2012
EU/3/12/976 Antisense oligonucleotide targeted to the SMN2 gene Treatment of 5q spinal muscular atrophy Biogen Idec Limited 02/04/2012 Spinraza
EU/3/12/978 Melatonin Treatment of perinatal asphyxia Chiesi Farmaceutici S.p.A. 02/04/2012
EU/3/12/979 Sodium thiosulfate Treatment of calciphylaxis Aptiv Solutions (UK) Limited 02/04/2012
EU/3/12/980 Genistein sodium salt dihydrate Treatment of mucopolysaccharidosis type III (Sanfilippo syndrome) Axcentua Pharmaceuticals AB 02/04/2012
EU/3/12/981 Adenovirus associated viral vector serotype 2 containing the human RPE65 gene Treatment of Leber’s congenital amaurosis Spark Therapeutics Ireland Ltd 02/04/2012
EU/3/12/982 Dipalmitoylphosphatidylcholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol, sodium salt, synthetic surfactant protein C analogue and synthetic surfactant protein B analogue Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Chiesi Farmaceutici S.p.A. 02/04/2012
EU/3/12/983 Heterologous human adult liver-derived stem cells Treatment of acute liver failure Fresenius Medical Care Deutschland GmbH 26/04/2012
EU/3/12/984 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4 d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one Treatment of chronic lymphocytic leukaemia Janssen-Cilag International NV 26/04/2012 IMBRUVICA
EU/3/12/985 Recombinant human methionine proinsulin Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 26/04/2012
EU/3/12/987 (E)-2,4,6-trimethoxystyryl-3-carboxymethylamino-4-methoxybenzyl-sulfone sodium salt Treatment of myelodysplastic syndromes Onconova Europe GmbH 26/04/2012
EU/3/12/988 Halofuginone Hydrobromide Treatment of Duchenne muscular dystrophy Biological Consulting Europe Ltd 26/04/2012
EU/3/12/989 2-Allyl-1-[6-(1-hydroxy-1-methylethyl)pyridin-2-yl]-6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-1,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin-3-one Treatment of ovarian cancer AstraZeneca UK Limited 26/04/2012
EU/3/12/990 Vosaroxin Treatment of acute myeloid leukaemia Sunesis Europe Ltd 26/04/2012
EU/3/12/991 Exon 45 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy BioMarin International Limited 26/04/2012
EU/3/12/992 Exon 53 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy BioMarin International Limited 26/04/2012
EU/3/12/993 N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide Treatment of neurofibromatosis type 2 Sirius Regulatory Consulting Limited 26/04/2012
EU/3/12/994 Yttrium (90Y)-DTPA-radiolabelled chimeric monoclonal antibody against frizzled homologue 10 Treatment of soft tissue sarcoma Laboratoires OncoTherapy Science France, S.A.R.L 25/05/2012
EU/3/12/995 Pegylated recombinant factor VIII Treatment of haemophilia A Novo Nordisk A/S 26/04/2012
EU/3/12/996 N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide Treatment of meningioma Sirius Regulatory Consulting Limited 06/06/2012
EU/3/12/997 N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide Treatment of schwannoma Sirius Regulatory Consulting Limited 06/06/2012
EU/3/12/998 Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene Treatment of Wiskott-Aldrich syndrome GlaxoSmithKline Trading Services Limited 06/06/2012
EU/3/12/999 Letermovir Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity Merck Sharp & Dohme Limited 06/06/2012
EU/3/12/1002 Adenovirus-associated vector containing human Fas-c gene Treatment of glioma Envigo Pharma Consulting Ltd 06/06/2012
EU/3/12/1003 Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA Treatment of adrenoleukodystrophy bluebird bio France 06/06/2012
EU/3/12/1008 Human erythrocytes encapsulating inositol hexaphosphate Treatment of sickle cell disease ERYtech Pharma S.A. 04/07/2012
EU/3/12/1009 Givinostat Treatment of Duchenne muscular dystrophy Italfarmaco S.p.A. 04/07/2012
EU/3/12/1010 Ataluren Treatment of Becker muscular dystrophy PTC Therapeutics International Limited 04/07/2012
EU/3/12/1011 Levoglutamide Treatment of sickle cell disease Emmaus Medical Europe Limited 04/07/2012
EU/3/12/1012 2S, 4R ketoconazole Treatment of Cushing’s syndrome Cortendo AB 04/07/2012
EU/3/12/1013 Recombinant human interleukin-7 Treatment of progressive multifocal leukoencephalopathy Inserm-ANRS (Agence Nationale de Recherches sur le Sida et les Hépatites Virales) 04/07/2012
EU/3/12/1016 16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide Treatment of neuroblastoma Biogenera SpA 04/07/2012
EU/3/12/1018 Recombinant adeno-associated viral vector containing human acid alfa-glucosidase-gene Treatment of glycogen storage disease type II (Pompe's disease) Audentes Therapeutics UK Limited 04/07/2012
EU/3/12/1020 Recombinant human pentraxin-2 Treatment of idiopathic pulmonary fibrosis FGK Representative Service GmbH 17/07/2012
EU/3/12/1021 1-[(2-Chloro-4-methoxyphenoxy)methyl]-4-[(2,6-dichlorophenoxy)methyl]benzene Prevention of poliomyelitis in patients with immunodeficiencies deemed at risk ViroDefense Ltd 17/07/2012
EU/3/12/1022 Metreleptin Treatment of Familial Partial Lipodystrophy Aegerion Pharmaceuticals B.V. 17/07/2012
EU/3/12/1023 Metreleptin Treatment of Barraquer-Simons syndrome Aegerion Pharmaceuticals B.V. 17/07/2012
EU/3/12/1024 Metreleptin Treatment of Lawrence syndrome Aegerion Pharmaceuticals B.V. 17/07/2012
EU/3/12/1025 Metreleptin Treatment of Berardinelli-Seip syndrome Aegerion Pharmaceuticals B.V. 17/07/2012
EU/3/12/1026 Hexasodium phytate Treatment of calciphylaxis Laboratoris Sanifit S.L. 17/07/2012
EU/3/12/1027 Human apotransferrin Treatment of congenital hypotransferrinaemia Sanquin Plasma Products B.V. 17/07/2012
EU/3/12/1028 (2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid Treatment of progressive familial intrahepatic cholestasis Albireo AB 17/07/2012
EU/3/12/1031 Ketoconazole Treatment of Cushing’s syndrome Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare 09/08/2012
EU/3/12/1033 N-Butyldeoxygalactonojirimycin Treatment of Fabry disease Idorsia Pharmaceuticals Deutschland GmbH 09/08/2012
EU/3/12/1034 Humanised monoclonal antibody against P-selectin Treatment of sickle cell disease Novartis Europharm Limited 09/08/2012
EU/3/12/1035 Recombinant human monoclonal antibody against activin receptor type IIB Treatment of inclusion body myositis Novartis Europharm Limited 09/08/2012
EU/3/12/1036 Trans-4-[4-[5-[[6-(trifluoromethyl)-3-pyridinyl]amino]-2-pyridinyl]phenyl] cyclohexane acetic acid sodium salt Treatment of familial chylomicronaemia syndrome (type I hyperlipoproteinaemia) Novartis Europharm Limited 14/09/2012
EU/3/12/1038 Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) AOP Orphan Pharmaceuticals AG 09/08/2012
EU/3/12/1039 Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein Treatment of cutaneous T-cell lymphoma AOP Orphan Pharmaceuticals AG 09/08/2012
EU/3/12/1040 (2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid Treatment of Alagille syndrome Albireo AB 09/08/2012
EU/3/12/1041 (2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid Treatment of primary biliary cirrhosis Albireo AB 09/08/2012
EU/3/12/1042 Covalently closed DNA plasmids coding for cytomegalovirus phosphoprotein 65 and glycoprotein B genes Prevention of cytomegalovirus disease in patients with impaired cell mediated immunity deemed at risk Astellas Pharma Europe B.V. 09/08/2012
EU/3/12/1043 N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine to be used with folic acid Diagnosis of positive folate receptor status in ovarian cancer Voisin Consulting S.A.R.L. 10/09/2012
EU/3/12/1045 Alpha-1 proteinase inhibitor (for inhalation use) Treatment of cystic fibrosis Grifols Deutschland GmbH 10/10/2012
EU/3/12/1046 Mavoglurant Treatment of fragile X syndrome Novartis Europharm Limited 10/10/2012
EU/3/12/1049 Rucaparib Treatment of ovarian cancer Clovis Oncology UK Limited 10/10/2012
EU/3/12/1050 [2-Cyano-3-cyclopropyl-3-hydroxy-N-(3-methyl-4-trifluoromethylphenyl)prop-2-enamide] Treatment of traumatic spinal cord injury Algiax Pharmaceuticals GmbH 10/10/2012
EU/3/12/1051 Recombinant human lecithin cholesterol acyltransferase Treatment of lecithin cholesterol acyltransferase deficiency AstraZeneca UK Limited 10/10/2012
EU/3/12/1052 Humanised monoclonal IgG4 antibody against tissue factor pathway inhibitor Treatment of haemophilia A Novo Nordisk A/S 10/10/2012
EU/3/12/1053 Lurbinectedin Treatment of ovarian cancer Pharma Mar S.A. 10/10/2012
EU/3/12/1054 Obinutuzumab Treatment of chronic lymphocytic leukaemia Roche Registration GmbH 10/10/2012 Gazyvaro
EU/3/12/1055 Belinostat Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Onxeo DK, Filial af Onxeo S.A., Frankrig 10/10/2012
EU/3/12/1057 Naloxone hydrochloride dihydrate Treatment of cutaneous T-cell lymphoma Winston Laboratories Ltd 08/11/2012
EU/3/12/1058 IL-12-secreting dendritic cells, loaded with autologous tumour lysate Treatment of glioma Activartis Biotech GmbH 08/11/2012
EU/3/12/1059 Milciclib maleate Treatment of malignant thymoma Tiziana Life Sciences PLC 08/11/2012
EU/3/12/1060 Ixazomib Treatment of systemic light chain amyloidosis Takeda Pharma A/S 08/11/2012
EU/3/12/1062 Chimeric monoclonal antibody against GD2 Treatment of neuroblastoma EUSA Pharma (UK) Limited 08/11/2012 Qarziba
EU/3/12/1063 Panobinostat Treatment of multiple myeloma Novartis Europharm Limited 08/11/2012 Farydak
EU/3/12/1066 tafamidis Treatment of senile systemic amyloidosis Pfizer Limited 08/11/2012
EU/3/12/1067 Erdosteine Treatment of mercury toxicity Rafifarm SRL 08/11/2012
EU/3/12/1068 Melarsoprol Treatment of African trypanosomiasis Pr. Peter Kennedy 08/11/2012
EU/3/12/1070 Recombinant human dyskerin Treatment of dyskeratosis congenita Advanced Medical Projects 08/11/2012
EU/3/12/1072 Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor Treatment of macular telangiectasia type 2 Le4D Limited 08/11/2012
EU/3/12/1073 Maytansinoid-conjugated human monoclonal antibody against mesothelin Treatment of malignant mesothelioma Bayer AG 06/12/2012
EU/3/12/1075 Cyclo(-gamma-aminobutyryl-L-phenylalanyl-L-tryptophanyl-D-tryptophanyl-L-lysyl-L-threonyl-L phenylalanyl-N-3-carboxypropyl)-glycine amide, acetate salt Treatment of acromegaly Cortendo AB 06/12/2012
EU/3/12/1076 Allopurinol sodium Treatment of perinatal asphyxia Pharmathen S.A. 06/12/2012
EU/3/12/1077 Exon 52 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy BioMarin International Limited 06/12/2012
EU/3/12/1078 Exon 55 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy BioMarin International Limited 06/12/2012
EU/3/12/1079 Artesunate Treatment of malaria Dafra Pharma International NV 06/12/2012
EU/3/12/1080 4-(4-{[2-(4-chlorophenyl)-4,4-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-({3-nitro-4-[(tetrahydro-2H-pyran-4-ylmethyl)amino]phenyl}sulfonyl)-2-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)benzamide Treatment of chronic lymphocytic leukaemia AbbVie Deutschland GmbH & Co. KG 06/12/2012 Venclyxto
EU/3/12/1083 Humanised single chain monoclonal antibody against CD37 Treatment of chronic lymphocytic leukaemia Aptevo Europe Limited 06/12/2012
EU/3/12/1084 Erdosteine Treatment of lead toxicity Rafifarm SRL 06/12/2012
EU/3/12/1085 Voclosporin Treatment of non-infectious uveitis Granzer Regulatory Consulting & Services 06/12/2012
EU/3/12/1086 Eflornithine in combination with sulindac Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 24/01/2013
EU/3/12/1087 Recombinant modified human growth hormone Treatment of growth hormone deficiency Richardson Associates Regulatory Affairs Ltd 24/01/2013
EU/3/12/1088 Allogeneic motor neuron progenitor cells derived from human embryonic stem cells Treatment of 5q spinal muscular atrophy California Stem Cell (UK) Ltd 24/01/2013
EU/3/12/1089 Choline tetrathiomolybdate Treatment of Wilson's disease Wilson Therapeutics AB 24/01/2013
EU/3/12/1091 Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human betaA-T87Q-globin gene Treatment of beta-thalassaemia intermedia and major bluebird bio France 24/01/2013
EU/3/12/1092 Chimeric monoclonal antibody against claudin 6 Treatment of ovarian cancer Astellas Pharma Europe B.V. 24/01/2013
EU/3/12/1093 1,2:5,6-Dianhydrogalactitol Treatment of glioma IDIS Ltd 24/01/2013
EU/3/12/1094 Modified recombinant human C-type natriuretic peptide Treatment of achondroplasia BioMarin Europe Ltd 24/01/2013
EU/3/12/1095 Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Laboratorios del Dr Esteve, S.A. 24/01/2013
EU/3/12/1096 Terguride Treatment of systemic sclerosis medac Gesellschaft für klinische Spezialpräparate mbH 24/01/2013
EU/3/12/1097 Lenalidomide Treatment of follicular lymphoma Celgene Europe Limited 24/01/2013
EU/3/12/1098 Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor Treatment of retinitis pigmentosa Enpharma Ltd 24/01/2013
EU/3/13/1099 Recombinant adeno-associated viral vector containing the human CNGB3 gene Treatment of achromatopsia caused by mutations in the CNGB3 gene TMC Pharma Services Ltd 08/02/2013
EU/3/13/1100 Humanised IgG1 kappa antibody against serum amyloid A and AL amyloid Treatment of amyloid light-chain amyloidosis Prothena Therapeutics Limited 08/02/2013
EU/3/13/1102 Cyclo-Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys Treatment of high altitude pulmonary oedema Apeptico Forschung und Entwicklung GmbH 08/02/2013
EU/3/13/1103 Treprostinil sodium Treatment of chronic thromboembolic pulmonary hypertension SciPharm S.a.r.L 08/02/2013
EU/3/13/1105 Humanised monoclonal antibody against myostatin Treatment of Duchenne muscular dystrophy Pfizer Limited 08/02/2013
EU/3/13/1106 L-asparaginase encapsulated in erythrocytes Treatment of acute myeloid leukaemia ERYtech Pharma S.A. 08/02/2013
EU/3/13/1107 Recombinant adeno-associated viral vector containing the human retinoschisin gene Treatment of X-linked juvenile retinoschisis TMC Pharma Services Ltd 12/03/2013
EU/3/13/1108 2-[4-Methoxy-3-(2-m-tolyl-ethoxy)-benzoylamino]-indan-2-carboxylic acid Treatment of systemic sclerosis Sanofi-Aventis groupe 12/03/2013
EU/3/13/1109 4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate Treatment of hepatocellular carcinoma Eli Lilly Nederland B.V. 13/03/2013
EU/3/13/1111 Gevokizumab Treatment of chronic non-infectious uveitis XOMA UK Limited 12/03/2013
EU/3/13/1113 Murine IgM monoclonal antibody binding to alpha beta T-cell receptor Prevention of graft rejection following solid organ transplantation CTI Clinical Trial and Consulting Services Europe GmbH 12/03/2013
EU/3/13/1114 Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl] acetate salt Treatment of congenital alpha-1 antitrypsin deficiency Polyphor UK Ltd 20/03/2013
EU/3/13/1115 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one Treatment of mantle cell lymphoma Janssen-Cilag International NV 12/03/2013 IMBRUVICA
EU/3/13/1116 Mepolizumab Treatment of Churg-Strauss Syndrome GlaxoSmithKline Trading Services Limited 12/03/2013
EU/3/13/1117 Ramiprilat Treatment of Stargardt’s disease Iris Pharma 12/03/2013
EU/3/13/1118 Recombinant human tripeptidyl-peptidase 1 Treatment of neuronal ceroid lipofuscinosis type 2 BioMarin International Limited 12/03/2013 Brineura
EU/3/13/1119 Lenvatinib Treatment of follicular thyroid cancer Eisai Europe Limited 26/04/2013 Lenvima
EU/3/13/1120 4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate Treatment of glioma Eli Lilly Nederland B.V. 26/04/2013
EU/3/13/1121 Lenvatinib Treatment of papillary thyroid cancer Eisai Europe Limited 26/04/2013 Lenvima
EU/3/13/1122 R,S-O-(3-piperidino-2-hydroxy-1-propyl)-nicotinic acid amidoxime dihydrochloride Treatment of Duchenne muscular dystrophy Vudbenk Life Science Kft. 26/04/2013
EU/3/13/1123 Nintedanib Treatment of idiopathic pulmonary fibrosis Boehringer Ingelheim International GmbH 26/04/2013 Ofev
EU/3/13/1124 2-hydroxypropyl--cyclodextrin Treatment of Niemann-Pick disease, type C Vtesse Europe Limited 26/04/2013
EU/3/13/1125 (S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one Treatment of chronic lymphocytic leukaemia/small lymphocytic lymphoma Voisin Consulting S.A.R.L. 26/04/2013
EU/3/13/1126 Mexiletine hydrochloride Treatment of non-dystrophic myotonia Prof. Michael Hanna 07/06/2013
EU/3/13/1127 Inotuzumab ozogamicin Treatment of B-cell acute lymphoblastic leukaemia Pfizer Limited 07/06/2013 Besponsa
EU/3/13/1128 N-[2,6-bis(1-methylethyl)phenyl]-N-[[1-[4-(dimethylamino) phenyl]cyclopentyl]methyl]urea, hydrochloride salt Treatment of adrenocortical carcinoma Millendo Therapeutics Ltd 07/06/2013
EU/3/13/1129 Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media Treatment of graft-versus-host disease Cell2B Advanced Therapeutics, SA 07/06/2013
EU/3/13/1130 Recombinant human transglutaminase 1 encapsulated into liposomes Treatment of transglutaminase-1-deficient autosomal recessive congenital ichthyosis Westfälische Wilhelms-Universität Münster 07/06/2013
EU/3/13/1131 Recombinant human CXCL8 mutant Treatment of cystic fibrosis ProtAffin Biotechnologie AG 07/06/2013
EU/3/13/1132 N-methyl-4-({4-[({3-methyl(methylsulfonyl)aminopyrazin-2-yl}methyl)amino]-5-(trifluoromethyl)pyrimidin-2-yl}amino)benzamide hydrochloride Treatment of malignant mesothelioma TMC Pharma Services Ltd 07/06/2013
EU/3/13/1133 Maribavir Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity Shire Pharmaceuticals Ireland Limited 07/06/2013
EU/3/13/1134 Autologous CD34+ cells transduced with a lentiviral vector containing the human ADA gene Treatment of adenosine deaminase-deficient-severe combined immunodeficiency Orchard Therapeutics Ltd 07/06/2013
EU/3/13/1135 Recombinant human nerve growth factor Treatment of retinitis pigmentosa Dompé farmaceutici S.p.A. 07/06/2013
EU/3/13/1136 5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride Treatment of 5q spinal muscular atrophy Sirius Regulatory Consulting Limited 07/06/2013
EU/3/13/1137 4,6,4trimethylangelicin Treatment of cystic fibrosis Rare Partners srl Impresa Sociale 19/06/2013
EU/3/13/1138 Copper meso-5,15-bis[3-[(1,2-dicarba-closo-dodecaboranyl)methoxy]phenyl]-meso-10,20-dinitroporphyrin Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy MorEx Development Partners LLP 27/06/2013
EU/3/13/1139 Sodium chlorite Treatment of amyotrophic lateral sclerosis FGK Representative Service GmbH 19/06/2013
EU/3/13/1140 Expanded human allogeneic neural retinal progenitor cells extracted from neural retina Treatment of retinitis pigmentosa ReNeuron Ltd 19/06/2013
EU/3/13/1141 Synthetic double-stranded siRNA oligonucleotide directed against the keratin 6a N171K mutation Treatment of pachyonychia congenita Alan Irvine 19/06/2013
EU/3/13/1142 Adenovirus associated viral vector serotype 5 containing the human pde6 gene Treatment of retinitis pigmentosa HORAMA SA 19/06/2013
EU/3/13/1143 Immortalised human C3A hepatoblastoma cells Treatment of acute liver failure Vital Therapies Limited 19/06/2013
EU/3/13/1145 Genetically modified serotype 5/3 adenovirus coding for granulocyte-macrophage colony-stimulating factor Treatment of soft tissue sarcoma Targovax Oy 19/06/2013
EU/3/13/1147 Granulocyte macrophage colony stimulating factor Treatment of pulmonary alveolar proteinosis Savara ApS 17/07/2013
EU/3/13/1148 Autologous bone marrow-derived mesenchymal stromal cells secreting neurotrophic factors Treatment of amyotrophic lateral sclerosis Brainstorm Cell Therapeutics UK Ltd 17/07/2013
EU/3/13/1149 Human hemin Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Borders Technology Management Ltd 17/07/2013
EU/3/13/1150 Moxetumomab pasudotox Treatment of B-lymphoblastic leukaemia/lymphoma MedImmune Ltd 17/07/2013
EU/3/13/1151 Belinostat Treatment of malignant thymoma Onxeo DK, Filial af Onxeo S.A., Frankrig 17/07/2013
EU/3/13/1153 Daratumumab Treatment of plasma cell myeloma Janssen-Cilag International NV 17/07/2013 Darzalex
EU/3/13/1154 Fosbretabulin tromethamine Treatment of ovarian cancer Diamond BioPharm Limited 17/07/2013
EU/3/13/1155 Allogeneic motor neuron progenitor cells derived from human embryonic stem cells Treatment of amyotrophic lateral sclerosis California Stem Cell (UK) Ltd 17/07/2013
EU/3/13/1156 Recombinant human monoclonal antibody against hepatitis B virus Prevention of hepatitis B re-infection following liver transplantation inVentiv Health Germany GmbH 17/07/2013
EU/3/13/1157 (S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one Treatment of follicular lymphoma Voisin Consulting S.A.R.L. 17/07/2013
EU/3/13/1158 Dexamethasone sodium phosphate encapsulated in human autologous erythrocytes Treatment of ataxia telangiectasia Erydel S.p.A. 17/07/2013
EU/3/13/1161 Heterologous human adult liver-derived progenitor cells Treatment of carbamoyl-phosphate synthase-1 deficiency Promethera Biosciences 17/07/2013
EU/3/13/1162 Heterologous human adult liver-derived progenitor cells Treatment of citrullinaemia type 1 Promethera Biosciences 17/07/2013
EU/3/13/1163 Heterologous human adult liver-derived progenitor cells Treatment of argininosuccinic aciduria Promethera Biosciences 17/07/2013
EU/3/13/1164 Heterologous human adult liver-derived progenitor cells Treatment of hyperargininaemia Promethera Biosciences 17/07/2013
EU/3/13/1165 Heterologous human adult liver-derived progenitor cells Treatment of N-acetylglutamate synthetase (NAGS) deficiency Promethera Biosciences 17/07/2013
EU/3/13/1166 Heterologous human adult liver-derived progenitor cells Treatment of citrullinaemia type 2 Promethera Biosciences 17/07/2013
EU/3/13/1167 Heterologous human adult liver-derived progenitor cells Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Promethera Biosciences 17/07/2013
EU/3/13/1168 Ex-vivo expanded autologous human corneal epithelium containing stem cells Treatment of limbal stem cell deficiency University of Newcastle upon Tyne 17/07/2013
EU/3/13/1169 Lipid-complexed cisplatin Treatment of osteosarcoma Richardson Associates Regulatory Affairs Ltd 05/08/2013
EU/3/13/1170 Octreotide acetate (oral use) Treatment of acromegaly Larode Ltd 05/08/2013
EU/3/13/1171 Autologous regulatory T cells with an immunophenotype of CD4+CD25hiFoxP3+ Prevention of graft rejection following solid organ transplantation iReg Medical AB 07/10/2013
EU/3/13/1174 Trans-N1-((1R,2S)-2-phenylcyclopropyl)cyclohexane-1,4-diamine bis-hydrochloride Treatment of acute myeloid leukaemia Oryzon Genomics SA 05/08/2013
EU/3/13/1176 Human allogeneic bone marrow derived osteoblastic-like cells Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 05/08/2013
EU/3/13/1177 Chimeric monoclonal antibody against claudin-18 splice variant 2 Treatment of pancreatic cancer Astellas Pharma Europe B.V. 05/08/2013
EU/3/13/1179 Recombinant human growth hormone modified by fusion with two hydrophilic polypeptide chains Treatment of growth hormone deficiency Larode Ltd 05/08/2013
EU/3/13/1181 Budesonide Treatment of eosinophilic oesophagitis Dr Falk Pharma GmbH 05/08/2013 Jorveza
EU/3/13/1182 Cladribine Treatment of mastocytosis Lipomed GmbH 05/08/2013
EU/3/13/1183 Sacrosidase Treatment of congenital sucrase-isomaltase deficiency QOL Therapeutics UK Ltd 05/08/2013
EU/3/13/1184 (1R,3R,4R,5S)-3-O-[2-O-benzoyl-3-O-(sodium(2S)-3-cyclohexyl-propanoate-2-yl)--D-galactopyranosyl]-4-O-(a-L-fucopyranosyl)-5-orothylamido-cyclohexane-1-carboxylic acid ethyl-2-amidyl-ethyloxy-2-acetyl-(8-amino-1,3,6-naphthalene-tris sodium sulfonate) amide Treatment of sickle cell disease Pfizer Limited 05/08/2013
EU/3/13/1185 Eculizumab Treatment of neuromyelitis optica Alexion Europe SAS 05/08/2013
EU/3/13/1188 Recombinant fusion protein linking coagulation factor VIIa with albumin Treatment of congenital factor VII deficiency CSL Behring GmbH 07/10/2013
EU/3/13/1189 Mexiletine hydrochloride Treatment of myotonic disorders Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare 07/10/2013
EU/3/13/1190 Recombinant human monoclonal IgM antibody targeting glucose-regulated protein 78 Treatment of plasma cell myeloma Patrys GmbH 07/10/2013
EU/3/13/1191 L-Pyr-L-Glu-L-Gln-L-Leu-L-Glu-L-Arg-L-Ala-L-Leu-L-Asn-L-Ser-L-Ser Treatment of sarcoidosis Araim Pharma Europe Ltd 07/10/2013
EU/3/13/1192 Zoledronic acid Treatment of complex regional pain syndrome Axsome Therapeutics Limited 07/10/2013
EU/3/13/1193 3,5-diiodothyropropionic acid Treatment of Allan-Herndon-Dudley syndrome CATS Consultants GmbH 07/10/2013
EU/3/13/1195 Antisense oligonucleotide targeting the F508delta mutation of CFTR Treatment of cystic fibrosis ProQR Therapeutics III BV 07/10/2013
EU/3/13/1196 Autologous CD34+ cells transduced with a lentiviral vector containing the human Wiskott-Aldrich syndrome gene Treatment of Wiskott-Aldrich-syndrome Généthon 07/10/2013
EU/3/13/1197 Autologous ex-vivo-expanded leucocytes treated with 5-aza-2-deoxycytidine Treatment of glioma CytoVac A/S 13/11/2013
EU/3/13/1198 Recombinant human insulin receptor monoclonal antibody-fused iduronate 2-sulfatase Treatment of mucopolysaccharidosis type II (Hunter's syndrome) Voisin Consulting S.A.R.L. 13/11/2013
EU/3/13/1199 Sorafenib tosylate Treatment of follicular thyroid cancer Bayer AG 13/11/2013 Nexavar
EU/3/13/1200 Sorafenib tosylate Treatment of papillary thyroid cancer Bayer AG 13/11/2013 Nexavar
EU/3/13/1201 Defibrotide Prevention of graft-versus-host disease Gentium S.r.I. 13/11/2013
EU/3/13/1203 Ibrutinib Treatment of diffuse large B-cell lymphoma Janssen-Cilag International NV 13/11/2013
EU/3/13/1204 Sirolimus Prevention of arteriovenous access dysfunction in patients undergoing surgical creation of an arteriovenous access for haemodialysis S-cubed Ltd 13/11/2013
EU/3/13/1205 Human monoclonal antibody against human interleukin 13 Treatment of eosinophilic oesophagitis Novartis Europharm Limited 13/11/2013
EU/3/13/1206 Synthetic 12 amino acids peptide designed after subcommissural organ spondin Treatment of spinal cord injury Neuronax SA 13/11/2013
EU/3/13/1207 Trebananib Treatment of ovarian cancer Amgen Europe B.V. 13/11/2013
EU/3/13/1208 Soraprazan Treatment of Stargardt’s disease Katairo GmbH 13/11/2013
EU/3/13/1209 Nitric oxide Treatment of cystic fibrosis Novoteris 18/12/2013
EU/3/13/1210 Recombinant human parathyroid hormone Treatment of hypoparathyroidism Shire Pharmaceuticals Ireland Limited 18/12/2013 Natpar
EU/3/13/1211 Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma Treatment of glioma ERC Belgium 18/12/2013
EU/3/13/1212 Ibrutinib Treatment of follicular lymphoma Janssen-Cilag International NV 18/12/2013
EU/3/13/1213 Lactobacillus acidophilus and Bifidobacterium bifidum Prevention of necrotising enterocolitis Laboratorio Farmaceutico S.I.T. s.r.l. 18/12/2013
EU/3/13/1214 (4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride Treatment of Alagille syndrome Shire Pharmaceuticals Ireland Limited 18/12/2013
EU/3/13/1215 (4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride Treatment of primary biliary cirrhosis Shire Pharmaceuticals Ireland Limited 18/12/2013
EU/3/13/1216 (4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride Treatment of progressive familial intrahepatic cholestasis Shire Pharmaceuticals Ireland Limited 18/12/2013
EU/3/13/1217 (4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride Treatment of primary sclerosing cholangitis Shire Pharmaceuticals Ireland Limited 18/12/2013
EU/3/13/1218 Recombinant human type I pancreatic elastase Prevention of arteriovenous access dysfunction in haemodialysis patients Proteon Therapeutics Limited 18/12/2013
EU/3/13/1219 Fenfluramine hydrochloride Treatment of Dravet syndrome Zogenix International Ltd 18/12/2013
EU/3/13/1220 Poly[2-[(4-{[1-carboxy-2-(hexadecylcarbamoyl)ethyl]sulfanyl}-2,3-bis({2-[((2S)-2-(2-{[(2R)-2-carbamoyl-(2-{[(2S)-1-ethoxy-3-(3-hydroxy-4oxo-1,4-dihydropyridin-1-yl)-1-oxopropan-2-yl]carbamoyl}ethyl]sulfanyl}-3-{[(2S)-1-ethoxy-3-(3-hydroxy-4-oxo-1,4-dihydropyridin-1-yl)-1-oxopropan-2-yl]carbamoyl}propanamido)-3-(3-hydroxy-4-oxo-1,4-dihydropyridin-1-yl)propanoyl Ethyl ester) )-methoxy]acetyl}oxy)butyl)sulfanyl]-3-(hexadecylcarbamoyl)propanoic acid]-poly(ethylene glycol)-ester] Treatment of dengue Coté Orphan Consulting UK Limited 18/12/2013
EU/3/13/1222 Amatuximab Treatment of malignant mesothelioma Eisai Europe Limited 16/01/2014
EU/3/13/1223 Inecalcitol Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Hybrigenics SA 16/01/2014
EU/3/13/1224 Sodium nitrite Treatment of aneurysmal subarachnoid haemorrhage Hope Pharmaceuticals, Ltd 16/01/2014
EU/3/13/1225 Lonafarnib Treatment of hepatitis delta virus infection Eiger Biopharmaceuticals Europe Limited 16/01/2014
EU/3/13/1226 (6aS)-1,10-dimethoxy-6-methyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinoline-2,9-diol Treatment of dystrophic myotonia Valentia BioPharma S.L 16/01/2014
EU/3/13/1227 Adenovirus-specific T-cells derived from allogeneic donor leukocytes, expanded ex vivo Treatment of adenovirus infection in allogeneic haematopoietic stem-cell transplant recipients Cell Medica Ltd 16/01/2014
EU/3/13/1228 Obeticholic acid Treatment of primary sclerosing cholangitis Intercept Pharma Ltd 16/01/2014
EU/3/13/1229 Autologous dendritic cells pulsed with allogeneic tumour cell lysate Treatment of malignant mesothelioma Amphera BV 16/01/2014
EU/3/13/1230 (2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl) amino)methyl)tetrahydrofuran-3,4-diol Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 16/01/2014
EU/3/13/1231 (2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl) amino)methyl)tetrahydrofuran-3,4-diol Treatment of acute lymphoblastic leukaemia Voisin Consulting S.A.R.L. 16/01/2014
EU/3/13/1232 Allantoin Treatment of epidermolysis bullosa Amicus Therapeutics UK Ltd 16/01/2014
EU/3/13/1233 Allogeneic bone-marrow derived ex-vivo expanded multipotent adult progenitor cells Prevention of graft-versus-host disease ReGenesys BVBA 16/01/2014
EU/3/14/1236 Diacerein Treatment of epidermolysis bullosa Medpace Finland OY 19/02/2014
EU/3/14/1237 Gallium [Ga-68]-N-[(4,7,10-tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-Lcysteinyl-L-threonine-cyclic(2-7)disulfide Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 19/02/2014
EU/3/14/1239 11-(4-Dimethylamino-3-hydroxy-6-methyl-tetrahydro-pyran-2-yloxy)-2-ethyl-3,4,10-trihydroxy-3,5,6,8,10,12,14-heptamethyl-1-oxa-6-aza-cyclopentadecane-13,15-dione Treatment of cystic fibrosis Synovo GmbH 19/02/2014
EU/3/14/1240 Cysteamine Treatment of cystic fibrosis Istituto Europeo per la Ricerca sulla Fibrosi Cistica - ONLUS 19/02/2014
EU/3/14/1241 Asp-Arg-Val-Tyr-Ile-His-Pro Treatment of Duchenne muscular dystrophy Envigo Pharma Consulting Ltd 19/02/2014
EU/3/14/1242 3-Chloro-4-fluorophenyl-[4-fluoro-4-{[(5-methylpyrimidin-2-ylmethyl) amino]methyl}piperidin-1-yl]methanone Treatment of Rett syndrome Neurolixis UK Ltd 19/02/2014
EU/3/14/1243 Recombinant human acid ceramidase Treatment of Farber disease Enzyvant Farber Ireland Limited 21/02/2014
EU/3/14/1245 Pioglitazone Treatment of adrenoleukodystrophy Minoryx Therapeutics S.L. 19/02/2014
EU/3/14/1246 68Ga-2,2'-(7-(4-((S)-1-((4S,7S,10S,13R,16S,19R)-4-((R)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-ylcarbamoyl)-10-(4-aminobutyl)-16-(4-((S)-2,6-dioxohexahydropyrimidine-4-carboxamido)benzyl)-7-((R)-1-hydroxyethyl)-6,9,12,15,18-pentaoxo-13-(4-ureidobenzyl)-1,2-dithia-5,8,11,14,17-pentaazacycloicosan-19-ylamino)-3-(4-chlorophenyl)-1-oxopropan-2-ylamino)-1-carboxy-4-oxobutyl)-1,4,7-triazonane-1,4-diyl)diacetic acid Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Ipsen Pharma 19/02/2014
EU/3/14/1247 Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha) Treatment of glioma Diamond BioPharm Limited 19/02/2014
EU/3/14/1248 N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)-propyl]-carbamoyl}-methyl)-2-[2-(2-fluoro-phenyl)-ethylamino]-N-isobutyl-acetamide Treatment of optic neuritis Bionure Farma SL 19/02/2014
EU/3/14/1249 Phosphorothioate oligonucleotide targeted to apolipoprotein C-III Treatment of familial chylomicronemia syndrome Akcea Therapeutics UK Ltd 19/02/2014
EU/3/14/1250 Phosphorothioate oligonucleotide targeted to transthyretin Treatment of ATTR amyloidosis Ionis USA Limited 26/03/2014
EU/3/14/1251 Recombinant human alpha-glucosidase conjugated with multiple copies of synthetic bismannose-6-phosphate-tetra-mannose glycan Treatment of glycogen storage disease type II (Pompe's disease) Genzyme Europe B.V. 26/03/2014
EU/3/14/1252 Cysteamine bitartrate Treatment of pancreatic cancer Chiesi Farmaceutici S.p.A. 26/03/2014
EU/3/14/1253 Ex-vivo-cultured human mesenchymal stromal cells Prevention of graft rejection following solid organ transplantation iCell Science AB 26/03/2014
EU/3/14/1255 Volasertib Treatment of acute myeloid leukaemia Boehringer Ingelheim International GmbH 26/03/2014
EU/3/14/1256 Adeno-associated viral vector serotype 8 containing the human GUCY2D gene Treatment of Leber's congenital amaurosis Fondazione Telethon 26/03/2014
EU/3/14/1257 Autologous CD34+ cells transduced with a lentiviral vector containing the human RAG1 gene Treatment of recombination-activating gene 1 deficient severe combined immunodeficiency Prof. F.J.T.Staal 26/03/2014
EU/3/14/1258 Doxorubicin(6-maleimidocaproyl)hydrazone Treatment of soft tissue sarcoma Pharma Gateway AB 26/03/2014
EU/3/14/1259 Amikacin sulfate Treatment of nontuberculous mycobacterial lung disease Insmed Limited 08/04/2014
EU/3/14/1260 Fixed-dose combination of (R-S) baclofen, naltrexone hydrochloride and D-sorbitol Treatment of Charcot-Marie-Tooth disease type 1A Pharnext SA 26/03/2014
EU/3/14/1261 Caffeine citrate Prevention of bronchopulmonary dysplasia Viridian Pharma Ltd 11/04/2014
EU/3/14/1262 Recombinant human surfactant protein D Prevention of bronchopulmonary dysplasia Dr Ulrich Granzer 11/04/2014
EU/3/14/1263 Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human beta A-T87Q-globin gene Treatment of sickle cell disease bluebird bio France 29/04/2014
EU/3/14/1264 Ibrutinib Treatment of lymphoplasmacytic lymphoma Janssen-Cilag International NV 29/04/2014 IMBRUVICA
EU/3/14/1265 Genetically modified serotype 5/3 adenovirus coding for granulocyte macrophage colony-stimulating factor Treatment of ovarian cancer Targovax Oy 29/04/2014
EU/3/14/1266 Autologous T cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19 Treatment of B-lymphoblastic leukaemia/lymphoma Novartis Europharm Limited 29/04/2014
EU/3/14/1268 Humanised monoclonal antibody against CD38 Treatment of plasma cell myeloma Sanofi-Aventis groupe 29/04/2014
EU/3/14/1269 Lutetium (177Lu) edotreotide Treatment of gastro-entero-pancreatic neuroendocrine tumours ITM Solucin GmbH 04/06/2014
EU/3/14/1270 (5R,5aR,8aR,9S)-9-[[4,6-O-[(R)-Ethylidene]-beta-D-glucopyranosyl]-oxy]-5-(4-({[(2,2-dimethyl-1,3-dioxolan-4-yl)methoxy]carbonyl}oxy)-3,5-dimethoxyphenyl)-5,8,8a,9-tetrahydroisobenzofuro[5,6-f][1,3]benzodioxol-6(5aH)-one Treatment of biliary tract cancer Mundipharma Corporation Limited 04/06/2014
EU/3/14/1271 177Lu-tetraxetan-tetulomab Treatment of follicular lymphoma Nordic Nanovector AS 04/06/2014
EU/3/14/1272 Recombinant human alpha 1 chain homotrimer of type VII collagen Treatment of epidermolysis bullosa Voisin Consulting S.A.R.L. 04/06/2014
EU/3/14/1273 Autologous dendritic cells pulsed with RNA from glioma stem cells Treatment of glioma Epitarget AS 04/06/2014
EU/3/14/1274 Paclitaxel-succinate-Arg-Arg-Leu-Ser-Tyr-Ser-Arg-Arg-Arg-Phe Treatment of glioma Orphit 04/06/2014
EU/3/14/1275 Aganirsen Treatment of central retinal vein occlusion Gene Signal SAS 10/06/2014
EU/3/14/1276 Isavuconazonium sulfate Treatment of mucormycosis Basilea Medical Ltd 04/06/2014 Cresemba
EU/3/14/1277 Plasmid DNA encoding the human cystic fibrosis transmembrane conductance regulator gene complexed with a non-viral, cationic lipid based gene transfer agent Treatment of cystic fibrosis Imperial Innovations Limited 04/06/2014
EU/3/14/1278 Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1 Treatment of choroideremia Spark Therapeutics Ireland Ltd 04/06/2014
EU/3/14/1279 4-(4-Methoxy-phenylamino)-6-methylcarbamyl-quinoline-3-carboxylic acid Prevention of scarring post glaucoma filtration surgery Clanotech AB 04/06/2014
EU/3/14/1280 Autologous CD34+ cells transduced with a lentiviral vector containing the human SGSH gene Treatment of mucopolysaccharidosis IIIA (Sanfilippo A syndrome) Orchard Therapeutics Ltd 10/06/2014
EU/3/14/1281 1-(2,2-difluoro-1,3-benzodioxol-5-yl)-N-{1-[(2R)-2,3-dihydroxypropyl]-6-fluoro-2-(1-hydroxy-2-methylpropan-2-yl)-1H-indol-5-yl}cyclopropanecarboxamide Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 04/07/2014
EU/3/14/1282 Mixture of two adeno-associated viral vectors of serotype 8 containing the 5'-half sequence of human MYO7A gene and the 3'-half sequence of human MYO7A gene Treatment of Usher syndrome Fondazione Telethon 04/07/2014
EU/3/14/1283 Mixture of two adeno-associated viral vectors of serotype 8 containing the 5'-half sequence of human ABCA4 gene and the 3'-half sequence of human ABCA4 gene Treatment of Stargardt's disease Fondazione Telethon 04/07/2014
EU/3/14/1284 Isavuconazonium sulfate Treatment of invasive aspergillosis Basilea Medical Ltd 04/07/2014 Cresemba
EU/3/14/1285 Afamelanotide Treatment of familial benign chronic pemphigus (Hailey-Hailey disease) Clinuvel UK Limited 04/07/2014
EU/3/14/1286 Humanised Fc engineered monoclonal antibody against CD19 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma MorphoSys AG 04/07/2014
EU/3/14/1288 Norursodeoxycholic acid Treatment of primary sclerosing cholangitis Dr Falk Pharma GmbH 04/07/2014
EU/3/14/1289 Recombinant human alpha-1-microglobulin Treatment of pre-eclampsia A1M Pharma AB 04/07/2014
EU/3/14/1290 Adeno-associated viral vector serotype 2 containing the human REP1 gene Treatment of choroideremia NightstaRx Ltd 04/07/2014
EU/3/14/1291 Rilotumumab Treatment of gastric cancer Amgen Europe B.V. 29/07/2014
EU/3/14/1292 Carboxy pyrrolidine hexanoyl pyrrolidine carboxylate Treatment of AL amyloidosis GlaxoSmithKline Trading Services Limited 30/07/2014
EU/3/14/1293 Recombinant monoclonal antibody to human serum amyloid P component Treatment of AL amyloidosis GlaxoSmithKline Trading Services Limited 30/07/2014
EU/3/14/1294 Sodium acetate salt of the synthetic peptide H-D-Ala-Ser-Pro-Met-Leu-Val-Ala-Tyr-Asp-D-Ala-OH Treatment for necrotising soft tissue infections FGK Representative Service GmbH 29/07/2014
EU/3/14/1295 Marizomib Treatment of plasma cell myeloma Celgene Europe Limited 29/07/2014
EU/3/14/1296 Adeno-associated viral vector serotype 9 containing the human cardiac calsequestrin gene Treatment of catecholaminergic polymorphic ventricular tachycardia Audentes Therapeutics UK Limited 29/07/2014
EU/3/14/1297 Synthetic double-stranded siRNA oligonucleotide directed against antithrombin mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues Treatment of haemophilia A Alnylam UK Limited 29/07/2014
EU/3/14/1298 Synthetic double-stranded siRNA oligonucleotide directed against antithrombin mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues Treatment of haemophilia B Genzyme Europe B.V. 29/07/2014
EU/3/14/1299 Riociguat Treatment of systemic sclerosis Bayer AG 29/07/2014
EU/3/14/1300 Recombinant fusion protein consisting of a modified form of the extracellular domain of human activin receptor IIB linked to the human IgG1 Fc domain Treatment of beta-thalassaemia intermedia and major Celgene Europe Limited 29/07/2014
EU/3/14/1301 Humanised anti-alpha ? beta 6 monoclonal antibody Treatment of idiopathic pulmonary fibrosis Biogen Idec Limited 29/07/2014
EU/3/14/1302 Oxytocin Treatment of Prader-Willi syndrome Maïthé Tauber 29/07/2014
EU/3/14/1303 Cediranib Treatment of ovarian cancer AstraZeneca AB 29/07/2014
EU/3/14/1304 Eculizumab Treatment of myasthenia gravis Alexion Europe SAS 29/07/2014 Soliris
EU/3/14/1305 Humanised recombinant monoclonal antibody against epidermal growth factor receptor conjugated to maleimidocaproyl monomethylauristatin F Treatment of glioma AbbVie Deutschland GmbH & Co. KG 29/07/2014
EU/3/14/1306 Cysteamine bitartrate Treatment of Huntington’s disease Chiesi Farmaceutici S.p.A. 29/07/2014
EU/3/14/1307 Retinol Prevention of bronchopulmonary dysplasia orphanix GmbH 22/08/2014
EU/3/14/1308 Sodium ascorbate and menadione sodium bisulfite Treatment of autosomal dominant polycystic liver disease MCA Regulatory Limited 22/08/2014
EU/3/14/1309 17a,21-dihydroxy-16a-methyl-pregna-1,4,9(11)-triene-3,20-dione Treatment of Duchenne muscular dystrophy ReveraGen BioPharma Limited 22/08/2014
EU/3/14/1310 (3S)-1-azabicyclo[2.2.2]oct-3-yl{2-[2-(4-fluorophenyl)-1,3-thiazol-4-yl]propan-2-yl}carbamate Treatment of Fabry disease Genzyme Europe B.V. 22/08/2014
EU/3/14/1311 Gevokizumab Treatment of Schnitzler syndrome XOMA UK Limited 22/08/2014
EU/3/14/1312 Recombinant factor VIIa modified with three terminal repeats derived from the chain of human chorionic gonadotropin Treatment of congenital factor VII deficiency Richardson Associates Regulatory Affairs Ltd 22/08/2014
EU/3/14/1313 (Z)-3-(3-(3,5-bis(trifluoromethyl)phenyl)-1H-1,2,4-triazol-1-yl)-N'-(pyrazin-2-yl)acrylohydrazide Treatment of acute myeloid leukaemia Karyopharm Europe GmbH 22/08/2014
EU/3/14/1314 Recombinant human apolipoprotein A-I in a complex with phospholipids Treatment of ATP-binding cassette transporter A1 deficiency Cerenis Therapeutics Holding SA 22/08/2014
EU/3/14/1315 Recombinant human apolipoprotein A-I in a complex with phospholipids Treatment of apolipoprotein A-I deficiency Cerenis Therapeutics Holding SA 22/08/2014
EU/3/14/1316 Recombinant factor VIIa modified with three terminal repeats derived from the chain of human chorionic gonadotropin Treatment of haemophilia A Richardson Associates Regulatory Affairs Ltd 22/08/2014
EU/3/14/1317 (Z)-3-(3-(3,5-bis(trifluoromethyl)phenyl)-1H-1,2,4-triazol-1-yl)-N'-(pyrazin-2-yl)acrylohydrazide Treatment of diffuse large B-cell lymphoma Karyopharm Europe GmbH 22/08/2014
EU/3/14/1318 Ulinastatin Treatment of acute pancreatitis BSV BioScience GmbH 22/08/2014
EU/3/14/1319 Recombinant factor VIIa modified with three terminal repeats derived from the chain of human chorionic gonadotropin Treatment of haemophilia B Richardson Associates Regulatory Affairs Ltd 22/08/2014
EU/3/14/1320 Recombinant human diamine oxidase Treatment of mastocytosis Medical University of Vienna 22/08/2014
EU/3/14/1321 Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene Treatment of Crigler-Najjar syndrome Fondazione Telethon 22/08/2014
EU/3/14/1322 Humanised IgG1 monoclonal antibody against human KIR3DL2 Treatment of cutaneous T-cell lymphoma Innate Pharma S.A. 22/08/2014
EU/3/14/1323 [5-amino-1-(4-fluoro-phenyl)-1H-pyrazol-4-yl]-[3-(2,3-dihydroxy-propoxy)-phenyl]-methanone Treatment of pancreatic cancer Synovo GmbH 22/08/2014
EU/3/14/1324 2-(2-methyl-5-nitro-1H-imidazol-1-yl)ethylsulfamide Treatment of small cell lung cancer DualTpharma B.V. 22/08/2014
EU/3/14/1325 Obinutuzumab Treatment of diffuse large B-cell lymphoma Roche Registration GmbH 22/08/2014
EU/3/14/1326 Vector based on an adeno-associated virus serotype 2 backbone, pseudo-serotyped with a type 8 capsid, which carries the coding sequence of the human TYMP gene under the control of the human thyroxine binding globulin promoter Treatment of mitochondrial neurogastrointestinal encephalomyopathy Vall d'Hebron Institute of Research 22/08/2014
EU/3/14/1327 S3,S13-cyclo(D-tyrolsyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-aspartyl-L-tryptophyl-N-methyl-L-glycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-N-methyl-L-isoleucinamide) Treatment of paroxysmal nocturnal haemoglobinuria Amyndas Pharmaceuticals S.A. 22/08/2014
EU/3/14/1328 4-{[(2R,3S,4R,5S)-4-(4-chloro-2-fluoro-phenyl)-3-(3-chloro-2-fluoro-phenyl)-4-cyano-5-(2,2-dimethyl-propyl)-pyrrolidine-2-carbonyl]-amino}-3-methoxy-benzoic acid Treatment of acute myeloid leukaemia Roche Registration Limited 22/08/2014
EU/3/14/1329 Variant of recombinant human fibroblast growth factor 19 Treatment of primary biliary cirrhosis Diamond BioPharm Limited 22/08/2014
EU/3/14/1330 Lentiviral vector containing the human liver and erythroid pyruvate kinase (PKLR) gene Treatment of pyruvate kinase deficiency Consorcio Centro de Investigación Biomédica en Red M.P. 22/08/2014
EU/3/14/1331 Recombinant fusion protein consisting of a modified form of the extracellular domain of human activin receptor IIB linked to the human IgG1 Fc domain Treatment of myelodysplastic syndromes Celgene Europe Limited 22/08/2014
EU/3/14/1332 Macromolecular conjugate of heparin sodium on a polymer backbone Prevention of ischaemia reperfusion injury associated with solid organ transplantation Corline Biomedical AB 22/08/2014
EU/3/14/1334 (3S)-(+)-(5-chloro-2-methoxyphenyl)-1,3-dihydro-3-fluoro-6-(trifluoromethyl)-2H-indol-2-one Treatment of fragile X syndrome Centre National de la Recherche Scientifique (CNRS) 15/10/2014
EU/3/14/1336 (S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride Treatment of Leigh syndrome Khondrion BV 15/10/2014
EU/3/14/1337 Acamprosate calcium Treatment of fragile X syndrome 1st Regulatory Ltd 15/10/2014
EU/3/14/1338 Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene Treatment of Crigler-Najjar syndrome Généthon 15/10/2014
EU/3/14/1339 Cannabidiol Treatment of Dravet syndrome GW Research Ltd 15/10/2014
EU/3/14/1340 Cultured allogeneic corneal limbal stem cells Treatment of limbal stem cell deficiency NHS National Services Scotland Trading as Scottish National Blood Transfusion Service 15/10/2014
EU/3/14/1341 Cysteamine hydrochloride Treatment of cystinosis Lucane Pharma SA 15/10/2014
EU/3/14/1342 Glucagon Treatment of congenital hyperinsulinism S-cubed Ltd 15/10/2014
EU/3/14/1343 Immunoglobulin G1, anti-(human tumour-associated calcium signal transducer 2)(human-Mus musculus monoclonal hRS7 heavy chain), disulfide with human-Mus musculus monoclonal hRS7 k-chain, dimer, hexakis(thioether) with (4S)-4-[[[[4-[[(2S)-2-(4-aminobutyl)-2-[[2-[2-[[26-[4-[[[[4-[(3-mercapto-2,5-dioxo-1-pyrrolidinyl)methyl]cyclohexyl]carbonyl]amino]methyl]-1H-1,2,3-triazol-1-yl]-3,6,9,12,15,18,21,24-octaoxahexacos-1-yl]amino]-2-oxoethoxy]acetyl]amino]-1-oxoethyl]amino]phenyl]methoxy]carbonyl]oxy]-4,11-diethyl-9-hydroxy-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14(4H,12H)-dione Treatment of pancreatic cancer Immunomedics GmbH 15/10/2014
EU/3/14/1344 Nitric oxide Treatment of cystic fibrosis PD Dr med. Joachim Riethmüller 15/10/2014
EU/3/14/1345 Osilodrostat Treatment of Cushing's syndrome Novartis Europharm Limited 15/10/2014
EU/3/14/1346 Oxalobacter formigenes strain HC-1 Treatment of short bowel syndrome OxThera AB 15/10/2014
EU/3/14/1347 Pyridoxal 5'-phosphate Treatment of pyridoxamine 5'-phosphate oxidase deficiency Great Ormond Street Hospital for Children, NHS Foundation Trust 15/10/2014
EU/3/14/1348 Recombinant human bone morphogenetic protein 4 Treatment of glioma STEMGEN S.p.A 15/10/2014
EU/3/14/1349 Recombinant human insulin receptor monoclonal antibody-fused-a-L-iduronidase Treatment of mucopolysaccharidosis type I Voisin Consulting S.A.R.L. 15/10/2014
EU/3/14/1350 Recombinant human monoclonal antibody of the IgG1 kappa class against human macrophage colony-stimulating factor Treatment of tenosynovial giant cell tumour, localised and diffused type Novartis Europharm Limited 15/10/2014
EU/3/14/1351 Recombinant human monoclonal IgG1 antibody for fibroblast growth factor 23 Treatment of X-linked hypophosphataemia Kyowa Kirin Limited 15/10/2014 CRYSVITA
EU/3/14/1352 Raxibacumab Treatment of inhalation anthrax disease Emergent Countermeasures International Ltd 15/10/2014
EU/3/14/1353 Mexiletine hydrochloride Treatment of myotonic disorders Lupin Europe GmbH 19/11/2014
EU/3/14/1354 Selinexor Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Karyopharm Europe GmbH 19/11/2014
EU/3/14/1355 Selinexor Treatment of plasma cell myeloma Karyopharm Europe GmbH 19/11/2014
EU/3/14/1356 Donor T lymphocytes depleted ex vivo of host alloreactive T cells using photodynamic treatment Treatment of acute myeloid leukaemia Kiadis Pharma Netherlands B.V. 19/11/2014
EU/3/14/1357 Imatinib Treatment of acute respiratory distress syndrome Exvastat Limited 19/11/2014
EU/3/14/1358 Recombinant human pentraxin-2 Treatment of post-essential thrombocythaemia myelofibrosis FGK Representative Service GmbH 19/11/2014
EU/3/14/1359 Pentosan polysulfate sodium Treatment of mucopolysaccharidosis type I Plexcera Therapeutics EU Limited 19/11/2014
EU/3/14/1360 A combination of H-Lys-Lys-Gly-Pro-Arg-Cys(SH)-Leu-Thr-Arg-Tyr-Tyr-Ser-Ser-Phe-Val-Asn-Met-Glu-Gly-Lys-Lys-OH and H-Lys-Lys-Gly-Asp-Asn-Ile-Met-Val-Thr-Phe-Arg-Asn-Gln-Ala-Ser-Arg-Pro-Tyr-Gly-Lys-Lys-OH Treatment of haemophilia A Apitope International NV 19/11/2014
EU/3/14/1361 1-(6-benzothiazolylsulfonyl)-5-chloro-1H-indole-2-butanoic acid Treatment of systemic sclerosis Inventiva 19/11/2014
EU/3/14/1362 1-(6-benzothiazolylsulfonyl)-5-chloro-1H-indole-2-butanoic acid Treatment of idiopathic pulmonary fibrosis Inventiva 19/11/2014
EU/3/14/1363 4-[[(1S,4S)-5-[[4-[4-(oxazol-2-yl)phenoxy]phenyl]methyl]-2,5-diazabicyclo[2.2.1]hept-2-yl]methyl]benzoic acid Treatment of cystic fibrosis IQVIA RDS Ireland Limited 19/11/2014
EU/3/14/1364 Olaptesed pegol Treatment of glioma Noxxon Pharma AG 19/11/2014
EU/3/14/1365 Recombinant human pentraxin-2 Treatment of post-polycythaemia vera myelofibrosis FGK Representative Service GmbH 19/11/2014
EU/3/14/1366 Recombinant human pentraxin-2 Treatment of primary myelofibrosis FGK Representative Service GmbH 19/11/2014
EU/3/14/1367 Bazedoxifene acetate Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 19/11/2014
EU/3/14/1368 Palovarotene Treatment of fibrodysplasia ossificans progressiva Medpace Germany GmbH 19/11/2014
EU/3/14/1371 Humanised IgG1 monoclonal antibody against human eotaxin-2 Treatment of systemic sclerosis FGK Representative Service GmbH 19/11/2014
EU/3/14/1372 (2R,3S)-2-(4-cyclopentylaminophenyl)-1-(2-fluoro-6-methylbenzoyl)piperidine-3-carboxylic acid(4-methyl-3-trifluoromethylphenyl)amide Treatment of microscopic polyangiitis ChemoCentryx Limited 19/11/2014
EU/3/14/1373 (2R,3S)-2-(4-cyclopentylaminophenyl)-1-(2-fluoro-6-methylbenzoyl)piperidine-3-carboxylic acid(4-methyl-3-trifluoromethylphenyl)amide Treatment of granulomatosis with polyangiitis ChemoCentryx Limited 19/11/2014
EU/3/14/1374 (3S)-1-azabicyclo[2.2.2]oct-3-yl{2-[2-(4-fluorophenyl)-1,3-thiazol-4-yl]propan-2-yl}carbamate Treatment of Gaucher disease Genzyme Europe B.V. 19/11/2014
EU/3/14/1375 Pro-Pro-Thr-Val-Pro-Thr-Arg Treatment of xeroderma pigmentosum ProGeLife S.A.S. 19/11/2014
EU/3/14/1376 Arimoclomol citrate Treatment of Niemann-Pick disease, type C Orphazyme ApS 19/11/2014
EU/3/14/1377 Chloroquine Treatment of glioma DualTpharma B.V. 19/11/2014
EU/3/14/1378 Diaspirin cross-linked haemoglobin Treatment of hepatocellular carcinoma New B Innovation (UK) Limited 19/11/2014
EU/3/14/1379 Dantrolene sodium Treatment of malignant hyperthermia Eagle Laboratories Limited 19/11/2014
EU/3/14/1381 Adeno-associated viral vector serotype 8 containing the human MD1 gene Treatment of Duchenne muscular dystrophy Généthon 19/11/2014
EU/3/14/1382 Allogeneic CD34+ cells expanded ex vivo with an aryl hydrocarbon receptor antagonist Treatment of acute lymphoblastic leukaemia Novartis Europharm Limited 16/12/2014
EU/3/14/1383 Single-chain urokinase plasminogen activator Treatment of pleural empyema Coté Orphan Consulting UK Limited 16/12/2014
EU/3/14/1384 ((E)-1-(4'-chlorophenyl)-3-(4-hydroxy-3-metoxyphenyl)prop-2-en-1-one) Treatment of WHIM syndrome Centre National de la Recherche Scientifique (CNRS) 16/12/2014
EU/3/14/1385 Heat-killed Mycobacterium obuense (whole cell) Treatment of pancreatic cancer Immodulon Therapeutics Ltd 16/12/2014
EU/3/14/1386 2-hydroxymethyl-2-methoxymethyl-1-azabicyclo[2,2,2]octan-3-one Treatment of ovarian cancer Aprea Therapeutics AB 16/12/2014
EU/3/14/1387 Exisulind Treatment of familial cerebral cavernous malformations Firc Institute of Molecular Oncology (IFOM) 16/12/2014
EU/3/14/1388 Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media Prevention of graft-versus-host disease Cell2B Advanced Therapeutics, SA 16/12/2014
EU/3/14/1389 Adeno-associated viral vector serotype rh.10 carrying the human N-sulfoglucosamine sulfohydrolase cDNA Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) LYSOGENE 16/12/2014
EU/3/14/1390 Bevacizumab Treatment of hereditary haemorrhagic telangiectasia Dr Sophie Dupuis-Girod 16/12/2014
EU/3/14/1392 5-bromo-N-(prop-2-yn-1-yl)-2-(1H-1,2,4-triazol-1-yl)pyrimidine-4,6-diamine Treatment of Huntington’s disease Palobiofarma S.L. 16/12/2014
EU/3/14/1393 Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3 zeta chimeric antigen receptor Treatment of diffuse large B cell lymphoma Kite Pharma EU B.V. 16/12/2014
EU/3/14/1394 Pegylated recombinant human hyaluronidase PH20 Treatment of pancreatic cancer Pharm Research Associates (UK) Limited 16/12/2014
EU/3/14/1395 Allogeneic ex vivo-generated natural killer cells from CD34+ umbilical cord blood progenitor cells Treatment of acute myeloid leukaemia IPD-Therapeutics BV 16/12/2014
EU/3/14/1396 Adenovirus serotype 5 containing partial E1A deletion and an integrin-binding domain Treatment of glioma Alan Boyd Consultants Ltd 16/12/2014
EU/3/14/1397 Amikacin sulfate Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis PlumeStars s.r.l. 16/12/2014
EU/3/14/1398 Genetically modified serotype 5/3 adenovirus coding for granulocyte macrophage colony-stimulating factor Treatment of malignant mesothelioma Targovax Oy 16/12/2014
EU/3/14/1399 Edaravone Treatment of amyotrophic lateral sclerosis Treeway B.V. 16/12/2014
EU/3/14/1400 (1S,4R,5R,7S)-3,4-dibenzyl-2-oxo-6,8-dioxa-3-azabyciclo[3.2.1]octane-7-carboxylic acid-L-lysine Treatment of neurotrophic keratitis MIMETECH S.r.l. 16/12/2014
EU/3/14/1401 Riluzole Treatment of traumatic spinal cord injury Dr Laurent Vinay 16/12/2014
EU/3/14/1402 Benserazide hydrochloride Treatment of beta-thalassaemia intermedia and major Isabelle Ramirez 16/12/2014
EU/3/14/1403 Plerixafor Treatment of WHIM syndrome Groupe d'étude des neutropénies 16/12/2014
EU/3/14/1404 1-(2-isopropoxyethyl)-2-thioxo-1,2,3,5-tetrahydro-pyrrolo[3,2-d]pyrimidin-4-one Treatment of multiple system atrophy AstraZeneca AB 16/12/2014
EU/3/14/1405 Autologous collagen type II-specific regulatory T cells Treatment of non-infectious uveitis TxCell 16/12/2014
EU/3/14/1406 Chenodeoxycholic acid Treatment of inborn errors of primary bile acid synthesis sigma-tau Arzeimittel GmbH 16/12/2014 Chenodeoxycholic acid Leadiant
EU/3/14/1407 Allogeneic adipose-derived adult mesenchymal stem cells contained in a fibrin-based bioengineered dermis Treatment of epidermolysis bullosa Biodan Yelah S.L. 16/12/2014
EU/3/14/1408 5,5'-(4-(trifluromethyl)benzylazanediyl)bis(methylene)diquinolin-8-ol Treatment of glioma Prof. Olivier Blin 16/12/2014
EU/3/14/1409 Pegylated recombinant arginine deiminase Treatment of malignant mesothelioma Designerx Europe Limited c/o Olswang LLP 15/01/2015
EU/3/14/1410 Recombinant human aspartylglucosaminidase Treatment of aspartylglucosaminuria ACE BioSciences A/S 15/01/2015
EU/3/14/1412 Herpes simplex type 1 virus containing cellular B-myb gene as tumour-specific promoter Treatment of pancreatic cancer Karcinolys S.A.S 15/01/2015
EU/3/14/1414 Sodium thiosulfate Treatment for calciphylaxis Hope Pharmaceuticals, Ltd 15/01/2015
EU/3/14/1415 Adenoviral vector serotype 5 containing the vascular endothelial growth factor D isoform (preprocessed short form) from a CMV promoter Treatment of placental insufficiency Magnus Invention Management Ltd 15/01/2015
EU/3/14/1416 Chimeric monoclonal antibody to O-acetyl-GD2 antigen Treatment of neuroblastoma OGD2 Pharma 15/01/2015
EU/3/14/1417 A lentiviral vector pseudotyped by the Indiana serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins Treatment of adult T-cell leukaemia/lymphoma THERAVECTYS 15/01/2015
EU/3/14/1418 A lentiviral vector pseudotyped by the New-Jersey serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins Treatment of adult T-cell leukaemia/lymphoma THERAVECTYS 15/01/2015
EU/3/14/1419 Tenofovir disoproxil fumarate Treatment of Aicardi-Goutières syndrome Dr Yanick Crow 15/01/2015
EU/3/14/1420 Emtricitabine Treatment of Aicardi-Goutières syndrome Dr Yanick Crow 15/01/2015
EU/3/14/1421 Ponatinib hydrochloride Treatment of gastrointestinal stromal tumours Incyte Biosciences UK Ltd 15/01/2015
EU/3/14/1422 Chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) BioMarin Europe Ltd 15/01/2015
EU/3/14/1423 Synthetic signal peptide of human mucin-1 (amino acids 1-21) Treatment of plasma cell myeloma Richardson Associates Regulatory Affairs Ltd 15/01/2015
EU/3/14/1424 Humanised Fc engineered monoclonal antibody against CD19 Treatment of diffuse large B-cell lymphoma MorphoSys AG 15/01/2015
EU/3/14/1425 Ceftriaxone Treatment of spinocerebellar ataxia Ospedale San Raffaele s.r.l. 15/01/2015
EU/3/14/1426 Allogeneic peripheral blood mononuclear cells induced to an early apoptotic state Prevention of graft-versus-host disease Richardson Associates Regulatory Affairs Ltd 15/01/2015
EU/3/14/1427 Recombinant human alkaline phosphatase Treatment of hypophosphatasia AM-Pharma BV 15/01/2015
EU/3/14/1428 Sodium valproate Treatment of Wolfram syndrome Alan Boyd Consultants Ltd 15/01/2015
EU/3/14/1429 N-methyl-4-({4-[({3-methyl(methylsulfonyl)aminopyrazin-2-yl}methyl)amino]-5-(trifluoromethyl)pyrimidin-2-yl}amino)benzamide hydrochloride Treatment of ovarian cancer TMC Pharma Services Ltd 15/01/2015
EU/3/14/1430 Adeno-associated viral vector serotype 8 containing the human factor VII gene Treatment of congenital factor VII deficiency Professor Edward G. Tuddenham 15/01/2015
EU/3/15/1432 2'-O-methyl phosphorothioate RNA oligonucleotide, 5'-m5CUGm5CUGm5CUGm5CUGm5CUGm5CUGm5CUG-3' Treatment of Huntington's disease BioMarin International Limited 18/02/2015
EU/3/15/1433 Sevuparin sodium Treatment of sickle cell disease Modus Therapeutics AB 12/02/2015
EU/3/15/1434 Chimeric group B adenovirus (11p/3) with deletions in the E3 and E4 regions Treatment of ovarian cancer PsiOxus Therapeutics Ltd 12/02/2015
EU/3/15/1435 Nitroglycerin Treatment of systemic sclerosis Covis Pharma S.à.r.l. 12/02/2015
EU/3/15/1436 Lactobacillus reuteri Prevention of necrotising enterocolitis Infant Bacterial Therapeutics AB 12/02/2015
EU/3/15/1437 Alvocidib Treatment of acute myeloid leukaemia Chiltern Clinical Research International GmbH 12/02/2015
EU/3/15/1438 Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus Treatment of adenovirus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 19/03/2015
EU/3/15/1439 Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus Treatment of cytomegalovirus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 12/02/2015
EU/3/15/1440 Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus Treatment of Epstein-Barr virus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 19/03/2015
EU/3/15/1442 Fibrinogen-coated albumin spheres Treatment of Ebola virus disease Fibreu Limited 12/02/2015
EU/3/15/1443 Recombinant human glutamate oxaloacetate transaminase 1 Treatment of glioma Dr Regenold GmbH 12/02/2015
EU/3/15/1445 Ulocuplumab Treatment of acute myeloid leukaemia Bristol-Myers Squibb Pharma EEIG 12/02/2015
EU/3/15/1446 N-(3-(4-(3-(diisobutylamino)propyl)piperazin-1-yl)propyl)-1H-benzo[d]imidazol-2-amine disulphate salt Treatment of progressive supranuclear palsy AlzProtect sas 12/02/2015
EU/3/15/1447 Olaratumab Treatment of soft tissue sarcoma Eli Lilly Nederland B.V. 12/02/2015 Lartruvo
EU/3/15/1448 505 amino acid protein, corresponding to amino acids 2-506 of the wild type human histidyl-tRNA synthetase Treatment of facioscapulohumeral muscular dystrophy Voisin Consulting S.A.R.L. 12/02/2015
EU/3/15/1449 Myriocin Treatment of retinitis pigmentosa Nanovector s.r.l. 12/02/2015
EU/3/15/1450 Gallium (68Ga)-edotreotide Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 19/03/2015 SomaKit TOC
EU/3/15/1451 5'-ASCSASTSCSASGSTSCSTSGSASUSASASGSCSTSA-3' Treatment of Alport syndrome CTI Clinical Trial and Consulting Services Europe GmbH 19/03/2015
EU/3/15/1452 Tideglusib Treatment of fragile X syndrome AMO Pharma Ltd 19/03/2015
EU/3/15/1453 Chimeric 2'-O-(2-methoxyethyl) modified oligonucleotide targeted to huntingtin RNA Treatment of Huntington’s disease Ionis USA Limited 19/03/2015
EU/3/15/1454 6-ethoxy-7-methoxy-2-(2-methylsulfanylphenyl)-3,1-benzoxazin-4-one Treatment of Netherton syndrome Sixera Pharma AB 19/03/2015
EU/3/15/1455 Human plasma-derived alpha-1 proteinase inhibitor Treatment of graft-versus-host disease Kamada BioPharma Limited 19/03/2015
EU/3/15/1456 Recombinant human club cell 10 KDa protein Prevention of bronchopulmonary dysplasia RLM Consulting 19/03/2015
EU/3/15/1457 [5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine hydrochloride Treatment of tenosynovial giant cell tumour, localised and diffuse type Daiichi Sankyo Europe GmbH 19/03/2015
EU/3/15/1458 Humanised anti-folate receptor 1 monoclonal antibody conjugated to maytansinoid DM4 Treatment of ovarian cancer ImmunoGen Europe Limited 19/03/2015
EU/3/15/1459 Enoxacin Treatment of amyotrophic lateral sclerosis Dr Regenold GmbH 19/03/2015
EU/3/15/1460 Lenvatinib Treatment of hepatocellular carcinoma Eisai Europe Limited 19/03/2015
EU/3/15/1461 Recombinant human monoclonal antibody binding to vascular adhesion protein-1 Treatment of primary sclerosing cholangitis Biotie Therapies Corp 19/03/2015
EU/3/15/1462 Sodium 3-[(4aR,6R,7R,7aS)-7-hydroxy-2-oxido-2-sulfanylidene-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxaphosphinin-6-yl]-2-bromo-6-phenyl-5H-imidazo[1,2-a]purin-9-one Treatment of retinitis pigmentosa Universitätsklinikum Tübingen (UKT) 19/03/2015
EU/3/15/1463 Melphalan flufenamide Treatment of plasma cell myeloma Oncopeptides AB 19/03/2015
EU/3/15/1464 Autologous adipose tissue-derived stromal vascular fraction cells Treatment of systemic sclerosis Assistance Publique Hôpitaux de Marseille 19/03/2015
EU/3/15/1465 Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a LAMB3-encoding retroviral vector Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
EU/3/15/1466 Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a COL7A1-encoding retroviral vector Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
EU/3/15/1467 Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a COL17A1-encoding retroviral vector Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
EU/3/15/1469 Human reovirus type 3 Dearing strain Treatment of ovarian cancer Oncolytics Biotech (UK) Limited 19/03/2015
EU/3/15/1470 5,10,15,20-tetrakis(2,6-difluoro-3-N-methylsulfamoylphenyl)bacteriochlorin Treatment of biliary tract cancer Luzitin S.A 19/03/2015
EU/3/15/1472 Fluciclovine (18F) Diagnosis of glioma Blue Earth Diagnostics Ltd 24/04/2015
EU/3/15/1473 Lenalidomide Treatment of marginal zone lymphoma Celgene Europe Limited 24/04/2015
EU/3/15/1474 Ecothiopate iodide Treatment of Stargardt's disease Dorian Regulatory Affairs BV 24/04/2015
EU/3/15/1475 1-(4-(N-glycylamido)phenyl)-3-trifluoromethyl-5-(phenanthren-2-yl)-pyrazole-hydrochloride Treatment of cryptococcosis Arno Therapeutics UK, Limited 24/04/2015
EU/3/15/1476 1-(4-(N-glycylamido)phenyl)-3-trifluoromethyl-5-(phenanthren-2-yl)-pyrazole-hydrochloride Treatment of tularaemia Arno Therapeutics UK, Limited 24/04/2015
EU/3/15/1477 Human reovirus type 3 Dearing strain Treatment of pancreatic cancer Oncolytics Biotech (UK) Limited 24/04/2015
EU/3/15/1478 Rimeporide Treatment of Duchenne muscular dystrophy EUDRAC Limited 24/04/2015
EU/3/15/1479 Recombinant monoclonal IgG1 antibody against T-cell immune response cDNA 7 Prevention of graft rejection following solid organ transplantation Nekonal S.a.r.l. 24/04/2015
EU/3/15/1480 Rintatolimod Treatment of Ebola virus disease NV Hemispherx BioPharma Europe 24/04/2015
EU/3/15/1482 Adeno-associated viral vector serotype 5 containing the human CHM gene Treatment of choroideremia Inserm-Transfert SA 24/04/2015
EU/3/15/1483 Xenon Treatment of perinatal asphyxia Neuroprotexeon Ltd 24/04/2015
EU/3/15/1484 Nitric oxide Treatment of cystic fibrosis Biological Consulting Europe Ltd 24/04/2015
EU/3/15/1485 Sodium 2-hydroxylinoleate Treatment of neuroblastoma Ability Pharmaceuticals SL 24/04/2015
EU/3/15/1486 Recombinant human mesencephalic astrocyte-derived neurotrophic factor Treatment of retinitis pigmentosa Regintel Limited 24/04/2015
EU/3/15/1487 Reduced oxydised N-acetyl heparin Treatment of plasma cell myeloma Leadiant Biosciences Ltd 21/05/2015
EU/3/15/1489 Fusion proteins composed by a genetically modified cholera toxin subunit A1, peptides from the acetylcholine receptor alpha chain and a dimer of the D fragment from Staphylococcus aureus protein A Treatment of myasthenia gravis Toleranzia AB 21/05/2015
EU/3/15/1490 Triamcinolone acetonide Treatment of non-infectious uveitis S-cubed Ltd 21/05/2015
EU/3/15/1491 Adeno-associated viral vector serotype 9 containing the human HGSNAT gene Treatment of mucopolysaccharidosis IIIC (Sanfilippo C syndrome) Cochamo Systems Ltd 21/05/2015
EU/3/15/1492 AASSGVSTPGSAGHDIITEQPRS Treatment of Huntington’s disease Centre National de la Recherche Scientifique (CNRS) 21/05/2015
EU/3/15/1493 Allopurinol sodium Treatment of perinatal asphyxia ACE Pharmaceuticals BV 21/05/2015
EU/3/15/1494 Humanised anti-CD37 monoclonal antibody conjugated to maytansinoid DM1 Treatment of diffuse large B-cell lymphoma Voisin Consulting S.A.R.L. 21/05/2015
EU/3/15/1495 Triheptanoin Treatment of glucose transporter type-1 deficiency syndrome Ultragenyx UK Limited 21/05/2015
EU/3/15/1496 Trehalose Treatment of oculopharyngeal muscular dystrophy Dr Ulrich Granzer 21/05/2015
EU/3/15/1497 5,7-dichloro-2-dimethylaminomethyl-8-hydroxyquinoline hydrochloride Treatment of Huntington’s disease Prana Biotechnology UK Limited 21/05/2015
EU/3/15/1498 2-(7-ethoxy-4-(3-fluorophenyl)-1-oxophthalazin-2(1H)-yl)-N-methyl-N-(2-methylbenzo[d]oxazol-6-yl)acetamide Treatment of cystic fibrosis Clinical Network Services (UK) Ltd 21/05/2015
EU/3/15/1499 Adult human bone-marrow-derived, ex-vivo-expanded, pooled allogeneic mesenchymal stromal cells Treatment of thromboangiitis obliterans (Buerger's disease) Regulatory Resources Group Ltd 21/05/2015
EU/3/15/1500 Synthetic 47-amino-acid N-myristoylated lipopeptide, derived from the preS region of hepatitis B virus Treatment of hepatitis delta virus infection MYR GmbH 19/06/2015
EU/3/15/1502 Trehalose Treatment of spinocerebellar ataxia Dr Ulrich Granzer 19/06/2015
EU/3/15/1503 Allogeneic ex-vivo-expanded human umbilical cord blood-derived mesenchymal stem cells Prevention of bronchopulmonary dysplasia PSR Group B.V. 19/06/2015
EU/3/15/1504 Obinutuzumab Treatment of follicular lymphoma Roche Registration GmbH 19/06/2015 Gazyvaro
EU/3/15/1506 Antisense oligonucleotide directed against TGF-beta2 mRNA Prevention of scarring post glaucoma filtration surgery Isarna Therapeutics GmbH 19/06/2015
EU/3/15/1507 3-{[2,3,5,6-tetrafluoro-3'-(trifluoromethoxy)biphenyl-4-yl]carbamoyl}thiophene-2-carboxylic acid Treatment of non-infectious uveitis Panoptes Pharma Ges.m.b.H 19/06/2015
EU/3/15/1508 Triheptanoin Treatment of very long-chain acyl-CoA dehydrogenase deficiency Ultragenyx UK Limited 19/06/2015
EU/3/15/1509 Adeno-associated viral vector serotype 9 containing the human SMN gene Treatment of spinal muscular atrophy AveXis EU, Ltd 19/06/2015
EU/3/15/1510 Edaravone Treatment of amyotrophic lateral sclerosis Mitsubishi Tanabe Pharma Europe Ltd 19/06/2015
EU/3/15/1511 Human plasminogen Treatment of plasminogen deficiency ProMetic BioTherapeutics Ltd 28/07/2015
EU/3/15/1512 Anti-H5N1 equine immunoglobulin F(ab')2 fragments Treatment of avian influenza Fab'entech 28/07/2015
EU/3/15/1513 Doxorubicin Treatment of hepatoblastoma Double Bond Pharmaceutical AB 28/07/2015
EU/3/15/1514 Lanreotide acetate Treatment of autosomal dominant polycystic kidney disease Prof. Dr R.T.Gansevoort 10/08/2015
EU/3/15/1515 Synthetic hypericin Treatment of cutaneous T-cell lymphoma Kinesys Consulting Ltd 28/07/2015
EU/3/15/1516 Modified adenovirus serotype 5/35 containing a CMV promoter-driven transgene cassette with the human transgenes for a membrane-bound CD40 ligand and full length 4-1BBL Treatment of pancreatic cancer Lokon Pharma AB 28/07/2015
EU/3/15/1517 2-((3-((4-((3-aminopropyl)amino)butyl)amino)propyl)amino)-N-((5S,5aS,8aR,9R)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5,5a,6,8,8a,9-hexahydrofuro[3',4':6,7]naphtho[2,3-d][1,3]dioxol-5-yl)acetamide, tetrahydrochloride Treatment of acute myeloid leukaemia Pierre Fabre Médicament 28/07/2015
EU/3/15/1518 Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene Treatment of retinitis pigmentosa Spark Therapeutics Ireland Ltd 28/07/2015
EU/3/15/1519 Allogeneic human adult stem cells, isolated from skeletal muscle and expanded ex vivo Treatment of Duchenne muscular dystrophy Karl Rouger 28/07/2015
EU/3/15/1520 Cannabidiol Treatment of perinatal asphyxia GW Pharma Ltd 28/07/2015
EU/3/15/1521 Artesunate Treatment of malaria Dr Ulrich Granzer 28/07/2015
EU/3/15/1522 Humanised IgG4 monoclonal antibody against extracellular tau Treatment of progressive supranuclear palsy Biogen Idec Limited 28/07/2015
EU/3/15/1523 Inecalcitol Treatment of acute myeloid leukaemia Hybrigenics SA 28/07/2015
EU/3/15/1524 Triheptanoin Treatment of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency Ultragenyx UK Limited 28/07/2015
EU/3/15/1525 Triheptanoin Treatment of mitochondrial trifunctional protein deficiency Ultragenyx UK Limited 28/07/2015
EU/3/15/1526 Triheptanoin Treatment of carnitine palmitoyltransferase II deficiency Ultragenyx UK Limited 28/07/2015
EU/3/15/1527 Hydrocinnamate-[Orn-Pro-dCha-Trp-Arg]acetate Treatment of amyotrophic lateral sclerosis PBS Regulatory Consulting Group Limited 28/07/2015
EU/3/15/1528 Synthetic double-stranded RNA oligonucleotide specific to hydroxyacid oxidase 1 gene Treatment of primary hyperoxaluria type 1 Dicerna EU Limited 28/07/2015
EU/3/15/1529 Glycyl-L-2-methylprolyl-L-glutamic acid Treatment of fragile X syndrome QRC Consultants Ltd 28/07/2015
EU/3/15/1531 Sarizotan hydrochloride Treatment of Rett syndrome Newron Pharmaceuticals SpA 28/07/2015
EU/3/15/1532 Insulin human Treatment of short bowel syndrome Sirius Regulatory Consulting Limited 10/08/2015
EU/3/15/1533 Human allogeneic bone-marrow-derived osteoblastic cells Treatment of osteogenesis imperfecta Bone Therapeutics SA 10/08/2015
EU/3/15/1534 Glycyl-L-2-methylprolyl-L-glutamic acid Treatment of Rett syndrome QRC Consultants Ltd 10/08/2015
EU/3/15/1535 Fibrinogen-coated albumin spheres Treatment of acute radiation syndrome Fibreu Limited 10/08/2015
EU/3/15/1536 Recombinant human acid ceramidase Treatment of cystic fibrosis Enzyvant Farber Ireland Limited 10/08/2015
EU/3/15/1538 Fixed-dose combination of fosfomycin disodium and tobramycin Treatment of cystic fibrosis CURx Pharma (UK) Limited 10/08/2015
EU/3/15/1539 Adeno-associated viral vector serotype 8 containing the human MTM1 gene Treatment of X-linked myotubular myopathy Audentes Therapeutics UK Limited 10/08/2015
EU/3/15/1540 Adeno-associated viral vector serotype 9 containing the human iduronate-2-sulfatase gene Treatment of mucopolysaccharidosis type II (Hunter's syndrome) Laboratorios del Dr Esteve, S.A. 10/08/2015
EU/3/15/1541 Ibrutinib Treatment of marginal zone lymphoma Janssen-Cilag International NV 10/08/2015
EU/3/15/1543 (S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride Treatment of mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes Khondrion BV 10/08/2015
EU/3/15/1544 2-(2-phenylvinyl)-4-[4-methylpiperazin-1-yl)]-6-(5-methyl-2H-pyrazol-3-yl-amino)-pyrimidine L(+) tartrate salt Treatment of hepatocellular carcinoma Dr Ulrich Granzer 10/08/2015
EU/3/15/1545 CD33-directed antibody-drug conjugate consisting of an antibody conjugated to a DNA cross-linking pyrrolobenzodiazepine dimer drug Treatment of acute myeloid leukaemia Seattle Genetics UK, Limited 10/08/2015
EU/3/15/1547 Mazindol Treatment of narcolepsy NeuroLifeSciences 09/10/2015
EU/3/15/1548 Ovine-specific immunoglobulin (Fab) fragments raised against Vipera berus venom Treatment of snakebite envenomation MicroPharm Limited 09/10/2015
EU/3/15/1549 Synthetic peptide L-cysteine, L-cysteinylglycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-, cyclic (1.fwdarw.17)-disulfide Treatment of primary graft dysfunction following lung transplantation Apeptico Forschung und Entwicklung GmbH 09/10/2015
EU/3/15/1550 3-pentylbenzeneacetic acid sodium salt Treatment of idiopathic pulmonary fibrosis ProMetic Pharma SMT Limited 09/10/2015
EU/3/15/1551 Recombinant human IgG1 kappa light chain monoclonal antibody targeting plasma kallikrein Treatment of hereditary angioedema Shire Pharmaceuticals Ireland Limited 09/10/2015
EU/3/15/1552 Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor Treatment of mantle cell lymphoma Kite Pharma EU B.V. 09/10/2015
EU/3/15/1553 Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor Treatment of primary mediastinal large B-cell lymphoma Kite Pharma EU B.V. 09/10/2015
EU/3/15/1554 Nimodipine Treatment of aneurysmal subarachnoid haemorrhage Dr Stefan Blesse 09/10/2015
EU/3/15/1555 Synthetic hepcidin Treatment of beta thalassaemia intermedia and major La Jolla Pharmaceutical II BV 09/10/2015
EU/3/15/1556 Recombinant adeno-associated viral vector containing human CNGA3 gene Treatment of achromatopsia caused by mutations in the CNGA3 gene TMC Pharma Services Ltd 09/10/2015
EU/3/15/1557 Sirolimus Treatment of tuberous sclerosis Desitin Arzneimittel GmbH 09/10/2015
EU/3/15/1558 Three chimeric human/murine monoclonal antibodies against the Ebola (Zaire) surface glycoprotein Treatment for Ebola virus disease Dr Stefan Blesse 09/10/2015
EU/3/15/1559 2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione Treatment of systemic sclerosis Genkyotex S.A. 09/10/2015
EU/3/15/1560 N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide Treatment of Duchenne muscular dystrophy FGK Representative Service GmbH 09/10/2015
EU/3/15/1561 Ataluren Treatment of aniridia PTC Therapeutics International Limited 09/10/2015
EU/3/15/1562 A highly purified formulation of Staphylococcus aureus protein A Treatment of immune thrombocytopenia Coté Orphan Consulting UK Limited 09/10/2015
EU/3/15/1563 Recombinant human interleukin-3 truncated diphtheria toxin fusion protein Treatment of acute myeloid leukaemia TMC Pharma Services Ltd 09/10/2015
EU/3/15/1565 2-chloro-N6-(3-iodobenzyl)adenosine-5'-N-methyluronamide Treatment of hepatocellular carcinoma PBS Regulatory Consulting Group Limited 09/10/2015
EU/3/15/1566 Autologous human peripheral blood Vdelta1+ T lymphocytes activated in vitro by cytokine and monoclonal antibody treatment Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Lymphact - Lymphocyte Activation Technologies S.A. 09/10/2015
EU/3/15/1567 Recombinant human interleukin-3 truncated diphtheria toxin fusion protein Treatment of blastic plasmacytoid dendritic cell neoplasm TMC Pharma Services Ltd 11/11/2015
EU/3/15/1568 Interferon alfa-n3 Treatment of Middle East respiratory syndrome NV Hemispherx BioPharma Europe 11/11/2015
EU/3/15/1569 Pentetrazol Treatment of idiopathic hypersomnia Balance Therapeutics, Limited 11/11/2015
EU/3/15/1571 Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor Treatment of acute lymphoblastic leukaemia Kite Pharma EU B.V. 11/11/2015
EU/3/15/1572 Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor Treatment of chronic lymphocytic leukaemia/small lymphocytic lymphoma Kite Pharma EU B.V. 11/11/2015
EU/3/15/1573 Adeno-associated viral vector serotype 8 encoding the human ATP7B gene under the control of the human alpha-1 antitrypsin promoter Treatment of Wilson's disease Aligen Therapeutics S.L. 11/11/2015
EU/3/15/1574 4-[(2-butyl-4-oxo-1,3-diazaspiro[4.4]non-1-en-3-yl)methyl]-N-(4,5-dimethyl-3-isoxazolyl)-2-(ethoxymethyl)-[1,1-biphenyl]-2-sulfonamide Treatment of focal segmental glomerulosclerosis Retrophin Europe Limited 11/11/2015
EU/3/15/1575 Humanised fusion protein consisting of extracellular domain of CD24 linked to IgG1 Fc domain Prevention of graft-versus-host disease Enpharma Ltd 11/11/2015
EU/3/15/1576 (5S,8S,10aR)-N-benzhydryl-5-((S)-2-(methylamino)propanamido)-3-(3-methylbutanoyl)-6-oxodecahydropyrrolo[1,2-a][1,5]diazocine-8-carboxamide Treatment of ovarian cancer ASPHALION, SL 11/11/2015
EU/3/15/1577 Adenovirus associated viral vector serotype 5 containing the human RPE65 gene Treatment of Leber’s congenital amaurosis MeiraGTx UK II Limited 11/11/2015
EU/3/15/1578 Adenovirus associated viral vector serotype 8 containing the human CNGB3 gene Treatment of achromatopsia caused by mutations in the CNGB3 MeiraGTx UK II Limited 11/11/2015
EU/3/15/1579 Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor Treatment of follicular lymphoma Kite Pharma EU B.V. 11/11/2015
EU/3/15/1580 N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4 methylpiperazin-1-yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide Treatment of neuroblastoma Pharma Gateway AB 11/11/2015
EU/3/15/1581 Sodium phenylbutyrate Treatment of pyruvate dehydrogenase complex deficiency Fondazione Telethon 11/11/2015
EU/3/15/1582 Humanised monoclonal antibody of the IgG4 kappa isotype targeting CD47 Treatment of acute myeloid leukaemia ICON Clinical Research Limited 11/11/2015
EU/3/15/1584 Variant of recombinant human fibroblast growth factor 19 Treatment of primary sclerosing cholangitis Diamond BioPharm Limited 14/12/2015
EU/3/15/1585 Sirolimus Treatment of beta thalassaemia intermedia and major Rare Partners srl Impresa Sociale 14/12/2015
EU/3/15/1586 Recombinant human nerve growth factor Treatment of neurotrophic keratitis Dompé farmaceutici S.p.A. 14/12/2015 OXERVATE
EU/3/15/1587 Combretastatin A1 diphosphate Treatment of acute myeloid leukaemia Diamond BioPharm Limited 14/12/2015
EU/3/15/1588 (R)-1-[1-(4-acetoxy-3,3-dimethyl-2-oxo-butyl)-2-oxo-5-(pyridin-2-yl)-2,3-dihydro-1H-benzo[e][1,4]diazepin-3-yl]-3-(3-methylamino-phenyl)-urea Treatment of gastro-entero-pancreatic neuroendocrine tumours Trio Medicines Ltd 14/12/2015
EU/3/15/1589 Glibenclamide Treatment of neonatal diabetes AMMTeK 15/01/2016
EU/3/15/1590 Recombinant human monoclonal IgG1 antibody against programmed death ligand-1 Treatment of Merkel cell carcinoma Merck Serono Europe Limited 14/12/2015 Bavencio
EU/3/15/1591 Synthetic peptide L-cysteine, L-cysteinylglycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-, cyclic (1.fwdarw.17)-disulfide Treatment of pseudohypoaldosteronism type 1B Apeptico Forschung und Entwicklung GmbH 14/12/2015
EU/3/15/1592 [4-aminobutanoic acid-glycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-L-aspartyl](cyclo 1-Dgamma17) Treatment of pseudohypoaldosteronism type 1B Apeptico Forschung und Entwicklung GmbH 14/12/2015
EU/3/15/1593 Imetelstat sodium Treatment of myelofibrosis Janssen-Cilag International NV 14/12/2015
EU/3/15/1594 Live attenuated Listeria monocytogenes delta actA/delta inlB strain expressing human mesothelin Treatment of malignant mesothelioma Aduro Biotech Holdings, Europe B.V. 14/12/2015
EU/3/15/1595 Live attenuated Listeria monocytogenes bioengineered with a chimeric human epidermal growth factor receptor 2 fused to a truncated form of the Lm protein listeriolysin O Treatment of osteosarcoma IQVIA RDS Ireland Limited 14/12/2015
EU/3/15/1596 Bilayer engineered collagen hydrogel-based skin graft composed of autologous keratinocytes and fibroblasts Treatment of partial deep dermal and full thickness burns Voisin Consulting S.A.R.L. 14/12/2015
EU/3/15/1597 Sodium (2R,3S,5R)-5-(4-amino-2-oxo-1,3,5-triazin-1(2H)-yl)-2-(hydroxymethyl)tetrahydrofuran-3-yl ((2R,3S,5R)-5-(2-amino-6-oxo-1H-purin-9(6H)-yl)-3-hydroxytetrahydrofuran-2-yl)methyl phosphate Treatment of acute myeloid leukaemia Otsuka Pharmaceutical Europe Ltd 14/12/2015
EU/3/15/1598 2-(2-chlorobenzylidene)hydrazinecarboximidamide acetate Treatment of Charcot-Marie-Tooth disease Inflectis Bioscience 14/12/2015
EU/3/15/1599 Adeno-associated viral vector serotype rh10 containing the human factor IX gene Treatment of haemophilia B Pharma Gateway AB 14/12/2015
EU/3/15/1600 Sodium benzoate Treatment of hyperargininaemia Syri Limited 11/01/2016
EU/3/15/1601 Sodium benzoate Treatment of argininosuccinic aciduria Syri Limited 11/01/2016
EU/3/15/1602 Live attenuated Listeria monocytogenes transfected with plasmids encoding the HPV-16E7 protein fused to a truncated fragment of the Lm protein listeriolysin O Treatment of anal cancer Dr Ulrich Granzer 11/01/2016
EU/3/15/1603 Live attenuated Listeria monocytogenes delta actA/delta inlB strain expressing human mesothelin Treatment of pancreatic cancer Aduro Biotech Holdings, Europe B.V. 11/01/2016
EU/3/15/1604 Two allogenic irradiated pancreatic tumour cell lines Treatment of pancreatic cancer Aduro Biotech Holdings, Europe B.V. 11/01/2016
EU/3/15/1606 (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate Treatment of soft tissue sarcoma Loxo Oncology Limited 11/01/2016
EU/3/15/1607 Entolimod Treatment of acute radiation syndrome TMC Pharma Services Ltd 11/01/2016
EU/3/16/1608 S3,S13-cyclo(D-tyrolsyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-aspartyl-L-tryptophyl-N-methyl-L-glycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-N-methyl-L-isoleucinamide) Treatment of C3 glomerulopathy Amyndas Pharmaceuticals S.A. 17/02/2016
EU/3/16/1609 Humanised IgG4 monoclonal antibody against total complement component 1, subcomponent s Treatment of autoimmune haemolytic anaemia Assign Group Development UK Ltd 17/02/2016
EU/3/16/1610 Arsenic trioxide Treatment of acute myeloid leukaemia Orsenix Holdings BV 17/02/2016
EU/3/16/1611 Ex-vivo-expanded autologous fibroblasts transduced with lentiviral vector containing the COL7A1 gene Treatment of epidermolysis bullosa Dr Waseem Qasim 17/02/2016
EU/3/16/1612 Methyl 3-((2R)-2-hydroxy-4-(((((S)-1-methoxy-1-oxopropan-2-yl) amino)(phenoxy)phosphoryl)oxy)-3,3-dimethylbutanamido)propanoate Treatment of pantothenate-kinase-associated neurodegeneration Retrophin Europe Limited 17/02/2016
EU/3/16/1613 Tolfenamic acid Treatment of progressive supranuclear palsy RV Developpement 17/02/2016
EU/3/16/1614 Tolfenamic acid Treatment of behavioural variant frontotemporal dementia RV Developpement 17/02/2016
EU/3/16/1615 2-ethylbutyl (2S)-2-{[(S)-{[(2R,3S,4R,5R)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-5-cyano-3,4-dihydroxytetrahydrofuran-2-yl]methoxy}(phenoxy)phosphoryl]amino}propanoate Treatment of Ebola virus disease Gilead Sciences International Limited 17/02/2016
EU/3/16/1616 Diclofenamide Treatment of periodic paralysis Prof. Michael Hanna 17/02/2016
EU/3/16/1617 Venetoclax Treatment of acute myeloid leukaemia AbbVie Deutschland GmbH & Co. KG 17/02/2016
EU/3/16/1618 N-(4-methoxyphenyl)-N,2,6-trimethylfuro[2,3-d]pyrimidin-4-amine Treatment of glioma FLAG Therapeutics Ltd 17/02/2016
EU/3/16/1619 DNA plasmid encoding a recombinant fusion protein consisting of the extracellular domain of human TNFa p55 receptor linked to the human IgG1 Fc domain Treatment of non-infectious uveitis Eyevensys SAS 17/02/2016
EU/3/16/1620 Allogeneic fetal human retinal progenitor cells expanded ex vivo Treatment of retinitis pigmentosa Voisin Consulting S.A.R.L. 17/02/2016
EU/3/16/1621 Delta-9-tetrahydrocannabinol and cannabidiol from extracts of the Cannabis sativa L. plant Treatment of glioma GW Research Ltd 17/02/2016
EU/3/16/1622 Adeno-associated viral vector serotype 5 containing a B-domain deleted variant of human coagulation factor VIII gene Treatment of haemophilia A BioMarin Europe Ltd 21/03/2016
EU/3/16/1623 Adeno-associated viral vector serotype 8 encoding human ornithine transcarbamylase Treatment of ornithine transcarbamylase deficiency Pharma Gateway AB 21/03/2016
EU/3/16/1624 Acalabrutinib Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Acerta Pharma, BV 21/03/2016
EU/3/16/1625 Acalabrutinib Treatment of mantle cell lymphoma Acerta Pharma, BV 21/03/2016
EU/3/16/1626 Acalabrutinib Treatment of lymphoplasmacytic lymphoma Acerta Pharma, BV 21/03/2016
EU/3/16/1627 Allogeneic Epstein-Barr virus specific cytotoxic T lymphocytes Treatment of post-transplant lymphoproliferative disorder Atara Biotherapeutics Ireland Limited 21/03/2016
EU/3/16/1628 Diaspirin cross-linked haemoglobin Treatment of oesophageal cancer New B Innovation (UK) Limited 21/03/2016
EU/3/16/1629 Exenatide Treatment of idiopathic intracranial hypertension Alan Boyd Consultants Ltd 21/03/2016
EU/3/16/1630 Fenretinide Treatment of cutaneous T-cell lymphoma Clinipace GmbH 21/03/2016
EU/3/16/1631 Florilglutamic acid (18F) Diagnosis of glioma Piramal Imaging GmbH 21/03/2016
EU/3/16/1632 Florilglutamic acid (18F) Diagnosis of hepatocellular carcinoma Piramal Imaging GmbH 21/03/2016
EU/3/16/1633 Fosbretabulin tromethamine Treatment of gastro-entero-pancreatic neuroendocrine tumours Diamond BioPharm Limited 21/03/2016
EU/3/16/1634 Glucopyranosyl lipid A stable emulsion and recombinant New York esophageal squamous cell carcinoma-1 protein Treatment of soft tissue sarcoma Immune Design Ltd 21/03/2016
EU/3/16/1635 N-acetyl-D-mannosamine monohydrate Treatment of GNE myopathy Escala Therapeutics Ltd 21/03/2016
EU/3/16/1636 Sindbis virus envelope pseudotyped lentiviral vector encoding New York esophageal squamous cell carcinoma-1 protein Treatment of soft tissue sarcoma Immune Design Ltd 21/03/2016
EU/3/16/1637 Synthetic double-stranded siRNA oligonucleotide directed against hydroxyacid oxidase 1 mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues Treatment of primary hyperoxaluria Alnylam UK Limited 21/03/2016
EU/3/16/1638 Ubenimex Treatment of pulmonary arterial hypertension Eiger Biopharmaceuticals Europe Limited 21/03/2016
EU/3/16/1639 (1E,6E)-1,7-bis(3,4-dimethoxyphenyl)-4-cyclobutylmethyl-1,6-heptadiene-3,5-dione Treatment of X-linked spinal and bulbar muscular atrophy (Kennedy's disease) IQVIA RDS Ireland Limited 28/04/2016
EU/3/16/1640 2-methyl-1-[(4-[6-(trifluoromethyl)pyridin-2-yl]-6-{[2-(trifluoromethyl)pyridin-4-yl]amino}-1,3,5-triazin-2-yl)amino]propan-2-ol methanesulfonate Treatment of acute myeloid leukaemia Celgene Europe Limited 28/04/2016
EU/3/16/1641 Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA Treatment of Leber’s congenital amaurosis ProQR Therapeutics IV BV 28/04/2016
EU/3/16/1642 Autologous dermal fibroblasts genetically modified ex vivo with a lentiviral vector containing the human COL7A1 gene Treatment of epidermolysis bullosa Intrexon Actobiotics N.V. 28/04/2016
EU/3/16/1643 Autologous stromal vascular cell fraction from adipose tissue Treatment of systemic sclerosis Cytori Ltd 28/04/2016
EU/3/16/1644 Brincidofovir Prevention of cytomegalovirus disease Chimerix UK Ltd 28/04/2016
EU/3/16/1645 Cannabidiol Prevention of graft-versus-host disease Richardson Associates Regulatory Affairs Ltd 28/04/2016
EU/3/16/1646 Combination of 4-hydroxyandrostenedione, Serenoa serrulata fruit extract and alpha lipoic acid Treatment of multiple symmetric lipomatosis Dr Regenold GmbH 28/04/2016
EU/3/16/1648 Human/murine chimeric monoclonal antibody against endoglin Treatment of soft tissue sarcoma Tracon Pharma Limited 28/04/2016
EU/3/16/1649 Humanised recombinant IgG4 anti-human tau antibody Treatment of progressive supranuclear palsy AbbVie Deutschland GmbH & Co. KG 28/04/2016
EU/3/16/1651 Recombinant adeno-associated viral vector serotype 9 carrying the gene for the human E6-AP ubiquitin protein ligase Treatment of Angelman syndrome Voisin Consulting S.A.R.L. 28/04/2016
EU/3/16/1652 Recombinant human cerebral dopamine neurotrophic factor Treatment of amyotrophic lateral sclerosis Herantis Pharma Plc 28/04/2016
EU/3/16/1653 Resiquimod Treatment of cutaneous T-cell lymphoma Galderma R&D 28/04/2016
EU/3/16/1654 S-acetyl-(S)-4'-phosphopantetheine, calcium salt Treatment of pantothenate-kinase-associated neurodegeneration Acies Bio d.o.o. 28/04/2016
EU/3/16/1655 Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu, Ser-Gly-Gln-Ala-Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu-Pro-Ser-Cys-Leu-Glu-Ser, Arg-Ser-Asp-Glu-Leu-Val-Arg-His-His-Asn-Met-His-Gln-Arg-Asn-Met-Thr-Lys-Leu and Pro-Gly-Cys-Asn-Lys-Arg-Tyr-Phe-Lys-Leu-Ser-His-Leu-Gln-Met-His-Ser-Arg-Lys-His-Thr-Gly Treatment of acute myeloid leukaemia SELLAS Life Sciences Group UK, Limited 28/04/2016
EU/3/16/1656 Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu, Ser-Gly-Gln-Ala-Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu-Pro-Ser-Cys-Leu-Glu-Ser, Arg-Ser-Asp-Glu-Leu-Val-Arg-His-His-Asn-Met-His-Gln-Arg-Asn-Met-Thr-Lys-Leu and Pro-Gly-Cys-Asn-Lys-Arg-Tyr-Phe-Lys-Leu-Ser-His-Leu-Gln-Met-His-Ser-Arg-Lys-His-Thr-Gly Treatment of malignant mesothelioma SELLAS Life Sciences Group UK, Limited 28/04/2016
EU/3/16/1657 (R)-6-(2-fluorophenyl)-N-(3-(2-((2-methoxyethyl)amino)ethyl)phenyl)-5,6-dihydrobenzo[h]quinazolin-2-amine dihydrochloride Treatment of biliary tract cancer QRC Consultants Ltd 30/05/2016
EU/3/16/1659 Arimoclomol citrate Treatment of inclusion body myositis Orphazyme ApS 30/05/2016
EU/3/16/1660 Autologous CD34+ cells transduced with lentiviral vector encoding the human beta globin gene Treatment of beta thalassaemia intermedia and major GlaxoSmithKline Trading Services Limited 30/05/2016
EU/3/16/1661 Fc- and CDR-modified humanised monoclonal antibody against C5 Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe SAS 30/05/2016
EU/3/16/1662 H-Phe-Ser-Arg-Tyr-Ala-Arg-OH acetate Treatment of amyotrophic lateral sclerosis QRC Consultants Ltd 30/05/2016
EU/3/16/1663 Pentosan polysulfate sodium Treatment of interstitial cystitis NextraResearch S.r.l. 30/05/2016
EU/3/16/1664 Polyethylene glycol-modified human recombinant truncated cystathionine beta-synthase Treatment of homocystinuria Alan Boyd Consultants Ltd 30/05/2016
EU/3/16/1665 Recombinant adeno-associated viral vector containing the human RPGR gene Treatment of retinitis pigmentosa caused by mutations in the RPGR gene TMC Pharma Services Ltd 30/05/2016
EU/3/16/1666 Rimiducid Treatment of graft-versus-host disease Bellicum Pharma Limited 30/05/2016
EU/3/16/1667 Rovalpituzumab tesirine Treatment of small cell lung cancer AbbVie Deutschland GmbH & Co. KG 30/05/2016
EU/3/16/1668 Sodium nitrite and ethylenediaminetetraacetic acid Treatment of cystic fibrosis Arch Bio Ireland Ltd 30/05/2016
EU/3/16/1669 Temsirolimus Treatment of adrenoleukodystrophy Consorcio Centro de Investigación Biomédica en Red M.P. 30/05/2016
EU/3/16/1670 Vemurafenib Treatment of Langerhans’ cell histiocytosis Groupe d'étude des histiocytoses 30/05/2016
EU/3/16/1671 2'-O-(2-methoxyethyl)phosphorothioate antisense oligonucleotide targeting the growth hormone receptor Treatment of acromegaly IQVIA RDS Ireland Limited 27/06/2016
EU/3/16/1672 3-(5-amino-2-methyl-4-oxoquinazolin-3(4H)-yl)piperidine-2,6-dione hydrochloride Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 27/06/2016
EU/3/16/1673 Pyridoxine and L-pyroglutamic acid Treatment of fragile X syndrome FGK Representative Service Ltd 27/06/2016
EU/3/16/1674 Allogeneic donor-derived ex-vivo expanded T lymphocytes transduced with a retroviral vector containing inducible caspase 9 and truncated CD19 Treatment in haematopoietic stem cell transplantation Bellicum Pharma Limited 27/06/2016
EU/3/16/1675 Citric acid monohydrate Treatment of acute liver failure CATS Consultants GmbH 27/06/2016
EU/3/16/1676 Cyclocreatine Treatment of creatine deficiency syndromes Pharma Gateway AB 27/06/2016
EU/3/16/1677 Diclofenamide Treatment of periodic paralysis Sun Pharmaceutical Industries Europe BV 27/06/2016
EU/3/16/1678 Donor T lymphocytes depleted ex vivo of host alloreactive T cells using photodynamic treatment Treatment in haematopoietic stem cell transplantation Kiadis Pharma Netherlands B.V. 27/06/2016
EU/3/16/1679 Eflornithine Treatment of glioma Orbus Therapeutics Limited 27/06/2016
EU/3/16/1680 Humanised anti-IL-6 receptor monoclonal antibody Treatment of neuromyelitis optica spectrum disorders Chugai Pharma Europe Ltd 27/06/2016
EU/3/16/1681 Humanised monoclonal antibody targeting interleukin-15 Treatment of eosinophilic oesophagitis Calypso Biotech B.V. 27/06/2016
EU/3/16/1682 Melatonin Treatment of necrotising enterocolitis Therapicon Srl 01/08/2016
EU/3/16/1683 Melatonin Treatment of neonatal sepsis Therapicon Srl 27/06/2016
EU/3/16/1684 Modified mRNA encoding the UGT1A1 protein Treatment of Crigler-Najjar syndrome Pharma Gateway AB 27/06/2016
EU/3/16/1685 Molgramostim Treatment of acute respiratory distress syndrome Savara ApS 27/06/2016
EU/3/16/1686 Recombinant humanised monoclonal IgG2 lambda antibody against human sclerostin Treatment of osteogenesis imperfecta Mereo Biopharma 3 Limited 27/06/2016
EU/3/16/1687 Recombinant protein derived from the saliva of the Ornithodoros moubata tick Treatment of Guillain-Barré syndrome Akari Therapeutics Plc 27/06/2016
EU/3/16/1688 Setmelanotide Treatment of Prader-Willi syndrome TMC Pharma Services Ltd 27/06/2016
EU/3/16/1689 Teriparatide Treatment of hypoparathyroidism Alacrita LLP 27/06/2016
EU/3/16/1690 16-base single-stranded peptide nucleic acid oligonucleotide linked to a 7 aminoacid peptide Treatment of soft tissue sarcoma Biogenera SpA 14/07/2016
EU/3/16/1692 3-[4-(1H-imidazol-1-ylmethyl)phenyl]-5-(2-methylpropyl)thiophene-2-[(N-butyloxylcarbamate)-sulphonamide] sodium salt Treatment of idiopathic pulmonary fibrosis Vicore Pharma AB 14/07/2016
EU/3/16/1693 Adeno-associated viral vector serotype 2.7m8 containing the ChrimsonR-tdTomato gene Treatment of retinitis pigmentosa GenSight- Biologics 14/07/2016
EU/3/16/1694 Autologous CD4+ and CD8+ T-cells transduced with lentiviral vector containing an affinity-enhanced T-cell receptor targeting the New York esophageal antigen-1 Treatment of soft tissue sarcoma Adaptimmune Limited 14/07/2016
EU/3/16/1695 Autologous Epstein-Barr virus specific T-cells derived from peripheral blood mononuclear cells, expanded ex vivo Treatment of extranodal NK/T-cell lymphoma, nasal type Cell Medica Ltd 14/07/2016
EU/3/16/1696 Autologous Epstein-Barr virus specific T-cells derived from peripheral blood mononuclear cells, expanded ex vivo Treatment of post-transplant lymphoproliferative disorder Cell Medica Ltd 14/07/2016
EU/3/16/1697 Brincidofovir Treatment of adenovirus infection in immunocompromised patients Chimerix UK Ltd 14/07/2016
EU/3/16/1698 Dimethyl fumarate Treatment of bullous pemphigoid Immungenetics AG 14/07/2016
EU/3/16/1699 Mifamurtide Treatment of echinococcosis Delta Proteomics SAS 14/07/2016
EU/3/16/1700 Mifamurtide Treatment of hepatocellular carcinoma Delta Proteomics SAS 14/07/2016
EU/3/16/1701 Poly(oxy-1,2-ethanediyl), alpha-(carboxymethyl)-omega-methoxy-,amide with arginase 1 [cobalt cofactor] (synthetic human) (1:10), trimer Treatment of hyperargininaemia ERA Consulting GmbH 14/07/2016
EU/3/16/1702 Recombinant human monoclonal antibody to insulin receptor Treatment of congenital hyperinsulinism XOMA UK Limited 14/07/2016
EU/3/16/1703 Setmelanotide Treatment of pro-opiomelanocortin deficiency TMC Pharma Services Ltd 14/07/2016
EU/3/16/1704 Sirolimus Treatment of sporadic lymphangioleiomyomatosis Best Regulatory Consulting Ltd 14/07/2016
EU/3/16/1705 Sodium benzoate Treatment of ornithine transcarbamylase deficiency Lucane Pharma SA 14/07/2016
EU/3/16/1706 Sodium benzoate Treatment of carbamoyl-phosphate synthase-1 deficiency Lucane Pharma SA 14/07/2016
EU/3/16/1707 Sodium benzoate Treatment of citrullinaemia type 1 Lucane Pharma SA 14/07/2016
EU/3/16/1708 Sodium benzoate Treatment of hyperargininaemia Lucane Pharma SA 14/07/2016
EU/3/16/1709 Sodium hypochlorite Treatment of partial deep dermal and full thickness burns Hypo-Stream Ltd 14/07/2016
EU/3/16/1710 Triheptanoin Treatment of McArdle’s disease Vall d'Hebron Institute of Research 14/07/2016
EU/3/16/1711 Volanesorsen sodium Treatment of familial partial lipodystrophy Akcea Therapeutics UK Ltd 14/07/2016
EU/3/16/1712 2-((2-ethyl-6-(4-(2-(3-hydroxyazetidin-1-yl)-2-oxoethyl)-piperazin-1-yl)-8-methylimidazo[1,2-alpha]pyridin-3-yl)-(methyl)amino)-4-(4-fluorophenyl)-thiazole-5-carbonitrile Treatment of idiopathic pulmonary fibrosis Galapagos NV 29/08/2016
EU/3/16/1713 2-(1,5-dimethyl-3-phenyl-1H-pyrrol-2-yl)-N-{4-[4-(5-fluoro-pyrimidin-2-yl)piperazin-1-yl]-phenyl}-2-oxo-acetamide Treatment of scedosporiosis F2G Ltd 29/08/2016
EU/3/16/1714 6'-(R)-methyl-5-O-(5-amino-5,6-dideoxy-a-L-talofuranosyl)-paromamine sulfate Treatment of mucopolysaccharidosis type I IQVIA RDS Ireland Limited 29/08/2016
EU/3/16/1715 Adenovirus associated viral vector serotype 5 containing the human RPGR gene Treatment of retinitis pigmentosa MeiraGTx UK II Limited 29/08/2016
EU/3/16/1716 Adeno-associated viral vector serotype 9 containing the human mini-dystrophin gene Treatment of Duchenne muscular dystrophy Pfizer Limited 29/08/2016
EU/3/16/1717 Autologous mesenchymal stromal cells on a decellularised tracheal scaffold from a cadaveric donor Treatment of tracheal stenosis Videregen Ltd 29/08/2016
EU/3/16/1718 Cannabidiol Treatment of graft-versus-host disease Richardson Associates Regulatory Affairs Ltd 29/08/2016
EU/3/16/1719 Cisplatin Treatment of malignant mesothelioma PlumeStars s.r.l. 29/08/2016
EU/3/16/1720 Fimaporfin Treatment of cholangiocarcinoma PCI Biotech AS 29/08/2016
EU/3/16/1721 L-Pyr-L-Glu-L-Gln-L-Leu-L-Glu-L-Arg-L-Ala-L-Leu-L-Asn-L-Ser-L-Ser Prevention of graft loss in pancreatic islet transplantation Araim Pharma Europe Ltd 29/08/2016
EU/3/16/1722 Masitinib mesilate Treatment of amyotrophic lateral sclerosis AB Science 29/08/2016
EU/3/16/1723 Methotrexate Treatment of alkaptonuria aimAKU (Associazione Italiana Malati di Alcaptonuria) 29/08/2016
EU/3/16/1724 Nintedanib Treatment of systemic sclerosis Boehringer Ingelheim International GmbH 29/08/2016
EU/3/16/1725 Recombinant protein derived from the saliva of the Ornithodoros moubata tick Treatment of paroxysmal nocturnal haemoglobinuria Akari Therapeutics Plc 29/08/2016
EU/3/16/1726 Recombinant human acid alpha-glucosidase conjugated with mannose-6-phosphate analogues Treatment of glycogen storage disease type II (Pompe’s disease) NanoMedSyn 29/08/2016
EU/3/16/1727 Recombinant human interleukin-12 Treatment of acute radiation syndrome IQVIA RDS Ireland Limited 29/08/2016
EU/3/16/1729 Sodium benzoate Treatment of lysinuric protein intolerance Lucane Pharma SA 29/08/2016
EU/3/16/1730 Sodium benzoate Treatment of ornithine translocase deficiency Lucane Pharma SA 29/08/2016
EU/3/16/1731 Synthetic double-stranded siRNA oligonucleotide directed against delta-aminolevulinic acid synthase 1 mRNA covalently linked to a ligand containing three N-acetylgalactosamine residues Treatment of acute hepatic porphyria Alnylam UK Limited 29/08/2016
EU/3/16/1732 Synthetic ribonucleic acid oligonucleotide directed against superoxide dismutase 1 messenger ribonucleic acid Treatment of amyotrophic lateral sclerosis Biogen Idec Limited 29/08/2016
EU/3/16/1733 Temozolomide Treatment of glioma Double Bond Pharmaceutical AB 29/08/2016
EU/3/16/1734 Valproic Acid Treatment of McArdle’s disease Vall d'Hebron Institute of Research 29/08/2016
EU/3/16/1735 Zoledronic acid Treatment of glioma Laboratorio Italiano Biochimico Farmaceutico Lisapharma S.p.A. 29/08/2016
EU/3/16/1736 (6aR,10aR)-3-(1',1'-dimethylheptyl)-delta-8-tetrahydrocannabinol-9-carboxylic acid Treatment of cystic fibrosis TMC Pharma Services Ltd 14/10/2016
EU/3/16/1737 (E)-(6-((N-methyl-((3-methylbenzofuran-2-yl)methyl)amino)-3-oxoprop-1-en-1-yl)-2-oxo-3,4-dihydro-1,8-naphthyridin-1(2H)-yl)methyl phosphate, bis ethanolamine salt Treatment of osteomyelitis Voisin Consulting S.A.R.L. 14/10/2016
EU/3/16/1738 2-(1,5-dimethyl-3-phenyl-1H-pyrrol-2-yl)-N-{4-[4-(5-fluoro-pyrimidin-2-yl)piperazin-1-yl]-phenyl}-2-oxo-acetamide Treatment of invasive aspergillosis F2G Ltd 14/10/2016
EU/3/16/1739 A non-covalent trimer of tumour necrosis factor fused to an antibody specific to the extra-domain B of fibronectin in single-chain variable fragment format Treatment of soft tissue sarcoma Philogen S.p.A. 14/10/2016
EU/3/16/1740 Adeno-associated viral vector serotype 2/2 containing a gene encoding the channelrhodopsin-2 protein Treatment of retinitis pigmentosa Allergan Pharmaceuticals International Limited 14/10/2016
EU/3/16/1741 Adeno-associated viral vector serotype 5 containing the human RLBP1 gene Treatment of retinitis pigmentosa HORAMA SA 14/10/2016
EU/3/16/1742 Acebutolol hydrochloride Treatment of Smith-Magenis syndrome Therapicon Srl 14/10/2016
EU/3/16/1743 Autologous mononuclear cells derived from human cord blood Treatment of neonatal encephalopathy BrainRepair UG (haftungsbeschränkt) 14/10/2016
EU/3/16/1744 Autologous mononuclear cells derived from human cord blood Treatment of periventricular leukomalacia BrainRepair UG (haftungsbeschränkt) 14/10/2016
EU/3/16/1745 Autologous T cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19 Treatment of diffuse large B-cell lymphoma Novartis Europharm Limited 14/10/2016
EU/3/16/1746 Carbamazepine Treatment of metaphyseal chondrodysplasia, Schmid type University of Newcastle upon Tyne 14/10/2016
EU/3/16/1747 Chemically modified human recombinant sulfamidase Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Swedish Orphan Biovitrum AB (publ) 14/10/2016
EU/3/16/1748 Crenolanib besylate Treatment of acute myeloid leukemia Arog Pharmaceuticals Europe Ltd 14/10/2016
EU/3/16/1749 Crenolanib besylate Treatment of soft tissue sarcoma Arog Pharmaceuticals Europe Ltd 14/10/2016
EU/3/16/1750 Exendin (9-39) Treatment of noninsulinoma pancreatogenous hypoglycaemia syndrome Eiger Biopharmaceuticals Europe Limited 14/10/2016
EU/3/16/1751 Fenretinide Treatment of peripheral T-cell lymphoma Clinipace GmbH 14/10/2016
EU/3/16/1752 Human monoclonal IgG1 antibody against tissue factor pathway inhibitor Treatment of haemophilia A Pfizer Limited 14/10/2016
EU/3/16/1753 Haematopoietic stem cells modified with a lentiviral vector containing the CD18 gene Treatment of leukocyte adhesion deficiency type I Consorcio Centro de Investigación Biomédica en Red M.P. 14/10/2016
EU/3/16/1754 Lutetium-177(3+),S2,S7-cyclo[N-{4,7,10-tricarboxymethyl-1,4,7,10-tetraaza-cyclododecan-1-yl-acetyl}-4-chloro-L-phenylalanyl-D-cysteinyl-4-[(4S)-2,6-dioxo-1,3-diazinane-4-carboxamido]-L-phenylalanyl-4-(carbamoylamino)-D-phenylalanyl-L-lysyl-L-threonyl-L-cysteinyl-D-tyrosinamide] Treatment of gastro-entero-pancreatic neuroendocrine tumours Ipsen Pharma 14/10/2016
EU/3/16/1755 Melatonin Treatment of Smith-Magenis syndrome Therapicon Srl 14/10/2016
EU/3/16/1756 Mogamulizumab Treatment of cutaneous T-cell lymphoma Kyowa Kirin Limited 14/10/2016
EU/3/16/1757 N-[(2S)-5-{[(1R,2S)-2-(4-fluorophenyl)cyclopropyl]amino}-1-(4-methylpiperazin-1-yl)-1-oxopentan-2-yl]-4-(1H-1,2,3-triazol-1-yl)benzamide, bis-tosylate salt Treatment of myelofibrosis Imago BioSciences Ltd 14/10/2016
EU/3/16/1758 P-ethoxy growth factor receptor-bound protein 2 antisense oligonucleotide Treatment of acute myeloid leukaemia Clinical Network Services (UK) Ltd 14/10/2016
EU/3/16/1759 Recombinant adeno-associated viral vector encoding a human micro-dystrophin gene under the control of a muscle specific promoter Treatment of Duchenne muscular dystrophy Pharma Gateway AB 14/10/2016
EU/3/16/1760 Radio-iodinated (131I) anti-CD45 murine monoclonal antibody Treatment in haematopoietic stem cell transplantation PharmaLex UK Services Limited 14/10/2016
EU/3/16/1761 Self-complementary adeno-associated viral vector serotype 9 containing the SGSH gene Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Abeona Therapeutics Europe SL 14/10/2016
EU/3/16/1762 Synthetic 15-amino-acid macrocyclic peptide acylated with a polyethyleneglycol palmitoylated linker Treatment of paroxysmal nocturnal haemoglobinuria Ra Europe Limited 14/10/2016
EU/3/16/1763 Tadekinig alfa Treatment of haemophagocytic lymphohistiocytosis IQVIA RDS Ireland Limited 14/10/2016
EU/3/16/1764 Tetrofosmin Diagnosis of glioma ProActina 14/10/2016
EU/3/16/1765 Ubiquinol Treatment of primary coenzyme Q10 deficiency syndrome Consorcio Centro de Investigación Biomédica en Red M.P. 14/10/2016
EU/3/16/1766 Venetoclax Treatment of diffuse large B-cell lymphoma AbbVie Deutschland GmbH & Co. KG 14/10/2016
EU/3/16/1767 Venetoclax Treatment of multiple myeloma AbbVie Deutschland GmbH & Co. KG 14/10/2016
EU/3/16/1768 Xenon Treatment of ischaemia reperfusion injury associated with cardiac arrest Neuroprotexeon Ltd 14/10/2016
EU/3/16/1769 2-hydroxy-6-((2-(1-isopropyl-1H-pyrazol-5-yl)pyridin-3-yl)methoxy)benzaldehyde Treatment of sickle cell disease SynteractHCR Deutschland GmbH 18/11/2016
EU/3/16/1770 5-[4-[2-(5-(1-hydroxyethyl)-2-pyridinyl)ethoxy]benzyl]-2,4-thiazolidinedione hydrochloride Treatment of adrenoleukodystrophy Minoryx Therapeutics S.L. 18/11/2016
EU/3/16/1771 Adeno-associated viral vector serotype 8 containing the human glucose-6-phosphatase gene Treatment of glycogen storage disease type Ia Pharma Gateway AB 18/11/2016
EU/3/16/1772 Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene Treatment of Crigler-Najjar syndrome Audentes Therapeutics UK Limited 18/11/2016
EU/3/16/1773 Allogeneic cytomegalovirus-specific cytotoxic T lymphocytes Treatment of cytomegalovirus infection in patients with impaired cell-mediated immunity Atara Biotherapeutics Ireland Limited 18/11/2016
EU/3/16/1774 Allogeneic peripheral blood mononuclear cells incubated ex vivo with 16, 16-dimethyl prostaglandin E2 and dexamethasone Treatment in haematopoietic stem cell transplantation Fate Therapeutics Ltd 18/11/2016
EU/3/16/1775 Alpha-tocopherol Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
EU/3/16/1776 Ascorbic acid Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
EU/3/16/1777 Brincidofovir Treatment of smallpox Chimerix UK Ltd 18/11/2016
EU/3/16/1778 Budesonide Treatment of primary IgA nephropathy Calliditas Therapeutics AB 18/11/2016
EU/3/16/1779 Human monoclonal antibody against activin A Treatment of fibrodysplasia ossificans progressiva Regeneron Ireland U.C. 18/11/2016
EU/3/16/1780 Ibrutinib Treatment of graft-versus-host disease Janssen-Cilag International NV 18/11/2016
EU/3/16/1781 Live-attenuated non-replicative Pseudomonas aeruginosa strain expressing large T antigen of Merkel cell polyomavirus Treatment of Merkel cell carcinoma APCure SAS 18/11/2016
EU/3/16/1782 L-selenomethionine Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
EU/3/16/1783 N-(5-(6-chloro-2,2-difluorobenzo[d][1,3]dioxol-5-yl)pyrazin-2-yl)-2-fluoro-6-methylbenzamide Treatment of acute pancreatitis Cogas Pharma Limited 18/11/2016
EU/3/16/1784 Particles comprised of methacrylic acid based co-polymer, cross-linked with a bi-functional cross-linker, purified to bind L-phenylalanine and L-phenylalanine containing peptides Treatment of hyperphenylalaninaemia MipSalus ApS 18/11/2016
EU/3/16/1785 R-azasetron besylate Treatment of sudden sensorineural hearing loss Sensorion 18/11/2016
EU/3/16/1786 Recombinant adeno-associated viral vector serotype 2 carrying the gene for the human aromatic L-amino acid decarboxylase protein Treatment of aromatic L-amino acid decarboxylase deficiency Diamond BioPharm Limited 18/11/2016
EU/3/16/1787 Sodium benzoate Treatment of argininosuccinic aciduria Lucane Pharma SA 18/11/2016
EU/3/16/1788 Sodium benzoate Treatment of N-acetylglutamate synthetase deficiency Lucane Pharma SA 18/11/2016
EU/3/16/1789 Synthetic human hepcidin Treatment of sickle cell disease La Jolla Pharmaceutical II BV 18/11/2016
EU/3/16/1790 Tyr-Gly-Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-Arg-Gly-Gly-Asp-Leu-Leu-Pro-Arg-Gly-Ser Treatment of Huntington’s disease Dr Ulrich Granzer 18/11/2016
EU/3/16/1791 Vaccine consisting of 5 survivin peptides with different human leukocyte antigen restrictions Treatment of ovarian cancer Dr Ulrich Granzer 18/11/2016
EU/3/16/1792 Valproic acid Treatment of diffuse large B-cell lymphoma Valcuria AB 18/11/2016
EU/3/16/1793 Zinc gluconate Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
EU/3/16/1794 68Ga-DOTA-pABzA-DIG-dPhe-Gln-Trp-Ala-Val-Gly-His-NHCH[(CH2-CH(CH3)2]2 Diagnosis of gastrointestinal stromal tumours Advanced Accelerator Applications 12/12/2016
EU/3/16/1795 Adeno-associated viral vector serotype 8 containing the human CNGA3 gene under the control of a cone arrestin promoter Treatment of achromatopsia caused by mutations in the CNGA3 gene Universitätsklinikum Tübingen (UKT) 12/12/2016
EU/3/16/1796 Adeno-associated viral vector serotype 8 encoding engineered rhodopsin DNA-binding repressor and human rhodopsin expression cassettes Treatment of retinitis pigmentosa Fondazione Telethon 12/12/2016
EU/3/16/1797 Arsenic trioxide Treatment of graft-versus-host disease Medsenic 12/12/2016
EU/3/16/1798 Avelumab Treatment of gastric cancer Merck Serono Europe Limited 12/12/2016
EU/3/16/1799 Cabiralizumab Treatment of tenosynovial giant cell tumour, localised and diffuse type TMC Pharma Services Ltd 12/12/2016
EU/3/16/1800 Dantrolene sodium Treatment of Wolfram syndrome Alan Boyd Consultants Ltd 12/12/2016
EU/3/16/1801 Ibudilast Treatment of amyotrophic lateral sclerosis MediciNova (Europe) Limited 12/12/2016
EU/3/16/1802 Ivosidenib Treatment of acute myeloid leukaemia QRC Consultants Ltd 12/12/2016
EU/3/16/1803 Metformin Treatment of progressive myoclonic epilepsy type 2 (Lafora disease) Consorcio Centro de Investigación Biomédica en Red M.P. 12/12/2016
EU/3/16/1804 Pegylated recombinant human interleukin-10 Treatment of pancreatic cancer Larode Ltd 12/12/2016
EU/3/16/1805 Propranolol Treatment of soft tissue sarcoma The Anticancer Fund 12/12/2016
EU/3/16/1806 Recombinant self-complementary adeno-associated viral vector serotype 9 containing the human CLN3 gene Treatment of neuronal ceroid lipofuscinosis Abeona Therapeutics Europe SL 12/12/2016
EU/3/16/1807 Udenafil Treatment of functional single ventricle congenital heart disease ICON Clinical Research Limited 12/12/2016
EU/3/16/1808 (6aR, 10aR)-3-(1',1'-dimethylheptyl)-delta-8-tetrahydro-cannabinol-9-carboxylic acid Treatment of systemic sclerosis TMC Pharma Services Ltd 12/01/2017
EU/3/16/1809 [5,10,15,20-tetrakis(4-carboxyphenyl)-21H,23H-porphine]manganese(III) chloride Treatment of Cockayne syndrome Institut Pasteur 12/01/2017
EU/3/16/1810 3-pentylbenzeneacetic acid sodium salt Treatment of Alström syndrome ProMetic Pharma SMT Limited 12/01/2017
EU/3/16/1811 5-aminolevulinic acid Treatment of glioma Centre Hospitalier Universitaire de Lille 12/01/2017
EU/3/16/1812 Antroquinonol Treatment of pancreatic cancer Biological Consulting Europe Ltd 12/01/2017
EU/3/16/1813 Autologous dendritic cells incubated ex vivo with zebularine and factor VIII Treatment of haemophilia A Idogen AB 12/01/2017
EU/3/16/1814 Doxorubicin hydrochloride in a lipid-based pegylated nanoparticle modified with a 31-aminoacid peptide targeting nucleolin Treatment of malignant mesothelioma TREAT U, S.A. 12/01/2017
EU/3/16/1815 Fluticasone propionate Treatment of eosinophilic oesophagitis Adare Pharmaceuticals srl 12/01/2017
EU/3/16/1816 Genetically modified adeno-associated viral vector serotype 9 expressing shRNA as well as a codon-optimized shRNA-insensitive wildtype PABPN1 Treatment of oculopharyngeal muscular dystrophy Clinipace GmbH 12/01/2017
EU/3/16/1817 Human donor haematopoietic stem and progenitor cells that have been treated ex vivo with the protein transduction domain of the HIV-1 transactivation protein fused to MYC transcription factor Treatment in haematopoietic stem cell transplantation Coté Orphan Consulting UK Limited 12/01/2017
EU/3/16/1818 Human hepatoma cell line HepaRG in bioartificial liver Treatment of acute liver failure Hep-Art Medical Devices BV 12/01/2017
EU/3/16/1819 Humanised IgG1 monoclonal antibody against the receptor-binding site of human placental growth factor Treatment of medulloblastoma Oncurious NV 12/01/2017
EU/3/16/1820 Hydroxychloroquine Treatment of antiphospholipid syndrome Centre Hospitalier Universitaire d'Angers 12/01/2017
EU/3/16/1821 Leuprorelin acetate Treatment of congenital hypogonadotropic hypogonadism Stichting Centre for Human Drug Research (CHDR) 12/01/2017
EU/3/16/1822 Pentosan polysulfate sodium Treatment of interstitial cystitis HV-Polysaccharides GmbH & Co. KG 12/01/2017
EU/3/16/1823 Pioglitazone hydrochloride Treatment of sudden sensorineural hearing loss Regiomedica GmbH 12/01/2017
EU/3/16/1824 Pr-D-Cys-Met-Pip-Arg-Leu-Arg-Sar-Cys-Lys-Arg-Pro-Tyr-Tle-Leu-OH Treatment of perinatal asphyxia VECT-HORUS 12/01/2017
EU/3/16/1825 Recombinant adeno-associated viral vector serotype 9 containing the human N-alpha-acetylglucosaminidase gene Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Abeona Therapeutics Europe SL 12/01/2017
EU/3/16/1826 Recombinant IgG degrading enzyme of Streptococcus pyogenes Prevention of graft rejection following solid organ transplantation Hansa Medical AB 12/01/2017
EU/3/16/1827 Trans-resveratrol Treatment of spinocerebellar ataxia Luis Pereira de Almeida 12/01/2017
EU/3/17/1828 1-(2,2-difluoro-2H-1,3-benzodioxol-5-yl)-N-{1-[(2R)-2,3-dihydroxypropyl]-6-fluoro-2-(1-hydroxy-2-methylpropan-2-yl)-1H-indol-5-yl}cyclopropane-1-carboxamide and ivacaftor Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 27/02/2017
EU/3/17/1829 26 base synthetic single-stranded fully phosphorothioated 2'-O-methyl-RNA and DNA mixmer oligonucleotide-based compound Treatment of Dravet syndrome Eirgen Pharma Limited 27/02/2017
EU/3/17/1830 5-(4,6-dimorpholino-1,3,5-triazin-2-yl)-4-(trifluoromethyl)pyridin-2-amine Treatment of diffuse large B-cell lymphoma Voisin Consulting S.A.R.L. 27/02/2017
EU/3/17/1831 505 amino acid protein, corresponding to amino acids 2-506 of the wild-type human histidyl-tRNA synthetase Treatment of limb-girdle muscular dystrophy Voisin Consulting S.A.R.L. 27/02/2017
EU/3/17/1832 Alpha-tocopherol and ascorbic acid Treatment of fragile X syndrome Advanced Medical Projects 27/02/2017
EU/3/17/1833 Autologous T cells transduced with lentiviral vector encoding an anti-SLAMF7 CD28/CD3-zeta chimeric antigen receptor Treatment of plasma cell myeloma Dr Michael Hudecek 27/02/2017
EU/3/17/1834 Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl]acetate salt Treatment of primary ciliary dyskinesia Polyphor UK Ltd 27/02/2017
EU/3/17/1835 Ex-vivo-expanded autologous keratinocytes transduced with retroviral vector containing the COL7A1 gene Treatment of epidermolysis bullosa Abeona Therapeutics Europe SL 27/02/2017
EU/3/17/1836 Fenfluramine hydrochloride Treatment of Lennox-Gastaut syndrome Zogenix International Ltd 27/02/2017
EU/3/17/1837 Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 Treatment of myelodysplastic syndromes Opsona Therapeutics Limited 27/02/2017
EU/3/17/1838 Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 Treatment of pancreatic cancer Opsona Therapeutics Limited 27/02/2017
EU/3/17/1839 Iodine (131I) murine IgG1 monoclonal antibody against CD276 Treatment of neuroblastoma Y-mAbs Therapeutics A/S 27/02/2017
EU/3/17/1840 N-(4-(1-cyanocyclopentyl)phenyl)-2-(4-pyridinylmethyl)amino-3-pyridinecarboxamide methanesulfonate Treatment of gastric cancer Sirius Regulatory Consulting Limited 27/02/2017
EU/3/17/1841 Propranolol hydrochloride Treatment of von Hippel-Lindau disease Consejo Superior de Investigaciones Cientificas (CSIC) 27/02/2017
EU/3/17/1842 Recombinant human club cell 10 KDa protein Treatment of bronchiolitis obliterans syndrome EUDRAC Limited 27/02/2017
EU/3/17/1843 Soluble recombinant human fibroblast growth factor receptor 3 Treatment of achondroplasia TherAchon SAS 27/02/2017
EU/3/17/1844 Tauroursodeoxycholic acid Treatment of amyotrophic lateral sclerosis Bruschettini s.r.l. 27/02/2017
EU/3/17/1845 Thalidomide Treatment of hereditary haemorrhagic telangiectasia PlumeStars s.r.l. 27/02/2017
EU/3/17/1846 Vemurafenib Treatment of Erdheim-Chester disease Groupe d'étude des histiocytoses 27/02/2017
EU/3/17/1847 (3'R,4'S,5'R)-N-[(3R,6S)-6-carbamoyltetrahydro-2H-pyran-3-yl]-6''-chloro-4'-(2-chloro-3-fluoropyridin-4-yl)-4,4-dimethyl-2''-oxo-1'',2''-dihydrodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indole]-5'-carboxamide mono(4-methylbenzenesulfonate) monohydrate Treatment of soft tissue sarcoma Daiichi Sankyo Europe GmbH 20/03/2017
EU/3/17/1848 Acetylleucine Treatment of Niemann-Pick disease IntraBio Ltd 20/03/2017
EU/3/17/1849 Adeno-associated viral vector serotype 8 containing the human alpha-galactosidase A gene Treatment of Fabry disease Freeline Therapeutics Ltd 20/03/2017
EU/3/17/1850 Adeno-associated viral vector serotype LK03 encoding human ornithine transcarbamylase Treatment of ornithine transcarbamylase deficiency Dr Julien Baruteau 20/03/2017
EU/3/17/1851 Adeno-associated viral vector serotype rh.10 expressing beta-galactosidase Treatment of GM1 gangliosidosis LYSOGENE 20/03/2017
EU/3/17/1852 Allogeneic ex-vivo-expanded umbilical cord blood-derived hematopoietic CD34+ progenitor cells and allogeneic non-expanded umbilical cord blood-derived hematopoietic mature myeloid and lymphoid cells Treatment in haematopoietic stem cell transplantation Regulatory Resources Group Ltd 20/03/2017
EU/3/17/1853 Antisense oligonucleotide targeting the USH2A gene Treatment of retinitis pigmentosa ProQR Therapeutics IV BV 20/03/2017
EU/3/17/1854 Autologous adipose tissue-derived mesenchymal stem cells Treatment of thromboangiitis obliterans (Buerger's disease) SPC GmbH 20/03/2017
EU/3/17/1855 Cannabidiol Treatment of Lennox-Gastaut syndrome GW Research Ltd 20/03/2017
EU/3/17/1856 Inebilizumab Treatment of neuromyelitis optica spectrum disorders AstraZeneca AB 20/03/2017
EU/3/17/1857 Ketoconazole Treatment of granulosa cell tumours Grupo Español de Tumores Huérfanos e Infrecuentes (GETHI) 20/03/2017
EU/3/17/1858 Megestrol acetate Treatment of granulosa cell tumours Grupo Español de Tumores Huérfanos e Infrecuentes (GETHI) 20/03/2017
EU/3/17/1859 Phosphoinositide 3-kinase gamma peptide Treatment of cystic fibrosis Kither Biotech s.r.l. 20/03/2017
EU/3/17/1860 Poly-cyclodextrin-bis-cysteine-PEG3400-camptothecin-conjugate Treatment of ovarian cancer Viadoc Business Solutions Limited 20/03/2017
EU/3/17/1861 (S)-8-{2-amino-6-[1-(5-chloro-biphenyl-2-yl)-(R)-2,2,2-trifluoro-ethoxy]-pyrimidin-4-yl}-2,8-diaza-spiro[4.5]decane-3-carboxylic acid ethyl ester Treatment of pulmonary arterial hypertension Roivant Sciences Ireland Limited 20/04/2017
EU/3/17/1862 Autologous adult bone marrow-derived non-expanded CD133+ haematopoietic stem cells Treatment of Asherman's syndrome Igenomix, S.L. 20/04/2017
EU/3/17/1863 Autologous T lymphocyte-enriched population of cells transduced with a lentiviral vector encoding a chimeric antigen receptor targeting human B cell maturation antigen with 4-1BB and CD3-zeta intracellular signalling domains Treatment of multiple myeloma Celgene Europe Limited 20/04/2017
EU/3/17/1864 Emeramide Prevention of mercury toxicity NBMI Science Limited 20/04/2017
EU/3/17/1865 Estetrol Treatment of neonatal encephalopathy Mithra Pharmaceuticals S.A. 28/04/2017
EU/3/17/1866 Human normal immunoglobulin Treatment in solid organ transplantation Hôpital Foch 20/04/2017
EU/3/17/1867 Modified messenger ribonucleic acid encoding human ornithine transcarbamylase enzyme encapsulated into lipid nanoparticles Treatment of ornithine transcarbamylase deficiency PhaseRx Ireland, Ltd 20/04/2017
EU/3/17/1868 N-[(1R)-1-phenylethyl]-6-{1H-pyrazolo[3,4-d]pyrimidin-4-yl}quinazolin-2-amine Treatment of fragile X syndrome Sentinel Oncology Limited 20/04/2017
EU/3/17/1869 Rituximab Treatment in solid organ transplantation Hôpital Foch 20/04/2017
EU/3/17/1870 Thymidine and deoxycytidine Treatment of mitochondrial DNA depletion syndrome, myopathic form Vall d'Hebron Institute of Research 20/04/2017
EU/3/17/1871 225Ac-lintuzumab Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 22/05/2017
EU/3/17/1872 Chimeric locked nucleic acid deoxynucleoside phosphorothioate-linked oligonucleotide inhibitor directed against microRNA-155-5p Treatment of cutaneous T-cell lymphoma Miragen Therapeutics Europe Ltd 22/05/2017
EU/3/17/1873 Poly(oxy-1,2-ethanediyl),,15,15'-diester with N-acetyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-.alpha.-aspartyl-L-tryptophylglycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-L-threonyl-2-[2-(2-aminoethoxy)ethoxy]acetyl-N6-carboxy-L-lysinamide cyclic (2.fwdarw.12)-(disulfide); where two identical synthetic peptide domains are covalently linked at the ends of the polyethylene glycol chain Treatment of paroxysmal nocturnal haemoglobinuria Best Regulatory Consulting Ltd 22/05/2017
EU/3/17/1874 Recombinant adeno-associated viral vector serotype 6 encoding the B-domain-deleted human factor VIII Treatment of haemophilia A Coté Orphan Consulting UK Limited 22/05/2017
EU/3/17/1875 Recombinant human interleukin-7 fused to a hybrid crystallisable fragment region of a human antibody Treatment of idiopathic CD4 lymphocytopenia NeoImmuneTech, INC., Spółka Akcyjna, Oddział w Polsce 22/05/2017
EU/3/17/1876 Sodium (1R,3R,4R,5S)-3-({2-N-acetylamino-2-deoxy-3-O-[(1S)-1-carboxylato-2-cyclohexylethyl]-beta-D-galactopyranosyl}oxy)-4-({6-deoxy-alpha-L-galactopyranosyl}oxy)-5-ethyl-cyclohexan-1-yl-(38-oxo-2,5,8,11,14,17,20,23,26,29,32,35-dodecaoxa-39-azahentetracontan-41-yl)carboxamide Treatment of acute myeloid leukaemia FGK Representative Service GmbH 22/05/2017
EU/3/17/1877 Tamoxifen citrate Treatment of cystic fibrosis GB Pharma Srl 22/05/2017
EU/3/17/1878 Ursodeoxycholic acid Treatment of Niemann-Pick disease IntraBio Ltd 22/05/2017
EU/3/17/1879 Asp-Arg-Val-Tyr-Ile-His-Pro Treatment of epidermolysis bullosa Envigo Pharma Consulting Ltd 20/06/2017
EU/3/17/1880 Avacopan Treatment of C3 glomerulopathy ChemoCentryx Limited 20/06/2017
EU/3/17/1881 Decitabine and tetrahydrouridine Treatment of sickle cell disease Ulrich Muehlner 20/06/2017
EU/3/17/1882 Ibutamoren mesilate Treatment of growth hormone deficiency Richardson Associates Regulatory Affairs Ltd 20/06/2017
EU/3/17/1883 Pentamer formyl thiophene acetic acid Treatment of Creutzfeldt-Jakob disease NeuroScios GmbH 20/06/2017
EU/3/17/1884 Recombinant human factor IX protein modified with three point mutations Treatment of haemophilia B Voisin Consulting S.A.R.L. 20/06/2017
EU/3/17/1885 Sildenafil Treatment of congenital diaphragmatic hernia Avivia Beheer BV 20/06/2017
EU/3/17/1886 Sirolimus Treatment of tuberous sclerosis Vale Pharmaceuticals Limited 20/06/2017
EU/3/17/1887 Synthetic glucagon analogue modified to contain 7 amino acid substitutions Treatment of congenital hyperinsulinism Zealand Pharma A/S 20/06/2017
EU/3/17/1888 Tripotassium citrate monohydrate and potassium hydrogen carbonate Treatment of distal renal tubular acidosis Advicenne Pharma SA 20/06/2017
EU/3/17/1889 (S)-1-(4-fluorophenyl)-1-(2-(4-(6-(1-methyl-1H-pyrazol-4-yl)pyrrolo[2,1-f][1,2,4]triazin-4-yl)piperazin-yl)pyrimidin-5-yl)ethan-1-amine Treatment of gastrointestinal stromal tumours PhaRA bvba 17/07/2017
EU/3/17/1890 Autologous CD4+ and CD8+ T cells expressing a CD19-specific chimeric antigen receptor Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 17/07/2017
EU/3/17/1891 Bacillus subtilis oxalate decarboxylase Treatment of primary hyperoxaluria Allena Pharmaceuticals Ireland Limited 17/07/2017
EU/3/17/1892 Oxymetazoline hydrochloride Treatment of spinal cord injury RDD Pharma Limited 17/07/2017
EU/3/17/1893 Polyphenyl(disodium 3-O-sulfo-beta-D-glucopyranuronate)-(1?3)-beta-D-galactopyranoside Treatment of anti-MAG neuropathy SFL Regulatory Affairs Consulting Ltd 17/07/2017
EU/3/17/1894 Recombinant human antibody directed against misfolded human superoxide dismutase 1 Treatment of amyotrophic lateral sclerosis The Medical & Regulatory Partnership Limited 17/07/2017
EU/3/17/1895 Retinol Prevention of retinopathy of prematurity orphanix GmbH 17/07/2017
EU/3/17/1896 Sirolimus Treatment of pachyonychia congenita Raremoon Consulting Ltd 17/07/2017
EU/3/17/1897 Tirapazamine Treatment of hepatocellular carcinoma PhaRA bvba 17/07/2017
EU/3/17/1898 Adeno-associated viral vector serotype Anc80 containing the truncated human ATP7B gene under the control of the human alpha-1 antitrypsin promoter Treatment of Wilson's disease Vivet Therapeutics SAS 23/08/2017
EU/3/17/1899 Antisense oligonucleotide targeting exon 13 in the USH2A gene Treatment of retinitis pigmentosa ProQR Therapeutics IV BV 23/08/2017
EU/3/17/1900 Asunercept Treatment of myelodysplastic syndromes Apogenix AG 23/08/2017
EU/3/17/1901 Itraconazole Treatment of naevoid basal-cell carcinoma syndrome (Gorlin syndrome) Mayne Pharma UK Limited 23/08/2017
EU/3/17/1902 N-{2-[(6-{[(2,6-dichloro-3,5-dimethoxyphenyl)carbamoyl](methyl)amino}pyrimidin-4-yl)amino]-5-(4-ethylpiperazin-1-yl)phenyl}prop-2-enamide Treatment of hepatocellular carcinoma Eisai Europe Limited 23/08/2017
EU/3/17/1903 Odiparcil Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Inventiva 23/08/2017
EU/3/17/1904 Picropodophyllin Treatment of glioma Axelar AB 23/08/2017
EU/3/17/1905 Purified pasteurised and freeze-dried cell-wall fragments from Mycobacterium tuberculosis strain RUTI Treatment of tuberculosis Archivel Farma S.L. 23/08/2017
EU/3/17/1906 Recombinant adeno-associated viral vector serotype 5 carrying the gene for the human frataxin protein Treatment of Friedreich’s ataxia Voisin Consulting S.A.R.L. 23/08/2017
EU/3/17/1907 Recombinant fragment of human surfactant protein-D Prevention of bronchopulmonary dysplasia Trimunocor Ltd 23/08/2017
EU/3/17/1908 Recombinant truncated N-terminal fragment of human lens epithelium-derived growth factor Treatment of retinitis pigmentosa Dorian Regulatory Affairs BV 23/08/2017
EU/3/17/1909 Salmonella typhi Ty21a strain transfected with a plasmid vector encoding the human vascular endothelial growth factor receptor 2 Treatment of glioma Vaximm GmbH 23/08/2017
EU/3/17/1910 Sirolimus Treatment of tuberous sclerosis Best Regulatory Consulting Ltd 23/08/2017
EU/3/17/1911 Sodium 2-hydroxylinoleate Treatment of pancreatic cancer Ability Pharmaceuticals SL 23/08/2017
EU/3/17/1912 Tacrolimus Treatment of pulmonary arterial hypertension VIVUS B.V. 23/08/2017
EU/3/17/1913 Teicoplanin Treatment of cystic fibrosis Neupharma S.r.l. 23/08/2017
EU/3/17/1914 (S)-3-((S)-2-(2-((2,6-difluorophenyl)amino)-2-oxoacetamido)propanamido)-4-oxo-5-(2,3,5,6-tetrafluorophenoxy)pentanoic acid Treatment of primary sclerosing cholangitis Pharma Gateway AB 16/10/2017
EU/3/17/1915 2-[N-(2-hydroxyethyl)]-N-(4-methoxybenzenesulfonyl)]amino-N-(4-chlorocinnamyl)-N-methylbenzylamine Treatment of Charcot-Marie-Tooth disease Repositioning SAS 16/10/2017
EU/3/17/1916 5-amino-1-(2-methyl-1H-benzo[d]imidazol-5-yl)-1H-pyrazol-4-yl 1H-indol-2-yl ketone mono[(S)-2-hydroxysuccinate] Treatment of biliary tract cancer Voisin Consulting S.A.R.L. 16/10/2017
EU/3/17/1917 Adenoviral vector of serotype 5 modified to contain a chimeric sequence consisting of a minimal urokinase-type plasminogen activator receptor promoter preceded by three Notch-responsive elements, and coated with oligopeptide end-modified poly (beta-amino) esters Treatment of pancreatic cancer Sagetis Biotech, S.L. 16/10/2017
EU/3/17/1918 Autologous ex-vivo-expanded peripheral polyclonal lymphocytes enriched in activated natural killer cells Treatment of multiple myeloma CellProtect Nordic Pharmaceuticals AB 16/10/2017
EU/3/17/1919 Bitopertin Treatment of beta-thalassaemia intermedia and major Roche Registration GmbH 16/10/2017
EU/3/17/1920 Cannabidiol Treatment of West syndrome GW Research Ltd 16/10/2017
EU/3/17/1921 Cannabidivarin Treatment of Rett syndrome GW Research Ltd 16/10/2017
EU/3/17/1922 Entospletinib Treatment of acute myeloid leukaemia Gilead Sciences International Limited 16/10/2017
EU/3/17/1923 Glasdegib maleate Treatment of acute myeloid leukaemia Pfizer Limited 16/10/2017
EU/3/17/1924 Glucopyranosyl lipid A Treatment of follicular lymphoma Immune Design Ltd 16/10/2017
EU/3/17/1925 Humanised monoclonal antibody targeting B-cell maturation antigen conjugated with maleimidocaproyl monomethyl auristatin F Treatment of multiple myeloma GlaxoSmithKline Trading Services Limited 16/10/2017
EU/3/17/1926 Ofranergene obadenovec Treatment of ovarian cancer Envigo Pharma Consulting Ltd 16/10/2017
EU/3/17/1927 Pracinostat Treatment of acute myeloid leukaemia Helsinn Birex Pharmaceuticals Ltd 16/10/2017
EU/3/17/1928 Recombinant adeno-associated viral vector serotype 5 encoding Staphylococcus aureus Cas9 endonuclease and two guide RNAs complementary to two regions of intron 26 of the CEP290 gene Treatment of Leber’s congenital amaurosis Pharma Gateway AB 16/10/2017
EU/3/17/1929 Recombinant monoclonal antibody to sialic acid-binding Ig-like lectin 8 Treatment of mastocytosis Envestia Limited 16/10/2017
EU/3/17/1930 Seladelpar Treatment of primary biliary cholangitis Larode Ltd 16/10/2017
EU/3/17/1931 Siplizumab Treatment in solid organ transplantation ITB-MED AB 16/10/2017
EU/3/17/1932 Synthetic cyclic 8 amino acid analogue of human unacylated ghrelin Treatment of Prader-Willi syndrome Alizé Pharma 16/10/2017
EU/3/17/1933 (1'R,6'R)-3-(benzylamine)-6-hydroxy-3'-methyl-4-pentyl-6'-(prop-1-en-2-yl)-[1,1'-bi(cyclohexane)]-2',3,6-triene-2,5-dione Treatment of systemic sclerosis IQVIA RDS Ireland Limited 08/11/2017
EU/3/17/1934 (R)-troloxamide quinone Treatment of amyotrophic lateral sclerosis Edison Orphan Pharma BV 08/11/2017
EU/3/17/1935 1,4-diamino-2,3-dicyano-1,4-bis[2-aminophenylthio]butadiene Treatment of non-traumatic subarachnoid haemorrhage Edvince AB 08/11/2017
EU/3/17/1936 1-[4-bromo-5-[1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl]-2-fluorophenyl]-3-phenylurea Treatment of gastrointestinal stromal tumours Pharma Gateway AB 08/11/2017
EU/3/17/1937 4-amino-1-[(1S,4R,5S)-2-fluoro-4,5-dihydroxy-3-(hydroxymethyl)cyclopent-2-en-1-yl]pyrimidin-2-one Treatment of pancreatic cancer IQVIA RDS Ireland Limited 08/11/2017
EU/3/17/1938 Antisense oligonucleotide targeting exon 73 in the COL7A1 gene Treatment of epidermolysis bullosa ProQR Therapeutics VII BV 08/11/2017
EU/3/17/1939 C1-esterase-inhibitor human Treatment in solid organ transplantation CSL Behring GmbH 08/11/2017
EU/3/17/1940 Concizumab Treatment of haemophilia B Novo Nordisk A/S 08/11/2017
EU/3/17/1941 Diazoxide choline Treatment of Prader-Willi syndrome Soleno Therapeutics UK Ltd 08/11/2017
EU/3/17/1942 N-(2-aminophenyl)-4-(1-[(1,3-dimethyl-1H-pyrazol-4-yl)methyl]piperidin)benzamide Treatment of peripheral T-cell lymphoma Celleron Therapeutics Limited 08/11/2017
EU/3/17/1943 Recombinant adeno-associated viral vector serotype 9 containing human iduronate-2-sulfatase gene Treatment of mucopolysaccharidosis type II (Hunter’s syndrome) REGENXBIO EU Limited 08/11/2017
EU/3/17/1944 Tamoxifen citrate Treatment of Duchenne muscular dystrophy Duchenne UK 08/11/2017
EU/3/17/1945 Tiratricol Treatment of Allan-Herndon-Dudley syndrome MN Development AB 08/11/2017
EU/3/17/1946 (2S,4R)-1-(2-(3-acetyl-5-(2-methylpyrimidine-5-yl)-1H-indazol-1-yl)acetyl)-N-(6-bromopyridine-2-yl)-4-fluoropyrrolidine-2-carboxamide Treatment of paroxysmal nocturnal haemoglobinuria FGK Representative Service GmbH 12/12/2017
EU/3/17/1947 2-isopropyl-3H-naphtho[1,2-d]imidazole-4,5-dione Treatment of mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes NeuroVive Pharmaceutical AB 12/12/2017
EU/3/17/1948 4-hydroxy-2,2,6,6-tetramethylpiperidine-N-oxyl Treatment of familial cerebral cavernous malformations Premier Research Group Limited 12/12/2017
EU/3/17/1949 Acetylleucine Treatment of GM2 gangliosidosis IntraBio Ltd 12/12/2017
EU/3/17/1950 Adenovirus associated viral vector serotype 8 containing the human AIPL1 gene Treatment of Leber’s congenital amaurosis MeiraGTx UK II Limited 12/12/2017
EU/3/17/1951 Agammaglobulinaemia tyrosine kinase Treatment of pemphigus Clinical Network Services (UK) Ltd 12/12/2017
EU/3/17/1952 Modified messenger ribonucleic acid encoding human argininosuccinate lyase enzyme encapsulated into lipid nanoparticles Treatment of argininosuccinic aciduria PhaseRx Ireland, Ltd 12/12/2017
EU/3/17/1953 Pegunigalsidase alfa Treatment of Fabry disease Protalix B.V 12/12/2017
EU/3/17/1954 Venetoclax Treatment of mantle cell lymphoma AbbVie Deutschland GmbH & Co. KG 12/12/2017
EU/3/17/1955 Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human alpha L-iduronidase gene Treatment of mucopolysaccharidosis type I IQVIA RDS Ireland Limited 17/01/2018
EU/3/17/1956 Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human iduronate 2-sulfatase gene Treatment of mucopolysaccharidosis type II (Hunter’s syndrome) IQVIA RDS Ireland Limited 17/01/2018
EU/3/17/1957 Adeno-associated viral vector serotype 5 encoding a microRNA targeted to human huntingtin gene Treatment of Huntington's disease uniQure Biopharma B.V. 17/01/2018
EU/3/17/1958 Allogeneic umbilical cord blood CD34+ cells cultured ex vivo with Notch ligand Delta1 Treatment in haematopoietic stem cell transplantation Voisin Consulting S.A.R.L. 17/01/2018
EU/3/17/1959 Cannabidiol Treatment of tuberous sclerosis GW Research Ltd 17/01/2018
EU/3/17/1960 Ciclopirox Treatment of congenital erythropoietic porphyria Atlas Molecular Pharma S.L. 17/01/2018
EU/3/17/1961 Gilteritinib Treatment of acute myeloid leukaemia Astellas Pharma Europe B.V. 17/01/2018
EU/3/17/1962 Humanised Fc-engineered monoclonal antibody against CD19 Treatment of IgG4-related disease MWB Consulting Ltd 17/01/2018
EU/3/17/1963 Hydroxychloroquine sulphate Treatment of LIPIN1 disease Professor Pascale De Lonlay 17/01/2018
EU/3/17/1964 Itacitinib Treatment of graft-versus-host disease Incyte Biosciences UK Ltd 17/01/2018
EU/3/17/1965 Metformin and L-citrulline Treatment of Duchenne muscular dystrophy Duchenne UK 17/01/2018
EU/3/17/1966 N-(bromoacetyl)-3,3-dinitroazetidine Treatment of small cell lung cancer Sirius Regulatory Consulting Limited 17/01/2018
EU/3/17/1967 N-[2,6-bis(1-methylethyl)phenyl]-N'-[[1-[4-(dimethylamino)phenyl]cyclopentyl]methyl]urea, hydrochloride salt Treatment of congenital adrenal hyperplasia Millendo Therapeutics Ltd 17/01/2018
EU/3/17/1968 Pyrazolo[1,5-a]pyrimidine, 3-[4-chloro-2-(4-morpholinyl)-5-thiazolyl]-7-(1-ethylpropyl)-2,5-dimethyl-pyrazolo[1,3-a]pyrimidine Treatment of congenital adrenal hyperplasia Regintel Limited 17/01/2018
EU/3/17/1969 Recombinant adeno-associated viral vector serotype 2/1 encoding human beta-hexosaminidase alpha and beta subunits Treatment of GM2 gangliosidosis University of Cambridge 17/01/2018
EU/3/17/1970 Sirolimus Treatment of sickle cell disease Rare Partners srl Impresa Sociale 17/01/2018
EU/3/17/1971 Vatiquinone Treatment of RARS2 syndrome Edison Orphan Pharma BV 17/01/2018
EU/3/18/1972 1-[[[4-(4-fluoro-2-methyl-1H-indol-5-yloxy)-6-methoxyquinolin-7-yl]oxy]methyl]cyclopropanamine-dihydrochloride Treatment of soft tissue sarcoma CATS Consultants GmbH 22/02/2018
EU/3/18/1973 2'-O-(2-methoxyethyl)-modified antisense oligonucleotide targeting exon 13 in the USH2A gene Treatment of retinitis pigmentosa ProQR Therapeutics IV BV 22/02/2018
EU/3/18/1974 6-{[(1R,2S)-2-aminocyclohexyl]amino}-7-fluoro-4-(1-methyl-1H-pyrazol-4-yl)-1,2-dihydro-3H-pyrrolo[3,4-c]pyridin-3-one monocitrate Treatment of acute myeloid leukaemia Takeda Pharma A/S 22/02/2018
EU/3/18/1975 Adenovirus-associated viral vector serotype 8 containing the human RPGR gene Treatment of retinitis pigmentosa Nightstar Therapeutics plc 22/02/2018
EU/3/18/1976 Allogeneic CD4+ and CD25+ T lymphocytes ex vivo incubated with GP120 Treatment in haematopoietic stem cell transplantation Universitätsmedizin der Johannes Gutenberg-Universität Mainz 22/02/2018
EU/3/18/1977 Cannabidivarin Treatment of fragile X syndrome GW Research Ltd 22/02/2018
EU/3/18/1978 Flucytosine Treatment of glioma Richardson Associates Regulatory Affairs Ltd 22/02/2018
EU/3/18/1979 Human monoclonal IgG2 antibody against tissue factor pathway inhibitor Treatment of haemophilia A Bayer AG 22/02/2018
EU/3/18/1980 Levosimendan Treatment of amyotrophic lateral sclerosis Orion Corporation 22/02/2018
EU/3/18/1981 Mertansine functionalised gold nanoconjugate Treatment of hepatocellular carcinoma Midatech Pharma Plc 22/02/2018
EU/3/18/1982 N-(tert-butylcarbamoyl)-5-cyano-2-((4'-(difluoromethoxy)-[1,1'-biphenyl]-3-yl)oxy)benzenesulfonamide Treatment of pulmonary arterial hypertension ATXA Therapeutics Limited 22/02/2018
EU/3/18/1983 Pyridoxal 5'-phosphate Treatment of pyridoxamine 5'-phosphate oxidase deficiency Medicure Pharma Europe Limited 22/02/2018
EU/3/18/1984 Recombinant human monoclonal antibody against mannan-binding lectin-associated serine protease-2 Treatment of primary IgA nephropathy Omeros London Limited 22/02/2018
EU/3/18/1985 Rusalatide acetate Treatment of acute radiation syndrome Raremoon Consulting Ltd 22/02/2018
EU/3/18/1986 Seletalisib Treatment of activated phosphoinositide 3-kinase delta syndrome UCB Biopharma SPRL 22/02/2018
EU/3/18/1987 Vocimagene amiretrorepvec Treatment of glioma Richardson Associates Regulatory Affairs Ltd 22/02/2018
EU/3/18/1988 (R)-2-(5-cyano-2-(6-(methoxycarbonyl)-7-methyl-3-oxo-8-(3-(trifluoromethyl)phenyl)-2,3,5,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyrimidine-5-yl)phenyl)-N,N,N-trimethylethanaminium methanesulfonate dehydrate Treatment of cystic fibrosis Chiesi Farmaceutici S.p.A. 22/02/2018
EU/3/18/1989 (2S,4R)-1-(2-(3-acetyl-5-(2-methylpyrimidine-5-yl)-1H-indazol-1-yl)acetyl)-N-(6-bromopyridine-2-yl)-4-fluoropyrrolidine-2-carboxamide Treatment of C3 glomerulopathy FGK Representative Service GmbH 21/03/2018
EU/3/18/1990 Dimethyl fumarate Treatment of Friedreich's ataxia PharmaBio Consulting 21/03/2018
EU/3/18/1991 Docosahexaenoic acid ethyl ester Treatment of sickle cell disease TurnKey PharmaConsulting Ireland Limited 21/03/2018
EU/3/18/1992 Efgartigimod alfa Treatment of myasthenia gravis argenx BVBA 21/03/2018
EU/3/18/1993 Gemfibrozil Treatment of neuronal ceroid lipofuscinosis IQVIA RDS Ireland Limited 21/03/2018
EU/3/18/1994 Ivosidenib Treatment of biliary tract cancer QRC Consultants Ltd 21/03/2018
EU/3/18/1995 Larotrectinib Treatment of salivary gland cancer Loxo Oncology Limited 21/03/2018
EU/3/18/1996 Melatonin Treatment of neonatal encephalopathy Therapicon Srl 21/03/2018
EU/3/18/1997 Miransertib Treatment of Proteus syndrome QRC Consultants Ltd 21/03/2018
EU/3/18/1998 Patidegib Treatment of naevoid basal-cell carcinoma syndrome (Gorlin syndrome) Blue-Reg Europe 21/03/2018
EU/3/18/1999 Recombinant adeno-associated viral vector containing a codon-optimized Padua derivative of human coagulation factor IX cDNA Treatment of haemophilia B uniQure Biopharma B.V. 21/03/2018
EU/3/18/2000 Recombinant human acid alpha-glucosidase Treatment of glycogen storage disease type II (Pompe's disease) Amicus Therapeutics UK Ltd 21/03/2018
EU/3/18/2001 Recombinant modified ricin toxin A-chain subunit Prevention of ricin poisoning Soligenix UK Ltd 21/03/2018
EU/3/18/2002 Ribavirin Treatment of Crimean-Congo haemorrhagic fever Pharmadev Healthcare Ltd 21/03/2018
EU/3/18/2003 Ribavirin Treatment of Lassa fever Pharmadev Healthcare Ltd 21/03/2018
EU/3/18/2004 Tazemetostat Treatment of diffuse large B-cell lymphoma IQVIA RDS Ireland Limited 21/03/2018
EU/3/18/2005 Tazemetostat Treatment of follicular lymphoma IQVIA RDS Ireland Limited 21/03/2018
EU/3/18/2006 Tazemetostat Treatment of malignant mesothelioma IQVIA RDS Ireland Limited 21/03/2018
EU/3/18/2007 Adeno-associated viral vector serotype 8 containing the human acid alpha-glucosidase gene Treatment of glycogen storage disease type II (Pompe's disease) Dr Philippe Moullier 16/04/2018
EU/3/18/2008 Adeno-associated viral vector serotype 9 encoding miRNA against human superoxide dismutase 1 Treatment of amyotrophic lateral sclerosis Stolmár & Partner Patentanwälte PartG mbB 16/04/2018
EU/3/18/2009 Autologous dendritic cells pulsed with killed ovarian cancer cells and matured by TLR3 ligand ex vivo Treatment of ovarian cancer SOTIO a.s 16/04/2018
EU/3/18/2010 Branaplam Treatment of spinal muscular atrophy Novartis Europharm Limited 16/04/2018
EU/3/18/2011 Burosumab Treatment of phosphaturic mesenchymal tumour Ultragenyx Germany GmbH 16/04/2018
EU/3/18/2012 Genetically modified replication-incompetent herpes simplex virus-1 expressing collagen VII Treatment of epidermolysis bullosa IDEA Innovative Drug European Associates Limited 16/04/2018
EU/3/18/2013 Polatuzumab vedotin Treatment of diffuse large B-cell lymphoma Roche Registration Limited 16/04/2018