Navigation path

Community Register of medicinal products

Register of designated Orphan Medicinal Products (by number)

EU Designation Product Designated Orphan Indication Sponsor Designation date Tradename
EU Centralised Nr
implemented by
EU/3/00/001 Somatropin AIDS wasting Merck Serono Europe Limited 8/08/2000
EU/3/00/005 Gemtuzumab Ozogamicin Treatment of acute myeloid leukaemia Wyeth Europa Ltd. 18/10/2000
EU/3/00/006 1,5-(Butylimino)-1,5-dideoxy, D-glucitol Treatment of Gaucher Disease Oxford GlycoSciences (UK) Ltd 18/10/2000 Zavesca
EU/1/02/238/...
20/11/2002
EU/3/00/007 N-carbamyl-L-glutamic acid Treatment of N-acetylglutamate synthetase (NAGS) deficiency Orphan Europe S.a.r.l. 18/10/2000 Carbaglu
EU/1/02/246/...
24/01/2003
EU/3/00/010 Anagrelide Hydrochloride Treatment of essential thrombocythaemia Shire Pharmaceutical Development Ltd 29/12/2000 Xagrid
EU/1/04/295/...
16/11/2004
EU/3/00/011 Busulfan (Intravenous use) Busilvex followed by cyclophosphamide (BuCy2) is indicated as conditioning treatment prior to conventional haematopoietic progenitor cell transplantation (HPCT) in adult patients when the combination is considered the best available option.

Busilvex followed by cyclophosphamide (BuCy4) or melphalan (BuMel) is indicated as conditioning treatment prior to conventional haematopoietic progenitor cell transplantation in paediatric patients.
Pierre Fabre Médicament 29/12/2000 Busilvex
EU/1/03/254/...
9/07/2003
EU/3/00/012 Nitisinone Treatment of tyrosinaemia type I Swedish Orphan International AB 29/12/2000 Orfadin
EU/1/04/303/...
21/02/2005
EU/3/00/013 Ethyl Eicosopentaenoate Treatment of Huntington´s disease Amarin Neuroscience Limited 29/12/2000
EU/3/00/014 Iloprost Treatment of primary and of the following forms of secondary pulmonary hypertension: connective tissue disease pulmonary hypertension, drug-induced pulmonary hypertension, portopulmonary hypertension, pulmonary hypertension associated with congenital heart disease, chronic thromboembolic pulmonary hypertension Bayer Schering Pharma AG 29/12/2000 Ventavis
EU/1/03/255/...
16/09/2003
EU/3/00/018 Recombinant human acid alpha-glucosidase Treatment of Glycogen Storage Disease type II (Pompe´s disease) Genzyme Europe B.V. 14/02/2001 Myozyme
EU/1/06/333/...
29/03/2006
EU/3/01/019 bosentan Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Actelion Registration Limited 14/02/2001 Tracleer
EU/1/02/220/...
15/05/2002
EU/3/01/020 Ibuprofen Treatment of patent ductus arteriosus Orphan Europe S.a.r.l. 14/02/2001 Pedea
EU/1/04/284/...
29/07/2004
EU/3/01/022 Laronidase Treatment of Mucopolysaccharidosis, type I Genzyme Europe B.V. 14/02/2001 Aldurazyme
EU/1/03/253/...
10/06/2003
EU/3/01/023 Pegvisomant Treatment of acromegaly Pfizer Ltd 14/02/2001 Somavert
EU/1/02/240/...
13/11/2002
EU/3/01/025 N-acetylgalactosamine-4-sulfatase Treatment of Mucopolysaccharidosis, type VI (Maroteaux-Lamy Syndrome) BioMarin Europe Ltd 14/02/2001 Naglazyme
EU/1/05/324/...
24/01/2006
EU/3/01/026 L-Lysine-N-acetyl-L-cysteinate Treatment of cystic fibrosis LABORATOIRES SMB SA 14/02/2001
EU/3/01/028 Inolimomab Treatment of Graft versus Host Disease EUSA Pharma SAS 5/03/2001
EU/3/01/034 Gusperimus trihydrochloride Treatment of Wegener’s granulomatosis Nordic Group B.V. 29/03/2001
EU/3/01/035 Levodopa and Carbidopa (Gastroenteral use) Treatment of advanced idiopathic Parkinson´s disease with severe motor fluctuations and not responding to oral treatment Abbott Products GmbH 10/05/2001
EU/3/01/038 Retroviral gamma-c cDNA containing vector Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease GENOPOIETIC S.A.S. 30/05/2001
EU/3/01/039 Ecteinascidin 743 Treatment of soft tissue sarcoma PharmaMar S.A. 30/05/2001 Yondelis
EU/1/07/417/...
17/09/2007
EU/3/01/044 Human Alpha1-Proteinase Inhibitor (respiratory use) Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency CSL Behring GmbH 9/07/2001
EU/3/01/045 Betaine anhydrous Treatment of homocystinuria Orphan Europe S.a.r.l. 9/07/2001 Cystadane
EU/1/06/379/...
15/02/2007
EU/3/01/048 Ziconotide (intraspinal use) Treatment of chronic pain requiring intraspinal analgesia Eisai Limited 9/07/2001 Prialt
EU/1/04/302/...
21/02/2005
EU/3/01/049 Ramoplanin Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection Vicuron Pharmaceuticals Italy srl, 9/07/2001
EU/3/01/050 Zinc acetate dihydrate Treatment of Wilson´s disease Orphan Europe S.a.r.l. 31/07/2001 Wilzin
EU/1/04/286/...
13/10/2004
EU/3/01/051 1,3-Propanedisulfonic acid, disodium salt Treatment of Systemic Secondary Amyloidosis Kiacta Europe Ltd 31/07/2001
EU/3/01/055 Cladribine (subcutaneous use) Treatment of indolent non-Hodgkin´s lymphoma Lipomed GmbH 18/09/2001 Litak
EU/1/04/275/...
14/04/2004
EU/3/01/056 Recombinant human acid sphingomyelinase Treatment of Niemann-Pick Disease, type B Genzyme Europe B.V. 19/09/2001
EU/3/01/058 Repertaxin L-lysine salt Prevention of delayed graft function in organ transplant Dompé s.p.a. 19/09/2001
EU/3/01/059 Dexrazoxane Treatment of anthracycline extravasations SpePharm Holding B.V. 19/09/2001 Savene
EU/1/06/350/...
28/07/2006
EU/3/01/062 Idebenone Treatment of Friedreich’s ataxia Laboratoires Takeda 20/11/2001
EU/3/01/063 Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) Treatment of chronic lymphocytic leukaemia Voisin Consulting S.A.R.L. 20/11/2001
EU/3/01/065 Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) Treatment of multiple myeloma Voisin Consulting S.A.R.L. 20/11/2001
EU/3/01/067 Thalidomide Treatment of multiple myeloma Celgene Europe Limited 20/11/2001 Thalidomide Celgene
EU/1/08/443/...
16/04/2008
EU/3/01/069 Phenylephrine Hydrochloride Treatment of ileal pouch anal anastomosis related faecal incontinence S.L.A. Pharma (UK) Limited 20/11/2001
EU/3/01/070 Celecoxib Treatment of Familial Adenomatous Polyposis Pfizer Limited 20/11/2001 Onsenal
EU/1/03/259/...
17/10/2003
EU/3/01/071 Stiripentol Treatment of severe myoclonic epilepsy in infancy Biocodex 5/12/2001 Diacomit
EU/1/06/367/...
4/01/2007
EU/3/01/074 Halofuginone Hydrobromide Treatment of systemic sclerosis PPD Global Ltd 11/12/2001
EU/3/01/075 Denileukin diftitox Treatment of cutaneous T-cell lymphoma Eisai Limited 11/12/2001
EU/3/01/077 [gly2] Recombinant human glucagon-like peptide Treatment of Short Bowel Syndrome Nycomed Danmark ApS 11/12/2001
EU/3/01/078 Iduronate-2-sulfatase Treatment of Mucopolysaccharidosis, type II (Hunter Syndrome) Shire HGT AB 11/12/2001 Elaprase
EU/1/06/365/...
8/01/2007
EU/3/01/079 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Treatment of acute lung injury Pharm Research Associates (UK) Limited 4/02/2002
EU/3/01/081 Fumagillin Treatment of diarrhoea associated with intestinal microsporidial infection SANOFI 4/02/2002
EU/3/01/082 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine Treatment of acute lymphoblastic leukaemia Genzyme Europe B.V. 5/02/2002 Evoltra
EU/1/06/334/...
29/05/2006
EU/3/01/083 Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene Treatment of high-grade glioma with subsequent use of ganciclovir sodium Ark Therapeutics Ltd 6/02/2002
EU/3/01/084 Azacitidine Treatment of myelodysplastic syndromes Celgene Europe Limited 6/02/2002 Vidaza
EU/1/08/488/...
17/12/2008
EU/3/02/086 Porfimer sodium (for use with photodynamic therapy) Treatment of high-grade dysplasia in Barrett’s Esophagus Pinnacle Biologics B.V. 6/03/2002 PhotoBarr
EU/1/04/272/...
25/03/2004
EU/3/02/091 TGF-beta2 specific phosphorothioate antisense oligodeoxynucleotide Treatment of high-grade glioma Antisense Pharma GmbH 22/03/2002
EU/3/02/092 4-(3,5-bis-(hydroxy-phenyl)-1,2,4) triazol-1-yl)-benzoic acid Treatment of chronic iron overload requiring chelation therapy Novartis Europharm Ltd 13/03/2002 Exjade
EU/1/06/356/...
28/08/2006
EU/3/02/093 Beclomethasone 17, 21-dipropionate (oral use) Treatment of intestinal graft-versus-host disease Soligenix UK Ltd 13/03/2002
EU/3/02/094 Chimeric IgG monoclonal antibody cG250 Treatment of renal cell carcinoma Wilex AG 19/03/2002
EU/3/02/095 Iodine (131I) chimeric IgG monoclonal antibody cG250 Treatment of renal cell carcinoma Wilex AG 19/03/2002
EU/3/02/096 Nitisinone Treatment of alkaptonuria Swedish Orphan International AB 13/03/2002
EU/3/02/101 Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein Treatment of glioma EUDRAC Limited 30/04/2002
EU/3/02/102 Mitotane Treatment of adrenal cortical carcinoma Laboratoire HRA Pharma 12/06/2002 Lysodren
EU/1/04/273/...
28/04/2004
EU/3/02/103 Recombinant Human Porphobilinogen Deaminase Treatment of acute intermittent porphyria Zymenex A/S 12/06/2002
EU/3/02/104 Miltefosine Treatment of visceral leishmaniasis Zentaris GmbH 12/06/2002
EU/3/02/106 Antisense NF-Kß p65 Oligonucleotide Treatment of active ulcerative colitis InDex Pharmaceuticals AB 30/07/2002
EU/3/02/107 Purified bromelain Treatment of partial deep dermal and full thickness burns TEVA Pharma GmbH 30/07/2002
EU/3/02/109 Oregovomab Treatment of ovarian cancer ViRexx International Corp. Limited 30/07/2002
EU/3/02/110 Thymalfasin Treatment of hepatocellular carcinoma SciClone Pharmaceuticals Italy S.r.l 30/07/2002
EU/3/02/111 Benzoic acid, sodium salt Treatment of non-ketotic hyperglycinaemia Ethicare GmbH 11/09/2002
EU/3/02/115 Treatment of uremic pruritus Toray International U.K. Limited 11/09/2002
EU/3/02/116 Treatment of renal cell carcinoma Liponova GmbH 21/10/2002
EU/3/02/118 Recombinant glycoprotein gp350 of Epstein-Barr virus Prevention of post transplantation lympho-proliferative disorders Henogen S.A. 22/10/2002
EU/3/02/119 Iodine (¹³¹I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody Treatment of glioma Interface International Consultancy Limited 13/11/2002
EU/3/02/120 Duramycin Treatment of cystic fibrosis AOP Orphan Pharmaceuticals AG 13/11/2002
EU/3/02/121 5-aminolevulinic acid hydrochloride Intra-operative photodynamic diagnosis of residual glioma medac Gesellschaft für klinische Spezialpräparate mbH 13/11/2002 Gliolan
EU/1/07/413/...
7/09/2007
EU/3/02/122 Etilefrin Treatment of low flow priapism Laboratoires SERB 13/11/2002
EU/3/02/124 3,4-diaminopyridine phosphate Treatment of Lambert-Eaton myasthenic syndrome BioMarin Europe Limited 18/12/2002 Firdapse
EU/1/09/601/...
23/12/2009
EU/3/02/126 Recombinant inhibitor of human plasma kallikrein treatment of angioedema Dyax s.a. 18/12/2002
EU/3/02/127 Cholic acid Treatment of inborn errors in primary bile acid synthesis Laboratoires C.T.R.S 18/12/2002
EU/3/02/128 Carboxypeptidase G2 Adjunctive treatment in patients at risk of methotrexate toxicity Enact Pharma PLC 3/02/2003
EU/3/02/129 G17(9) gastrin-diphtheria toxoid conjugate Treatment of pancreatic cancer Cato Europe GmbH 24/01/2003
EU/3/02/130 G17(9) gastrin-diphtheria toxoid conjugate Treatment of gastric cancer Cato Europe GmbH 28/01/2003
EU/3/03/132 Caffeine citrate Treatment of primary apnoea of premature newborns Chiesi Farmaceutici S.P.A. 17/02/2003 Peyona
EU/1/09/528/...
2/07/2009
EU/3/03/133 Icatibant acetate treatment of angioedema Jerini AG 17/02/2003 Firazyr
EU/1/08/461/...
11/07/2008
EU/3/03/134 Iodine (123I) Serum Amyloid P Diagnosis of the extent of histologically proven amyloidosis Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. 14/02/2003
EU/3/03/135 Decitabine Treatment of myelodysplastic syndromes Janssen-Cilag International NV 14/02/2003
EU/3/03/136 Iodine (¹³¹I) tositumomab Treatment of follicular lymphoma GlaxoSmithKline Research & Development Limited 14/02/2003
EU/3/03/137 Tositumomab Treatment of follicular lymphoma GlaxoSmithKline Research & Development Limited 14/02/2003
EU/3/03/139 bosentan Treatment of systemic sclerosis Actelion Registration Limited 17/03/2003 Tracleer
EU/1/02/220/...
7/06/2007
EU/3/03/140 Tobramycin (inhalation powder) Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Chiron Corporation Ltd 17/03/2003 TOBI Podhaler
EU/1/10/652/...
20/07/2011
EU/3/03/141 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine. Treatment of acute myeloid leukaemia Genzyme Europe BV 8/05/2003
EU/3/03/144 Liarozole Treatment of congenital ichthyoses Stiefel Laboratories (U.K.) Limited 10/06/2003
EU/3/03/145 Rubitecan Treatment of pancreatic cancer Eurogen Pharmaceuticals Limited 10/06/2003
EU/3/03/149 Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate Treatment of pancreatic cancer in combination with ifosfamide Ziel Biopharma Limited 30/06/2003
EU/3/03/153 Herpes simplex virus lacking infected cell protein 34.5 Treatment of glioma Virttu Biologics Limited 9/07/2003
EU/3/03/154 Hydroxyurea Treatment of sickle cell syndrome Addmedica 9/07/2003 Siklos
EU/1/07/397/...
29/06/2007
EU/3/03/155 Murine anti-idiotypic antibody against OC125 antibody against CA125 antigen Treatment of ovarian cancer Menarini Ricerche S.p.A. 9/07/2003
EU/3/03/156 Prasterone Treatment of adrenal insufficiency Medicom Healthcare BV 28/07/2003
EU/3/03/157 Recombinant dog gastric lipase Treatment of cystic fibrosis Meristem Therapeutics S.A. 9/07/2003
EU/3/03/160 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Treatment of retinopathy of prematurity Gene Signal SAS 2/10/2003
EU/3/03/161 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Treatment of neovascular glaucoma Gene Signal SAS 2/10/2003
EU/3/03/162 Yttrium (90Y) antiferritin polyclonal antibodies Treatment of Hodgkin lymphoma Monoclonal Antibodies Therapeutics (MAT) 2/10/2003
EU/3/03/163 5,6,7,8-Tetrahydrobiopterin Treatment of hyperphenylalaninemia Orphanetics Pharma Entwicklungs GmbH 2/10/2003
EU/3/03/166 Eculizumab Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe S.A.S. 17/10/2003 Soliris
EU/1/07/393/...
20/06/2007
EU/3/03/168 Adjunctive treatment in hematopoietic cell transplantation MolMed SpA 20/10/2003
EU/3/03/169 Human immunoglobulin Treatment of dermatomyositis Orfagen 20/10/2003
EU/3/03/170 Human immunoglobulin Treatment of polymyositis Orfagen 24/10/2003
EU/3/03/171 Trabectedin Treatment of ovarian cancer Pharmamar S.A. Sociedad Unipersonal 17/10/2003
EU/3/03/172 Trientine dihydrochloride Treatment of Wilson´s disease Univar Limited 24/10/2003
EU/3/03/173 Vasoactive Intestinal Peptide Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Mondobiotech Laboratories AG 22/12/2003
EU/3/03/174 Gimatecan Treatment of glioma Sigma Tau Industrie Farmaceutiche Riunite S.p.A 1/12/2003
EU/3/03/175 Recombinant antibody derivative against human CD19 and CD3 Treatment of mantle cell lymphoma Micromet GmbH 1/12/2003
EU/3/03/176 Recombinant antibody derivative against human CD19 and CD3 Treatment of chronic lymphocytic leukaemia Micromet GmbH 1/12/2003
EU/3/03/177 3-(4´aminoisoindoline-l´-one)-1-piperidine-2,6-dione Treatment of multiple myeloma Celgene Europe Limited 12/12/2003 Revlimid
EU/1/07/391/...
14/06/2007
EU/3/03/178 Sildenafil citrate Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Pfizer Ltd 12/12/2003 Revatio
EU/1/05/318/...
28/10/2005
EU/3/03/179 Recombinant human factor XIII (composed of two A subunits) Treatment of hereditary factor XIII deficiency Novo Nordisk A/S 12/12/2003
EU/3/03/182 5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt Treatment of aneurysmal subarachnoid haemorrhage Axovan Europe Ltd 12/12/2003
EU/3/03/183 Temocillin sodium Treatment of Burkholderia cepacia lung infection in cystic fibrosis Belpharma N.V 14/01/2004
EU/3/03/184 Cilengitide Treatment of glioma Merck KGaA 14/01/2004
EU/3/04/186 Treosulfan Conditioning treatment prior to haematopoietic progenitor cell transplantation medac Gesellschaft für klinische Spezialpräparate mbH 23/02/2004
EU/3/04/188 N-3[[4(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl) oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) Treatment of moderate and severe traumatic brain injury Xytis Pharmaceuticals Limited 23/02/2004
EU/3/04/189 Idebenone Treatment of Friedreich’s ataxia Santhera Pharmaceuticals (Deutschland) GmbH 8/03/2004
EU/3/04/190 Ethanol (96 per cent ) (gel for injection) Treatment of congenital lymphatic malformations Orfagen 8/03/2004
EU/3/04/191 Ethanol (96 per cent ) (gel for injection) Treatment of congenital venous malformations Orfagen 8/03/2004
EU/3/04/192 3-(4´aminoisoindoline-1´-one)-1-piperidine-2,6-dione Treatment of myelodysplastic syndromes Celgene Europe Limited 8/03/2004
EU/3/04/193 Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody Treatment of ovarian cancer Fresenius Biotech GmbH 8/03/2004
EU/3/04/194 Adeno-associated viral vector expressing lipoprotein lipase Treatment of lipoprotein lipase deficiency Amsterdam Molecular Therapeutics 8/03/2004
EU/3/04/195 2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol Treatment of anaplastic thyroid cancer Dr David Chaplin 14/04/2004
EU/3/04/197 Treprostinil sodium (inhalation use) Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 14/04/2004
EU/3/04/198 Human monoclonal antibody against CD4 Treatment of cutaneous T-cell lymphoma Genmab A/S 14/04/2004
EU/3/04/199 Tetrahydrobiopterin Treatment of hyperphenylalaninemia Merck Serono Europe Limited 8/06/2004 Kuvan
EU/1/08/481/...
2/12/2008
EU/3/04/200 ((2-aminoethyl) carbamic acid (2R,5S,8S,11S,14R,17S,19aS)-11-(4-aminobutyl)-5-benzyl-8-(4-benzyloxy benzyl)-14-(1H-indol-3-ylmethyl)-4,7,10,13,16,19-hexaoxo-17-phenyloctadecahydro-3a,6,9,12,15,18-hexaazacyclopentacyclooctadecen-2-yl ester, di[(S)-2-aminosuccinic acid] salt Treatment of functional gastro-entero-pancreatic endocrine tumours Novartis Europharm Ltd 8/06/2004
EU/3/04/201 Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar Prevention of stenosis in synthetic grafts used in haemodialysis Ark Therapeutics Ltd 8/06/2004
EU/3/04/202 HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients Cellcure A/S 21/06/2004
EU/3/04/203 5’-CTG CCA CGT TCT CCT GC-(2’ methoxy)A-(2’ methoxy)C-(2’ methoxy)C-3’ Treatment of myasthenia gravis PPD Global Ltd 21/06/2004
EU/3/04/204 Aztreonam lysinate (inhalation use) Treatment of gram negative bacteria lung infections in cystic fibrosis Gilead Sciences International Limited 21/06/2004 Cayston
EU/1/09/543/...
21/09/2009
EU/3/04/205 Suberoylanilide hydroxamic acid Treatment of cutaneous T-cell lymphoma Merck Sharp & Dohme Ltd 21/06/2004
EU/3/04/206 Muramyl tripeptide phosphatidyl ethanolamine Treatment of osteosarcoma IDM Pharma S.A. 21/06/2004 Mepact
EU/1/08/502/...
6/03/2009
EU/3/04/207 Sorafenib tosylate Treatment of renal cell carcinoma Bayer Schering Pharma AG 29/07/2004 Nexavar
EU/1/06/342/...
19/07/2006
EU/3/04/208 Acetylsalicylic acid Treatment of polycythemia vera Bayer HealthCare AG 29/07/2004
EU/3/04/209 Ciclosporin (inhalation use) Prevention of graft rejection after lung transplantation PARI Pharma GmbH 29/07/2004
EU/3/04/210 Ciclosporin (inhalation use) Treatment of graft rejection after lung transplantation PARI Pharma GmbH 29/07/2004
EU/3/04/211 Defibrotide Prevention of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004
EU/3/04/212 Defibrotide Treatment of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004
EU/3/04/213 Mepolizumab Treatment of hypereosinophilic syndrome Glaxo Group Limited 29/07/2004
EU/3/04/214 Midostaurin Treatment of acute myeloid leukaemia Novartis Europharm Ltd 29/07/2004
EU/3/04/215 Porfimer sodium (for use with photodynamic therapy) Treatment of cholangiocarcinoma Pinnacle Biologics B.V. 29/07/2004
EU/3/04/216 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
EU/3/04/217 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
EU/3/04/219 HLA-B27 derived peptide (amino acid 125-138) Treatment of autoimmune uveitis Dr Gerhild Wildner 2/09/2004
EU/3/04/220 Anti epidermal growth factor receptor antibody h-R3 Treatment of glioma Oncoscience AG 2/09/2004
EU/3/04/222 Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Eli Lilly Nederland B.V. 2/09/2004
EU/3/04/223 Heparin sodium Treatment of idiopathic pulmonary fibrosis Prof. Dr Seeger 2/09/2004
EU/3/04/224 Homoharringtonine Treatment of chronic myeloid leukaemia ChemGenex Europe SAS 2/09/2004
EU/3/04/226 Recombinant human interleukin-21 Treatment of renal cell carcinoma Quintiles Limited 2/09/2004
EU/3/04/227 l, 1´-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane Treatment to mobilize progenitor cells prior to stem cell transplantation Genzyme Europe B.V. 20/10/2004 Mozobil
EU/1/09/537/...
31/07/2009
EU/3/04/228 Homoharringtonine Treatment of acute myeloid leukaemia ChemGenex Europe SAS 20/10/2004
EU/3/04/229 Doxorubicin polyisohexylcyanoacrylate nanoparticles Treatment of the hepatocellular carcinoma BioAlliance Pharma 21/10/2004
EU/3/04/230 Dexamethasone sodium phosphate encapsulated in human erythrocytes Treatment of cystic fibrosis Erydel S.p.A. 20/10/2004
EU/3/04/231 Deferoxamine mesilate Treatment of traumatic spinal cord injury SCT Spinal Cord Therapeutics GmbH 20/10/2004
EU/3/04/232 Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium Treatment of glioma Sigma Tau Industrie Farmaceutiche Riunite S.p.A 20/10/2004
EU/3/04/233 Adeno-associated viral vector containing the human gamma-sarcoglycan gene Treatment of gamma-sarcoglycanopathy Généthon 21/10/2004
EU/3/04/234 Sitaxentan sodium Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Encysive (UK) Limited 21/10/2004 Thelin
EU/1/06/353/...
10/08/2006
EU/3/04/240 Rufinamide Treatment of Lennox-Gastaut syndrome Eisai Limited 20/10/2004 Inovelon
EU/1/06/378/...
16/01/2007
EU/3/04/241 Pirfenidone Treatment of idiopathic pulmonary fibrosis InterMune UK Limited 16/11/2004 Esbriet
EU/1/11/667/...
28/02/2011
EU/3/04/242 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of mastocytosis OxThera AB 16/11/2004
EU/3/04/243 Alpha-1 antitrypsin (inhalation use) Treatment of cystic fibrosis Innovative Drug European Associates (I.D.E.A.) Limited 16/11/2004
EU/3/04/244 Alpha-1 antitrypsin (inhalation use) Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Innovative Drug European Associates (I.D.E.A.) Limited 16/11/2004
EU/3/04/245 Aplidine Treatment of multiple myeloma Pharma Mar SA Sociedad Unipersonal 16/11/2004
EU/3/04/246 Eptacog alfa (activated) Treatment of Familial Adenomatous Polyposis TopoTarget Germany AG 30/11/2004
EU/3/04/248 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of multiple myeloma CellGenix GmbH 21/12/2004
EU/3/04/249 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of follicular lymphoma CellGenix GmbH 23/12/2004
EU/3/04/250 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of mantle cell lymphoma CellGenix GmbH 21/12/2004
EU/3/04/251 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of malignant gastro intestinal stromal tumours Dr Geoffrey Allan 21/12/2004
EU/3/04/257 Recombinant human bile salt-stimulated lipase Treatment of cystic fibrosis Arexis AB 26/01/2005
EU/3/04/258 L-Asparaginase Treatment of acute lymphoblastic leukaemia medac Gesellschaft für klinische Spezialpräparate mbH 26/01/2005
EU/3/04/260 Recombinant human alpha-Mannosidase Treatment of alpha-Mannosidosis Zymenex A/S 26/01/2005
EU/3/05/261 Fluocinolone acetonide (prolonged-release intravitreal implant) Treatment of non-infectious uveitis affecting the posterior segment of the eye Bausch & Lomb Ireland 7/03/2005
EU/3/05/262 Titanium dioxide and bisoctrizole Treatment of UV-A and visible light-induced photosensitivity disorders (chronic actinic dermatitis, cutaneous porphyrias, actinic prurigo and solar urticaria) Orfagen 3/03/2005
EU/3/05/263 dimethyl sulfoxide Treatment of severe closed traumatic brain injury AOP Orphan Pharmaceuticals AG 3/03/2005
EU/3/05/264 Cholest-4-en-3-one, oxime Treatment of 5q spinal muscular atrophies Trophos SA 10/03/2005
EU/3/05/265 Ciclosporin (inhalation use) Treatment of graft rejection after lung transplantation Chiron Corporation Limited 10/03/2005
EU/3/05/266 Ciclosporin (inhalation use) Prevention of graft rejection after lung transplantation Chiron Corporation Limited (trading as Chiron Biopharmaceuticals) 10/03/2005
EU/3/05/269 Tipifarnib Treatment of acute myeloid leukaemia Janssen-Cilag International NV 10/03/2005
EU/3/05/270 Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex Treatment of renal cell carcinoma Antigenics Therapeutics Limited 11/04/2005
EU/3/05/272 Histamine dihydrochloride Treatment of acute myeloid leukaemia EpiCept GmbH 11/04/2005 Ceplene
EU/1/08/477/...
7/10/2008
EU/3/05/273 Ambrisentan Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension European Medical Advisory Services Limited 11/04/2005 Volibris
EU/1/08/451/...
21/04/2008
EU/3/05/274 Melatonin Non-24-Hour Sleep-Wake Disorder in blind people with no light perception ICON Clinical Research (UK) Limited 11/04/2005
EU/3/05/275 Estradiol Hemihydrate and Progesterone Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age Dr Frank Pohlandt 11/04/2005
EU/3/05/276 Humanized Agonistic Anti-CD28 Monoclonal Antibody Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) TeGenero AG 11/04/2005
EU/3/05/277 (3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid Treatment of cystic fibrosis Voisin Consulting SARL 27/05/2005
EU/3/05/278 (3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid Treatment of Duchenne muscular dystrophy PTC Therapeutics, Limited 27/05/2005
EU/3/05/279 (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone Treatment of cutaneous T-cell lymphoma Celgene Europe Limited 27/05/2005
EU/3/05/280 Acadesine Treatment of B-cell chronic lymphocytic leukemia (B-CLL) Advancell - Advanced In Vitro Cell Technologies, S.A. 27/05/2005
EU/3/05/282 Miltefosine Treatment of Acanthamoeba keratitis Orphanidis Pharma Research GmbH 27/05/2005
EU/3/05/283 Recombinant megakaryopoeisis-stimulating protein Treatment of idiopathic thrombocytopenic purpura Amgen Europe B.V. 27/05/2005 Nplate
EU/1/08/497/...
4/02/2009
EU/3/05/284 Sodium butyrate (rectal use) Prevention of radiation proctitis Promefarm srl 27/05/2005
EU/3/05/285 Bimosiamose disodium Treatment of acute lung injury Revotar Biopharmaceuticals AG 27/05/2005
EU/3/05/286 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of multiple myeloma Dr Geoffrey Allan 20/06/2005
EU/3/05/287 Bovine bile extract Treatment of pancreatic cancer Dr Ulrich Granzer 20/06/2005
EU/3/05/288 4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HC1 Treatment of Huntington´s disease NSAB, Filial af NeuroSearch Sweden AB, Sverige 20/06/2005
EU/3/05/289 Pegylated arginine deiminase Treatment of hepatocellular carcinoma Dr Francesco Izzo 20/06/2005
EU/3/05/290 Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck Viventia Biotech (EU) Limited 20/06/2005
EU/3/05/292 H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Auris Medical Limited 16/06/2005
EU/3/05/293 nelarabine Treatment of acute lymphoblastic leukaemia Glaxo Group Limited 16/06/2005 Atriance
EU/1/07/403/...
22/08/2007
EU/3/05/294 Soluble yeast beta-1,3/1,6-glucan Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Biotec Pharmacon ASA 16/06/2005
EU/3/05/295 Hepatitis C Immunoglobulin Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 8/07/2005
EU/3/05/296 Hydrocortisone (modified release tablet) Treatment of congenital adrenal hyperplasia Diurnal Limited 27/07/2005
EU/3/05/297 Adeno-associated viral vector containing a modified U7-snRNA gene Treatment of Duchenne muscular dystrophy Généthon 27/07/2005
EU/3/05/298 Mycophenolate mofetil Treatment of Cushing’s syndrome secondary to ectopic ACTH secretion Laboratoire HRA Pharma 27/07/2005
EU/3/05/299 4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one Treatment of pancreatic cancer ICON Clinical Research (UK) Ltd 27/07/2005
EU/3/05/300 Nemorubicin hydrochloride Treatment of hepatocellular carcinoma Nerviano Medical Sciences Srl 28/07/2005
EU/3/05/301 Chimeric monoclonal antibody to shiga-toxin 1 and 2 Treatment of shiga-toxin producing bacterial infection. Albany Regulatory Consulting Ltd 26/08/2005
EU/3/05/302 Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower Treatment of sickle cell disease Xechem UK Ltd 26/08/2005
EU/3/05/303 Human autologous mesenchymal adult stem cells extracted from adipose tissue Treatment of anal fistula CELLERIX S.A. 26/08/2005
EU/3/05/307 Mecasermin Treatment of primary growth hormone insensitivity syndrome Ipsen Pharma 26/08/2005
EU/3/05/310 Treprostinil diethanolamine (oral use) Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 26/08/2005
EU/3/05/312 (1R, 2R, 4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R, 27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxazacyclohentriacontin-3-yl]propyl}-2-methoxy-cyclohexyldimethyl-phosphinate Treatment of soft tissue sarcoma Merck Sharp & Dohme Limited 26/08/2005
EU/3/05/313 Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency Fondazione Telethon 26/08/2005
EU/3/05/314 (1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol Treatment of tuberculosis Tibotec BVBA 26/08/2005
EU/3/05/315 (2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide Treatment of progressive myoclonic epilepsies UCB Pharma SA. 26/08/2005
EU/3/05/316 2-{4-[(5,6-diphenylpyrazin-2-yl)(isopropyl)amino]butoxy}-N-(methylsulfonyl)acetamide Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Actelion Registration Ltd 26/08/2005
EU/3/05/317 A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein Treatment of graft-versus-host disease Xenikos BV 26/08/2005
EU/3/05/318 Recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A Prevention of tuberculosis disease in BCG vaccinated individuals Emergent Product Development UK Limited 28/10/2005
EU/3/05/319 Human Staphylococcus aureus immunoglobulin Treatment of Staphylococcus aureus bacteremia Biotest Pharma GmbH 28/10/2005
EU/3/05/321 (1R, 2R, 4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R, 27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxazacyclohentriacontin-3-yl]propyl}-2-methoxy-cyclohexyldimethyl-phosphinate Treatment of primary malignant bone tumours Merck Sharp & Dohme Limited 28/10/2005
EU/3/05/323 Bacterial lipase Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Nordmark Arzneimittel GmbH u. Co. KG 7/11/2005
EU/3/05/324 Levamisol hydrochloride Treatment of nephrotic syndrome Addmedica 28/10/2005
EU/3/05/325 Mannitolum Treatment of cystic fibrosis Pharmaxis Pharmaceuticals Limited 7/11/2005
EU/3/05/326 Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) Treatment of systemic sclerosis Digna Biotech S.L. 28/10/2005
EU/3/05/327 Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt Treatment of glioma Oligovax 28/10/2005
EU/3/05/328 (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Celgene Europe Limited 28/10/2005
EU/3/05/329 Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) Treatment of the localised scleroderma Digna Biotech S.L. 28/10/2005
EU/3/05/331 Recombinant microbial lipase Treatment of malasbsorption due to exocrine pancreatic enzyme insufficiency Abbott Products GmbH 28/10/2005
EU/3/05/332 1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine Treatment of acute myeloid leukaemia Vion (UK) Limited, ? i3 Research 14/12/2005
EU/3/05/333 Eptacog alfa (activated) Treatment of diffuse alveolar haemorrhage Pharmaorigin ApS 14/12/2005
EU/3/05/334 Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) Edimer Ltd 14/12/2005
EU/3/05/336 Brostallicin Treatment of soft tissue sarcoma AAIPharma S.A. 23/12/2005
EU/3/05/337 Heparin sodium (inhalation use) Treatment of cystic fibrosis Vectura Group plc 23/12/2005
EU/3/05/338 Dasatinib Treatment of acute lymphoblastic leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 Sprycel
EU/1/06/363/...
20/11/2006
EU/3/05/339 Dasatinib Treatment of chronic myeloid leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 Sprycel
EU/1/06/363/...
20/11/2006
EU/3/05/341 Imexon Treatment of ovarian cancer ICON Clinical Research (UK) Ltd 23/12/2005
EU/3/05/342 Denufosol tetrasodium Treatment of cystic fibrosis Envestia Limited 23/12/2005
EU/3/05/343 Enzastaurin hydrochloride Treatment of glioma Eli Lilly Nederland B.V. 23/12/2005
EU/3/05/345 Lentiviral vector containing the human Wiskott Aldrich syndrome protein gene Treatment of Wiskott-Aldrich syndrome Généthon 24/01/2006
EU/3/05/346 E. Coli heat-shock protein 70 with bovine retinal S-antigen Treatment of autoimmune uveitis Biotech Tools SA 24/01/2006
EU/3/06/349 Apomorphine hydrochloride (inhalation use) Treatment of off-periods in Parkinson’s disease not responding to oral treatment Vectura Group plc 16/02/2006
EU/3/06/350 Alpha-1 proteinase inhibitor Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Octapharma (IP) Limited 16/02/2006
EU/3/06/351 Miglustat Treatment of Niemann-Pick disease, type C Actelion Registration Ltd 16/02/2006 Zavesca
EU/1/02/238/...
26/01/2009
EU/3/06/354 Oxalobacter formigenes strain HC-1 Treatment of primary hyperoxaluria OxThera AB 17/02/2006
EU/3/06/355 Zosuquidar trihydrochloride Treatment of acute myeloid leukaemia Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP 17/02/2006
EU/3/06/356 4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline Treatment of renal cell carcinoma Prodimed S.A. 16/02/2006
EU/3/06/359 Adeno associated viral vector containing the human calpain 3 gene Treatment of calpainopathy Généthon 6/04/2006
EU/3/06/360 Ciclosporin Treatment of vernal keratoconjunctivitis Novagali Pharma SA 6/04/2006
EU/3/06/361 Glutathione Treatment of cystic fibrosis Mukoviszidose e.V. 11/04/2006
EU/3/06/362 Human heterologous liver cells (for infusion) Treatment of acute liver failure Cytonet GmbH & Co. KG 11/04/2006
EU/3/06/363 4-[131I]iodo-L-phenylalanine Treatment of glioma Therapeia GmbH & Co. KG 11/04/2006
EU/3/06/364 Sorafenib tosylate Treatment of hepatocellular carcinoma Bayer Schering Pharma AG 11/04/2006 Nexavar
EU/1/06/342/...
29/10/2007
EU/3/06/365 Temsirolimus Treatment of renal cell carcinoma Pfizer Limited 6/04/2006 Torisel
EU/1/07/424/...
19/11/2007
EU/3/06/366 Tobramycin (liposomal) Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Axentis Pharma Limited 11/04/2006
EU/3/06/367 Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex Treatment of solitary bone cysts Kuros Biosurgery International AG 11/04/2006
EU/3/06/368 1-deoxygalactonojirimycin hydrochloride Treatment of Fabry disease Amicus Therapeutics UK Limited 22/05/2006
EU/3/06/369 Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix Treatment of epidermolysis bullosa CELLERIX S.A. 22/05/2006
EU/3/06/370 Decitabine Treatment of acute myeloid leukaemia Janssen-Cilag International NV 8/06/2006
EU/3/06/371 Heparin sodium Treatment of cystic fibrosis Ockham Biotech Limited 22/05/2006
EU/3/06/372 Hydrocortisone (modified release tablet) Treatment of adrenal insufficiency ViroPharma SPRL 22/05/2006 Plenadren
EU/1/11/715/...
3/11/2011
EU/3/06/373 Mecasermin Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects Ipsen Pharma 22/05/2006 INCRELEX
EU/1/07/402/...
3/08/2007
EU/3/06/374 Methoxsalen Treatment of Graft-versus-Host disease Johnson & Johnson Medical Ltd 22/05/2006
EU/3/06/375 Nilotinib Treatment of chronic myeloid leukaemia Novartis Europharm Ltd 22/05/2006 Tasigna
EU/1/07/422/...
19/11/2007
EU/3/06/376 Recombinant P-selectin glycoprotein immunoglobulin Prevention of post transplantation graft dysfunction RJM Consultancy Ltd 22/05/2006
EU/3/06/379 Diphenylcyclopropenone Treatment of alopecia totalis Orfagen 29/06/2006
EU/3/06/380 Diphenylcyclopropenone Treatment of alopecia universalis Orfagen 29/06/2006
EU/3/06/381 Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa Voisin Consulting 29/06/2006
EU/3/06/383 Siplizumab Treatment of T-cell and NK-cell neoplasms MedImmune, LLC 29/06/2006
EU/3/06/384 Human telomerase reverse transcriptase peptide (611-626) Treatment of pancreatic cancer Gemvax A/S 25/07/2006
EU/3/06/386 4-[123I]iodo-L-phenylalanine Diagnosis of glioma Therapeia GmbH & Co. KG 25/07/2006
EU/3/06/387 Amikacin sulfate (liposomal) Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Insmed Limited 25/07/2006
EU/3/06/388 Becatecarin Treatment of cancers of the biliary tree Helsinn Birex Pharmaceuticals Ltd 25/07/2006
EU/3/06/389 Lestaurtinib Treatment of acute myeloid leukaemia Cephalon Europe 25/07/2006
EU/3/06/390 4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride Treatment of moderate and severe traumatic brain injury vasopharm GmbH 28/08/2006
EU/3/06/391 Amphotericin B (for inhalation use) Prevention of pulmonary fungal infection in patients deemed at risk Kendle International Ltd 28/08/2006
EU/3/06/392 Human monoclonal antibody against inhibitory killer cell lg-like receptors Treatment of acute myeloid leukaemia Innate Pharma 28/08/2006
EU/3/06/394 Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin Treatment of follicular lymphoma Biovest Europe Limited 28/08/2006
EU/3/06/395 Aviptadil Treatment of acute lung injury mondoBIOTECH Laboratories Anstalt 28/08/2006
EU/3/06/396 Cardiotrophin-1 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation Digna Biotech S.L. 28/08/2006
EU/3/06/397 Cholest-4-en-3-one, oxime Treatment of amyotrophic lateral sclerosis Trophos SA 28/08/2006
EU/3/06/399 Mecasermin rinfabate Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Premacure AB 28/08/2006
EU/3/06/400 Metastable technetium 99 [99mTc] demogastrin 2 Diagnosis of medullary thyroid carcinoma Biomedica Life Sciences SA 28/08/2006
EU/3/06/401 N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate Treatment of familial amyloid polyneuropathy Pfizer Specialty UK Limited 28/08/2006
EU/3/06/403 5-(2,6-Difluoro-phenoxy)-3(R,S)-{2(S)-[2(S)-(3-methoxycarbonyl-2(S)-{3-methyl-2(S)-[(quinoline-2-carbonyl)-amino]-butyrylamino}-propionylamino)-3-methyl-butyrylamino]-propionylamino}-4-oxo-pentanoic acid methyl ester Treatment of neonatal brain injury CHIESI FARMACEUTICI SpA 23/10/2006
EU/3/06/404 Adenoviral vector containing human p53 gene Treatment of Li Fraumeni Syndrome Gendux Molecular Limited 23/10/2006
EU/3/06/405 Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) Treatment of renal cell carcinoma MOLOGEN AG 23/10/2006
EU/3/06/406 Arimoclomol Treatment of amyotrophic lateral sclerosis Orphazyme ApS 26/10/2006
EU/3/06/407 Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 Prevention of necrotizing enterocolitis Dr Michael Moore 31/10/2006
EU/3/06/408 Human cytomegalovirus immunoglobulin Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Biotest Pharma GmbH 31/10/2006
EU/3/06/409 L-asparaginase encapsulated in erythrocytes Treatment of acute lymphoblastic leukaemia Erytech Pharma S.A. 27/10/2006
EU/3/06/410 Doxorubicin hydrochloride (liposomal) Treatment of soft tissue sarcoma GP-Pharm S.A. 27/10/2006
EU/3/06/411 Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule Prevention of Graft-versus-Host disease Apogenix GmbH 31/10/2006
EU/3/06/412 4,7,10,13,16,19-docosahexaenoic acid Treatment of retinitis pigmentosa Celavista Pharmaceuticals Limited 3/11/2006
EU/3/06/413 Budesonide (oral use) Treatment of Graft-versus-Host disease Dr Falk, Pharma GmbH 3/11/2006
EU/3/06/414 Catumaxomab Treatment of gastric cancer Fresenius Biotech GmbH 3/11/2006
EU/3/06/416 Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' Treatment of acute myeloid leukaemia EleosInc Limited 3/11/2006
EU/3/06/417 Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) Treatment of renal cell carcinoma Immunservice GmbH 27/10/2006
EU/3/06/418 Iodine (131I) anti-tenascin monoclonal antibody 81C6 Treatment of glioma Biological Consulting Europe Ltd 30/10/2006
EU/3/06/419 Paclitaxel (liposomal) Treatment of pancreatic cancer MediGene AG 31/10/2006
EU/3/06/420 Temsirolimus Treatment of mantle cell lymphoma Pfizer Limited 6/11/2006 Torisel
EU/1/07/424/...
21/08/2009
EU/3/06/421 Forodesine hydrochloride Treatment of acute lymphoblastic leukaemia Napp Pharmaceuticals Research Limited 18/12/2006
EU/3/06/422 Paclitaxel (micellar) Treatment of ovarian cancer Oasmia Pharmaceutical AB 18/12/2006
EU/3/06/423 Tazarotene Treatment of congenital ichthyoses Orfagen 18/12/2006
EU/3/06/424 Thiotepa Conditioning treatment prior to haematopoietic progenitor cell transplantation Adienne S.r.l. 29/01/2007 Tepadina
EU/1/10/622/...
15/03/2010
EU/3/06/425 Complement factor H Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. 26/01/2007
EU/3/06/428 Forodesine hydrochloride Treatment of cutaneous T-cell lymphoma Napp Pharmaceuticals Research Limited 29/01/2007
EU/3/06/429 Recombinant modified vaccinia Ankara expressing human 5T4 Treatment of renal cell carcinoma Oxford Biomedica (UK) Ltd 26/01/2007
EU/3/07/430 artesunate Treatment of malaria Pharmaorigin ApS 20/02/2007
EU/3/07/431 Autologous dendritic cells pulsed with autologous tumour cell lysate Treatment of glioma Dorian Regulatory Affairs BV 15/02/2007
EU/3/07/432 Ex-vivo cultured adult human mesenchymal stem cells Treatment of Graft-versus-Host disease Genzyme Europe BV 20/02/2007
EU/3/07/433 HLA class I/II binding tumour associated peptides (ADF-APO-CCN-GUC-K67-MET- MMP-MUC-RGS) Treatment of renal cell carcinoma Immatics Biotechnologies GmbH 15/02/2007
EU/3/07/434 Idebenone Treatment of Leber's hereditary optic neuropathy Santhera Pharmaceuticals (Deutschland) GmbH 15/02/2007
EU/3/07/435 Recombinant human C1-inhibitor Prevention of delayed graft function after solid organ transplantation Pharming Group N.V. 20/02/2007
EU/3/07/437 Idebenone Treatment of Duchenne muscular dystrophy Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2007
EU/3/07/438 Zanolimumab Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Genmab A/S 20/03/2007
EU/3/07/440 Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene Treatment of congenital alpha-1 antitrypsin deficiency TMC Pharma Services Ltd. 20/03/2007
EU/3/07/441 Hydrocortisone (modified release tablet) Treatment of adrenal insufficiency Diurnal Limited 20/03/2007
EU/3/07/442 Enzastaurin hydrochloride Treatment of diffuse large B cell lymphoma Eli Lilly Nederland B.V. 20/03/2007
EU/3/07/443 Elafin Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Proteo Biotech AG 20/03/2007
EU/3/07/444 Pralatrexate Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Allos Therapeutics Limited 13/04/2007
EU/3/07/445 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Prevention of corneal graft rejection Gene Signal SAS 17/04/2007
EU/3/07/446 Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA Treatment of metachromatic leukodystrophy Fondazione Telethon 13/04/2007
EU/3/07/447 Nilotinib hydrochloride monohydrate Treatment of gastro intestinal stromal tumours Novartis Europharm Ltd 13/04/2007
EU/3/07/448 Talactoferrinum alfa Treatment of renal cell carcinoma Agennix Limited 5/06/2007
EU/3/07/450 5(S)-(2´-hydroxy ethoxy)-20(S)- camptothecin Treatment of osteosarcoma ClinTec International Ltd 8/06/2007
EU/3/07/451 Cisplatin (liposomal) Treatment of pancreatic cancer Regulon AE 8/06/2007
EU/3/07/452 R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H -1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea Treatment of gastric carcinoid Trio Medicines Ltd 14/06/2007
EU/3/07/453 Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 Treatment of haemophilia B (congenital factor IX deficiency) Biogen Idec Limited 8/06/2007
EU/3/07/455 Ciclosporin Prevention of corneal graft rejection Novagali Pharma SA 22/10/2007
EU/3/07/456 Rilonacept Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA) Regeneron UK Limited 10/07/2007 Rilonacept Regeneron
EU/1/09/582/...
23/10/2009
EU/3/07/458 fampridine Treatment of Guillain-Barré syndrome Dr Ulrich Granzer 10/07/2007
EU/3/07/459 1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride Treatment of narcolepsy Bioprojet 10/07/2007
EU/3/07/461 Human plasminogen Treatment of ligneous conjunctivitis Kedrion S.p.A. 3/08/2007
EU/3/07/462 Recombinant human soluble Fc-gamma receptor Iib Treatment of idiopathic thrombocytopenic purpura SuppreMol GmbH 2/08/2007
EU/3/07/463 Pyridoxalated haemoglobin polyoxyethylene Treatment of cardiogenic shock Curacyte AG 2/08/2007
EU/3/07/465 L-threo-3,4-dihydroxyphenylserine Treatment of orthostatic hypotension in patients with pure autonomic failure Diamond BioPharm Limited 2/08/2007
EU/3/07/466 L-threo-3,4-dihydroxyphenylserine Treatment of orthostatic hypotension in patients with multiple system atrophy Diamond BioPharm Limited 2/08/2007
EU/3/07/469 Ciprofloxacin (inhalation use) Treatment of cystic fibrosis Bayer Schering Pharma AG 3/08/2007
EU/3/07/470 Human heterologous liver cells (for infusion) Treatment of ornithine-transcarbamylase deficiency Cytonet GmbH & Co. KG 14/09/2007
EU/3/07/471 Human coagulation factor X Treatment of hereditary factor X deficiency Bio Products Laboratory 17/09/2007
EU/3/07/472 Cyclo{{(E,Z)-(2s,3r,4r)-3-Hydroxy-4-Methyl-2-(Methylamino)Nona-6,8-Dienoyl}-L-2-Aminobutyryl-N-Methyl-Glycyl-N-Methyl-L-Leucyl-L-Valyl-N-Methyl-L-Leucyl-L-Alanyl-D-Alanyl-N-Methyl-L-Leucyl-N-Methyl-L-Leucyl-N-Methyl-L-Valyl} Treatment of chronic non-infectious uveitis Lux Biosciences GmbH 14/09/2007
EU/3/07/473 Aviptadil Treatment of sarcoidosis mondoBIOTECH Laboratories Anstalt 14/09/2007
EU/3/07/474 Alpha-1 proteinase inhibitor (inhalation use) Treatment of cystic fibrosis CSL Behring GmbH 14/09/2007
EU/3/07/475 Alginate oligosaccharide (G-block) fragment Treatment of cystic fibrosis AlgiPharma AS 14/09/2007
EU/3/07/476 5´-O-(trans-9´´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine Treatment of acute myleoid leukaemia Clavis Pharma ASA 14/09/2007
EU/3/07/476 5´-O-(trans-9´´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine Treatment of acute myleoid leukaemia Clavis Pharma ASA 14/09/2007
EU/3/07/477 4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-ß-D-arabinofuranosyl]-2(1H)-pyrimidinone Treatment of hepatocellular carcinoma Interface International Consultancy Limited 14/09/2007
EU/3/07/478 N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Treatment of Hodgkin lymphoma CanReg (Europe) Limited 14/09/2007
EU/3/07/479 N-adamantanyl-N'-geranyl-ethylenediamine Treatment of tuberculosis RLM Consulting 14/09/2007
EU/3/07/480 Naptumomab estafenatox Treatment of renal cell carcinoma Active Biotech AB 14/09/2007
EU/3/07/481 R-salbutamol sulphate Treatment of cutaneous forms of lupus erythematosus Astion Pharma A/S 14/09/2007
EU/3/07/484 Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Treatment of Leber's congenital amaurosis Centre Hospitalier Universitaire de Nantes 22/10/2007
EU/3/07/485 Alvocidib Treatment of chronic lymphocytic leukaemia Sanofi Aventis 23/10/2007
EU/3/07/486 Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Treatment of retinitis pigmentosa Centre Hospitalier Universitaire de Nantes 14/11/2007
EU/3/07/487 4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol Treatment of chronic lymphocytic leukaemia BlackSwan Pharma GmbH 14/11/2007
EU/3/07/489 Ciclosporin Treatment of Herpes simplex virus stromal keratitis Novagali Pharma SA 29/10/2007
EU/3/07/490 Human autologous bone-forming cells derived from bone marrow stem cells Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 29/10/2007
EU/3/07/491 Interferon gamma Treatment of idiopathic pulmonary fibrosis Foundation For Fatal Rare Diseases 29/10/2007
EU/3/07/492 Iodine (131I) chlorotoxin Treatment of glioma Biological Consulting Europe Ltd 22/10/2007
EU/3/07/493 Isofagomine tartrate Treatment of Gaucher Disease Amicus Therapeutics UK Limited 23/10/2007
EU/3/07/494 Lenalidomide Treatment of chronic lymphocytic leukaemia Celgene Europe Limited 19/11/2007
EU/3/07/495 Methotrexate (oral liquid) Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 24/10/2007
EU/3/07/496 Mercaptopurine (oral liquid) Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 22/10/2007
EU/3/07/498 Polihexanide Treatment of Acanthamoeba keratitis S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. 14/11/2007
EU/3/07/499 Terguride Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Ergonex Licensing and Regulatory Services AG 29/11/2007
EU/3/07/500 Recombinant human rod-derived cone viability factor Treatment of retinitis pigmentosa Fovea Pharmaceuticals SA 29/11/2007
EU/3/07/501 Olaparib Treatment of ovarian cancer AstraZeneca AB 6/12/2007
EU/3/07/502 Picoplatin Treatment of small cell lung cancer Kendle International Ltd 6/12/2007
EU/3/07/503 Recombinant human hepatitis C monoclonal antibody against C4 region of E1 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 6/12/2007
EU/3/07/504 Irinotecan hydrochloride (drug eluting beads) Treatment of glioma CellMed AG 29/11/2007
EU/3/07/505 Interferon beta Treatment of acute lung injury Faron Pharmaceuticals Limited 29/11/2007
EU/3/07/506 Heterologous human adult liver derived stem cells Treatment of Crigler-Najjar syndrome Promethera Biosciences 29/11/2007
EU/3/07/507 Doxorubicin hydrochloride (drug eluting beads) Treatment of glioma CellMed AG 29/11/2007
EU/3/07/508 Chimeric-anti-interleukin-6 monoclonal antibody Treatment of Castleman’s disease Janssen Biologics B.V. 30/11/2007
EU/3/07/509 Azacitidine Treatment of acute myeloid leukaemia Celgene Europe Limited 29/11/2007 Vidaza
EU/1/08/488/...
17/12/2008
EU/3/07/510 artesunate Treatment of malaria Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 6/12/2007
EU/3/07/511 3-methoxy-pregnenolone Treatment of spinal cord injury MAPREG SAS 4/12/2007
EU/3/07/513 (S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine Treatment of tuberculosis Dr Ulrich Granzer 29/11/2007
EU/3/07/514 (1R, 2R)-Octanoic acid [2-(2’,3’-dihydro-benzo [1,4] dioxin-6’-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt Treatment of Gaucher Disease Genzyme Europe BV 4/12/2007
EU/3/07/516 Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 Treatment of acute myeloid leukaemia SymbioTec GmbH 20/12/2007
EU/3/07/517 N-[4-(3-amino-1H-indazol-4-yl)phenyl]-N´-(2-fluoro-5-methylphenyl) urea Treatment of hepatocellular carcinoma Abbott Laboratories Limited 20/12/2007
EU/3/07/518 Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension Bayer Schering Pharma AG 20/12/2007
EU/3/07/519 Maribavir Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk ViroPharma SPRL 18/12/2007
EU/3/07/520 Human papilloma virus type 16 E6/E7 synthetic long peptides Treatment of epithelial neoplasia of the vulva positive for human papilloma virus ISA Therapeutics B.V. 20/12/2007
EU/3/07/521 H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients Vaxon Biotech 18/12/2007
EU/3/07/522 (manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21°-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Celtic Bio-Pharma Services Ltd 31/01/2008
EU/3/07/523 Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide Treatment of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 31/01/2008
EU/3/07/524 (R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole Treatment of tuberculosis Otsuka Novel Products GmbH 1/02/2008
EU/3/07/525 Iodine (131I) iobenguane Treatment of neuroblastoma Molecular Insight Limited 31/01/2008
EU/3/07/526 N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Treatment of acute myeloid leukaemia CanReg (Europe) Limited 31/01/2008
EU/3/08/529 Tretazicar Treatment of visceral leishmaniasis Morvus Technology Limited 4/02/2008
EU/3/08/530 Heterologous human adult liver derived stem cells Treatment of ornithinine transcarbamylase deficiency Promethera Biosciences 4/02/2008
EU/3/08/531 ascorbic acid Treatment of Charcot-Marie-Tooth disease type 1A Murigenetics SAS 1/04/2008
EU/3/08/532 filgrastim Treatment of amyotrophic lateral sclerosis Sygnis Bioscience GmbH & Co. KG 1/04/2008
EU/3/08/533 Recombinant human monoclonal antibody against transforming growth factor beta-1, 2 and 3 Treatment of idiopathic pulmonary fibrosis Genzyme Europe BV 1/04/2008
EU/3/08/535 Humanised monoclonal antibody to the folate receptor alpha Treatment of ovarian cancer Eisai Europe Limited 1/04/2008
EU/3/08/536 Chimeric antibody to mesothelin Treatment of pancreatic cancer Eisai Europe Limited 17/03/2008
EU/3/08/538 Amrubicin hydrochloride Treatment of small cell lung cancer Celgene Europe Limited 2/04/2008
EU/3/08/539 Ammonium tetrathiomolybdate Treatment of Wilson´s disease JJGConsultancy Ltd 1/04/2008
EU/3/08/540 Omigapil maleate Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). Santhera Pharmaceuticals (Deutschland) GmbH 8/05/2008
EU/3/08/541 [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone Treatment of erythropoietic protoporphyria Clinuvel (UK) Limited 8/05/2008
EU/3/08/542 Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide Treatment of acute myeloid leukaemia Dr Ulrich Granzer 8/05/2008
EU/3/08/543 Sarsasapogenin Treatment of amyotrophic lateral sclerosis Phytopharm plc 8/05/2008
EU/3/08/544 Omigapil maleate Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency Santhera Pharmaceuticals (Deutschland) GmbH 8/05/2008
EU/3/08/545 [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone Treatment of congenital erythropoietic porphyria Clinuvel (UK) Limited 8/05/2008
EU/3/08/546 Alpha-1 proteinase inhibitor (inhalation use) Treatment of congenital alpha-1 antitrypsin deficiency Grifols Deutschland GmbH 3/06/2008
EU/3/08/548 Carfilzomib Treatment of multiple myeloma Nexus Oncology Ltd 3/06/2008
EU/3/08/549 NGR-human tumour necrosis factor Treatment of malignant mesothelioma MolMed S.p.A. 3/06/2008
EU/3/08/550 Nimotuzumab Treatment of pancreatic cancer Oncoscience AG 3/06/2008
EU/3/08/551 Pegylated recombinant factor VIIa Treatment of haemophilia A Novo Nordisk A/S 4/06/2008
EU/3/08/552 Pegylated recombinant factor VIIa Treatment of haemophilia B Novo Nordisk A/S 3/06/2008
EU/3/08/553 Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] Treatment of glioma Gregory Fryer Associates Ltd 3/06/2008
EU/3/08/554 Beraprost sodium (modified release tablet) Treatment of pulmonary arterial hypertension IDEA Innovative Drugs European Associates Limited 10/07/2008
EU/3/08/555 Vincristine sulphate liposomes Treatment of acute lymphoblastic leukaemia NDA Regulatory Science Ltd 8/07/2008
EU/3/08/556 N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide Treatment of cystic fibrosis Vertex Pharmaceuticals (U.K.) Limited 8/07/2008
EU/3/08/557 Sapacitabine Treatment of myelodysplastic syndromes Cyclacel Limited 8/07/2008
EU/3/08/558 Sapacitabine Treatment of acute myeloid leukaemia Cyclacel Limited 10/07/2008
EU/3/08/559 bosentan Treatment of idiopathic pulmonary fibrosis Actelion Registration Limited 5/09/2008
EU/3/08/560 (-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate Treatment of moderate and severe closed traumatic brain injury KeyNeurotek Pharmaceuticals AG 5/09/2008
EU/3/08/561 Donor lymphocyte preparation depleted of functional alloreactive T-cells Prevention of Graft-versus-Host disease Kiadis Pharma Netherlands B.V. 5/09/2008
EU/3/08/562 Topotecan hydrochloride (liposomal) Treatment of glioma Dr Matthias Luz 5/09/2008
EU/3/08/563 Recombinant derivative of C3 transferase Treatment of traumatic spinal cord injury Triskel EU Services 5/09/2008
EU/3/08/564 Avian polyclonal IgY antibody against Pseudomonas aeruginosa Treatment of cystic fibrosis Immunsystem I.M.S. AB 23/09/2008
EU/3/08/565 Drotrecogin alfa (activated) Treatment of acute respiratory distress syndrome Drugrecure Aps 22/09/2008
EU/3/08/566 Levofloxacin hemihydrate Treatment of cystic fibrosis Mpex London Ltd 23/09/2008
EU/3/08/567 Miltefosine Treatment of cutaneous T-cell lymphoma ExperGen Drug Development GmbH 22/09/2008
EU/3/08/568 N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide Treatment of partial deep dermal and full thickness burn wounds Creative Antibiotics Sweden AB 22/09/2008
EU/3/08/569 Pegylated L-asparaginase Treatment of acute lymphoblastic leukaemia Enzon (UK) Limited 22/09/2008
EU/3/08/570 Recombinant human CXCL8 mutant Prevention of delayed graft function after solid organ transplantation ProtAffin Biotechnologie AG 22/09/2008
EU/3/08/571 Recombinant human minibody against complement component C5 Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system Adienne S.r.l. 22/09/2008
EU/3/08/572 (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate Treatment of chronic idiopathic myelofibrosis Incyte Corporation Ltd 7/11/2008
EU/3/08/573 Adeno-associated viral vector containing the human alpha-sarcoglycan gene Treatment of alpha-sarcoglycanopathy Généthon 7/11/2008
EU/3/08/575 vildagliptin Treatment of isovaleric acidaemia Orphan Europe SARL 7/11/2008
EU/3/08/576 Carglumic acid Treatment of methylmalonic acidaemia Orphan Europe SARL 7/11/2008
EU/3/08/577 Carglumic acid Treatment of propionic acidaemia Orphan Europe SARL 7/11/2008
EU/3/08/578 Cysteamine hydrochloride Treatment of cystinosis Orphan Europe SARL 7/11/2008
EU/3/08/579 Ex-vivo expanded autologous human corneal epithelium containing stem cells Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns
Chiesi Farmaceutici S.P.A. 7/11/2008
EU/3/08/580 Filgrastim Treatment of spinal cord injury Sygnis Bioscience GmbH & Co. KG 7/11/2008
EU/3/08/581 Ofatumumab Treatment of chronic lymphocytic leukaemia Glaxo Group Limited 7/11/2008 Arzerra
EU/1/10/625/...
19/04/2010
EU/3/08/582 Recombinant human heparan N-sulfatase Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) Shire Pharmaceutical Development Limited 7/11/2008
EU/3/08/583 Gadodiamide (liposomal) Treatment of glioma Dr Matthias Luz 3/12/2008
EU/3/08/584 Palifosfamide Treatment of soft tissue sarcoma Ziopharm Oncology Limited 3/12/2008
EU/3/08/585 Daunorubicin (liposomal) Treatment of acute myeloid leukaemia Diatos S. A. 3/12/2008
EU/3/08/586 RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´[2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 3/12/2008
EU/3/08/587 Cenersen Treatment of chronic lymphocytic leukaemia EleosInc Limited 3/12/2008
EU/3/08/588 Recombinant human ADAMTS-13 Treatment of thrombotic thrombocytopenic purpura Baxter AG 3/12/2008
EU/3/08/589 Yttrium (90Y) edotreotide Treatment of gastro-entero-pancreatic neuroendocrine tumours Molecular Insight Limited 4/12/2008
EU/3/08/590 2-[[3-({4-[(5-{2-[(3-Fluorophenyl)amino]-2-oxoethyl}-1H-pyrazol-3-yl)amino]-quinazolin-7-yl}oxy)propyl](ethyl)amino]ethyl dihydrogen phosphate trihydrate Treatment of acute myeloid leukaemia AstraZeneca AB 5/12/2008
EU/3/08/591 5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole Treatment of Duchenne muscular dystrophy Summit (Oxford) Limited 4/12/2008
EU/3/08/592 Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 Treatment of hairy cell leukaemia MEDIMMUNE Limited 4/12/2008
EU/3/08/593 N2´-Deacetyl-N2´-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody Treatment of multiple myeloma Biotest AG 3/12/2008
EU/3/08/594 Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein Treatment of hypophosphatasia Dr Ulrich Granzer 3/12/2008
EU/3/08/595 Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E Treatment of anaplastic large cell lymphoma Seattle Genetics UK Limited 15/01/2009
EU/3/08/596 Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E Treatment of Hodgkin lymphoma Seattle Genetics UK Limited 15/01/2009
EU/3/08/597 2,3,4,5 tetrahydro-2,8-dimethyl-5-[2-(6-methyl-3-pyridyl)ethyl]-1H-pyrido[4,3-b]indole dihydrochloride Treatment of Huntington´s disease Innovative Drug European Associates (I.D.E.A.) Limited 20/01/2009
EU/3/08/598 Exon 44 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 27/02/2009
EU/3/08/599 Exon 51 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy Glaxo Group Ltd 27/02/2009
EU/3/08/600 Human anti-intercellular adhesion molecule1 monoclonal antibody Treatment of multiple myeloma BioInvent International AB 20/01/2009
EU/3/08/601 Milatuzumab Treatment of multiple myeloma Immunomedics GmbH 19/01/2009
EU/3/08/602 Milatuzumab Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 19/01/2009
EU/3/08/603 Pralatrexate Treatment of non-papillary transitional cell carcinoma of the urinary bladder Allos Therapeutics Limited 19/01/2009
EU/3/08/604 Recombinant Human minibody against complement component C5 fused with RGD-motif Prevention of the ischemia/reperfusion injury associated with solid organ transplantation ADIENNE S.r.l. 20/01/2009
EU/3/08/605 Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class Treatment of spinal cord injury Novartis Europharm Ltd 19/01/2009
EU/3/08/607 Type I native bovine skin collagen Treatment of systemic sclerosis arGentis Autoimmune Europe Limited 9/02/2009
EU/3/08/608 Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 Treatment of pancreatic cancer Immunomedics GmbH 6/02/2009
EU/3/08/609 Adeno-associated viral vector serotype 5 containing the human ABCA4 gene Treatment of Stargardt’s disease Fondazione Telethon 6/02/2009
EU/3/08/610 Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt Treatment of medullary thyroid carcinoma TMC Pharma Services Ltd 6/02/2009
EU/3/08/611 Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein Treatment of acute liver failure Alfact Innovation SAS 11/02/2009
EU/3/08/612 Recombinant human proinsulin Treatment of retinitis pigmentosa ProRetina Therapeutics, S.L. 11/02/2009
EU/3/09/613 Tobramycin (inhalation use) Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis PARI Pharma GmbH 27/02/2009
EU/3/09/614 Mifepristone Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin EXELGYN 27/02/2009
EU/3/09/615 N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) Dr Ulrich Granzer 27/02/2009
EU/3/09/616 (6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride monohydrate Treatment of amyotrophic lateral sclerosis Biogen Idec Limited 27/02/2009
EU/3/09/617 2,2-dimethylbutyric acid, sodium salt Treatment of beta-thalassaemia intermedia and major   Isabelle Ramirez 27/02/2009
EU/3/09/618 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of acute lymphoblastic leukaemia TEVA Pharma GmbH 27/02/2009
EU/3/09/619 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of acute myeloid leukaemia TEVA Pharma GmbH 27/02/2009
EU/3/09/620 (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate Treatment of myelofibrosis secondary to polycythemia vera or essential thrombocythemia Incyte Corporation Ltd 3/04/2009
EU/3/09/621 2,2-dimethylbutyric acid, sodium salt Treatment of sickle cell disease Isabelle Ramirez 18/03/2009
EU/3/09/622 N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt Treatment of acute myeloid leukaemia Ambit Europe Limited 23/03/2009
EU/3/09/623 Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene Treatment of beta-thalassaemia intermedia and major   EGT San Rocco Italia SRL 29/04/2009
EU/3/09/624 Autologous tumour-derived gp96 heat shock protein-peptide complex Treatment of glioma Antigenics Therapeutics Limited 29/04/2009
EU/3/09/625 Guanabenz Treatment of traumatic spinal cord injury Acure Pharma AB 29/04/2009
EU/3/09/628 Mercaptopurine (oral suspension) Treatment of acute lymphoblastic leukaemia Nova Laboratories Limited 30/04/2009 Mercaptopurine Nova Laboratories
EU/1/11/727/...
9/03/2012
EU/3/09/629 Nanobody directed towards the human A1 domain of von Willebrand factor Treatment of thrombotic thrombocytopenic purpura Ablynx NV 30/04/2009
EU/3/09/630 Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector Treatment of dystrophic epidermolysis bullosa Prof. Alain Hovnanian 30/04/2009
EU/3/09/632 Adeno-associated viral vector containing porphobilinogen deaminase gene Treatment of acute intermittent porphyria Amsterdam Molecular Therapeutics BV 29/04/2009
EU/3/09/633 L-asparaginase encapsulated in erythrocytes Treatment of pancreatic cancer Erytech Pharma SA 15/05/2009
EU/3/09/634 S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK Treatment of pancreatic cancer MBiotec GmbH 15/05/2009
EU/3/09/635 Treprostinil diethanolamine Treatment of systemic sclerosis United Therapeutics Europe Ltd 15/05/2009
EU/3/09/636 Dexamethasone phosphate (iontophoretic solution, ocular use) Treatment of corneal graft rejection
Interface International Consultancy Ltd 15/05/2009
EU/3/09/637 2',3',5'-tri-O-acetyluridine Treatment of 5-fluorouracil overdose Wellstat Therapeutics EU Limited 15/05/2009
EU/3/09/638 Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation Opsona Therapeutics 15/05/2009
EU/3/09/639 4,6,8-trihydroxy-10-(3,7,11-trimethyldodeca-2,6,10-trienyl)-5,10-dihydrodibenzo[b,e][1,4]diazepin-11-one Treatment of glioma Albany Regulatory Consulting Limited 15/05/2009
EU/3/09/640 Pegylated recombinant human factor IX Treatment of haemophilia B Novo Nordisk A/S 15/05/2009
EU/3/09/641 Alicaforsen Treatment of pouchitis Atlantic Healthcare Limited 15/05/2009
EU/3/09/642 Chimeric-anti-interleukin-6 monoclonal antibody Treatment of multiple myeloma Janssen Biologics B.V. 12/06/2009
EU/3/09/643 Desipramine hydrochloride Treatment of Rett syndrome Targeon SAS 12/06/2009
EU/3/09/645 Octreotide chloride (lipid depot solution) Treatment of acromegaly Camurus AB 12/06/2009
EU/3/09/647 (S)-3´-(OH)-desazadesferrithiocin-polyether, magnesium salt Treatment of chronic iron overload requiring chelation therapy FerroKin BioSciences Ltd 24/07/2009
EU/3/09/648 Afamelanotide Treatment of solar urticaria Clinuvel UK Limited 24/07/2009
EU/3/09/649 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of Hodgkin lymphoma TEVA Pharma GmbH 24/07/2009
EU/3/09/650 Blinatumomab Treatment of acute lymphoblastic leukaemia Micromet GmbH 24/07/2009
EU/3/09/651 Ciclosporin (eye drops, solution) Treatment of atopic keratoconjunctivitis Allergan Pharmaceuticals Ireland 24/07/2009
EU/3/09/652 Ciprofloxacin (liposomal) Treatment of cystic fibrosis Interface International Consultancy Ltd 24/07/2009
EU/3/09/653 Eculizumab Treatment of atypical haemolytic uremic syndrome Alexion Europe SAS 24/07/2009
EU/3/09/654 Hypothiocyanite / lactoferrin Treatment of cystic fibrosis Alaxia 24/07/2009
EU/3/09/655 Octocog alpha (liposomal) Treatment of haemophilia A Bayer Schering Pharma AG 24/07/2009
EU/3/09/656 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of diffuse large B-cell lymphoma CellGenix GmbH 24/07/2009
EU/3/09/657 Recombinant human N-acetylgalactosamine-6-sulfatase Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) BioMarin Europe Limited 24/07/2009
EU/3/09/658 Tamibarotene Treatment of acute promyelocytic leukaemia Eudax S.R.L. 24/07/2009
EU/3/09/659 Tosedostat Treatment of acute myeloid leukaemia Chroma Therapeutics Ltd 24/07/2009
EU/3/09/660 Trabedersen Treatment of pancreatic cancer Antisense Pharma GmbH 24/07/2009
EU/3/09/661 (S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate Treatment of carcinoid tumours Lexicon Celtic Limited 8/10/2009
EU/3/09/663 Adeno-associated viral vector containing modified U1 snRNA Treatment of Duchenne muscular dystrophy Amsterdam Molecular Therapeutics (AMT) B.V. 8/10/2009
EU/3/09/664 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of myelodysplastic syndromes TEVA Pharma GmbH 8/10/2009
EU/3/09/665 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of chronic myeloid leukaemia TEVA Pharma GmbH 8/10/2009
EU/3/09/666 Eicosapentaenoic acid Treatment of familial adenomatous polyposis S.L.A. Pharma (UK) Ltd 8/10/2009
EU/3/09/667 Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue Treatment of anal fistula Cellerix S.A. 8/10/2009
EU/3/09/669 Low molecular weight dextran sulfate Prevention of graft rejection during pancreatic islet transplantation TikoMed AB 9/10/2009
EU/3/09/670 pasireotide Treatment of acromegaly Novartis Europharm Ltd 8/10/2009
EU/3/09/671 pasireotide Treatment of Cushing's disease Novartis Europharm Ltd 8/10/2009 Signifor
EU/1/12/753/...
24/04/2012
EU/3/09/672 Pomalidomide Treatment of multiple myeloma Celgene Europe Limited 8/10/2009
EU/3/09/673 Recombinant antibody construct against human CD30 and CD16A Treatment of Hodgkin lymphoma Affimed Therapeutics AG 9/10/2009
EU/3/09/674 Recombinant human serum amyloid P Prevention of scarring post glaucoma filtration surgery Appletree Europe S.à.r.l. 9/10/2009
EU/3/09/675 Sequence-modified recombinant human factor VIIa Treatment of haemophilia A Bayer Schering Pharma AG 9/10/2009
EU/3/09/676 Sequence-modified recombinant human factor VIIa Treatment of haemophilia B Bayer Schering Pharma AG 8/10/2009
EU/3/09/677 Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys Treatment of acute lung injury Apeptico Forschung und Entwicklung GmbH 8/10/2009
EU/3/09/679 4-benzyl-2-naphtalen-1-yl-1,2,4-thiadiazolidine-3,5-dione Treatment of progressive supranuclear palsy NOSCIRA, S.A. 28/10/2009
EU/3/09/680 5'-O-(trans-9''-octadecenoyl)-1-beta-D-2'-deoxy-2',2'-difluorocytidine Treatment of pancreatic cancer Clovis Oncology UK Limited 28/10/2009
EU/3/09/681 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide Treatment of Huntington´s disease Siena Biotech SpA 28/10/2009
EU/3/09/683 Cholic acid Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid FGK Representative Service GmbH 28/10/2009
EU/3/09/684 Masitinib mesilate Treatment of pancreatic cancer AB Science 28/10/2009
EU/3/09/685 N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride Treatment of pancreatic cancer Merck KGaA 9/11/2009
EU/3/09/686 NGR-human tumour necrosis factor Treatment of hepatocellular carcinoma MolMed S.p.A. 9/11/2009
EU/3/09/689 Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis Treatment of myasthenia gravis CuraVac Europe SPRL 9/11/2009
EU/3/09/690 Human anthrax immunoglobulin Post-exposure prophylaxis of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 9/11/2009
EU/3/09/691 Human anthrax immunoglobulin Treatment of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 5/11/2009
EU/3/09/692 16-base single-stranded PNA oligonucleotide linked to a 7-aminoacid peptide Treatment of neuroblastoma Biogenera srl 25/11/2009
EU/3/09/693 1-Cyclopropyl-3-[3-(5-morpholin-4-ylmethyl-1H-benzoimidazol-2-yl)-1H-pyrazol-4-yl]-urea Treatment of acute myeloid leukaemia Astex Therapeutics Limited 26/11/2009
EU/3/09/694 6-thioguanine (oral liquid) Treatment of acute lymphoblastic leukaemia Only For Children Pharmaceuticals 26/11/2009
EU/3/09/695 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-1,2,4-triazolo[3,4-f][1,6]naphthyridin-3(2H)-one mono-hydrochloride Treatment of ovarian cancer Merck Sharp & Dohme Limited 30/11/2009
EU/3/09/696 Human MHC non-restricted cytotoxic T-cell line Treatment of ovarian cancer Abiogen Pharma S.p.A. 30/11/2009
EU/3/09/697 N-[6-(cis-2,6-dimethylmorpholin-4-yl)pyridine-3-yl]-2-methyl-4'-(trifluoromethoxy)[1,1'-biphenyl]-3-carboxamide Treatment of naevoid basal cell carcinoma syndrome (Gorlin syndrome) Novartis Europharm Limited 25/11/2009
EU/3/09/698 Pegylated carboxyhaemoglobin Treatment of sickle cell disease Voisin Consulting S.A.R.L. 26/11/2009
EU/3/09/699 Recombinant chimeric monoclonal antibody against CD20 Treatment of chronic lymphocytic leukaemia LFB-Biotechnologies 26/11/2009
EU/3/09/700 Vaccinia GM-CSF/TK-deactivated virus Treatment of hepatocellular carcinoma Transgene S.A. 26/11/2009
EU/3/09/701 2-iminobiotin Treatment of perinatal asphyxia Neurophyxia B.V. 28/01/2010
EU/3/09/702 Beta-artemether / lumefantrine (powder for oral suspension) Treatment of malaria Dafra Pharma International NV 28/01/2010
EU/3/09/703 Brivudine Treatment of pancreatic cancer RESprotect GmbH 28/01/2010
EU/3/09/704 Givinostat Treatment of systemic-onset juvenile idiopathic arthritis Italfarmaco S.p.A 28/01/2010
EU/3/09/705 Human monoclonal antibody against Pseudomonas aeruginosa IATS-O1 Treatment of pneumonia caused by serotype O1 Pseudomonas aeruginosa Envestia Limited 28/01/2010
EU/3/09/706 Lithium citrate tetrahydrate (in reverse-micelle formulation) Treatment of Huntington´s disease Medesis Pharma 28/01/2010
EU/3/09/707 Macitentan Treatment of idiopathic pulmonary fibrosis Actelion Registration Limited 28/01/2010
EU/3/09/708 Pegylated recombinant phenylalanine ammonia lyase Treatment of hyperphenylalaninaemia BioMarin Europe Ltd 28/01/2010
EU/3/09/709 Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule Treatment of glioma Apogenix GmbH 28/01/2010
EU/3/09/710 Recombinant human elafin Treatment of oesophagus carcinoma Proteo Biotech AG 28/01/2010
EU/3/09/711 Recombinant human vascular endothelial growth factor Treatment of amyotrophic lateral sclerosis NeuroNova AB 29/01/2010
EU/3/09/712 Recombinant kallikrein inhibitor Treatment of Netherton syndrome Dermadis S.A.S. 29/01/2010
EU/3/09/713 Veltuzumab Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 29/01/2010
EU/3/09/715 Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] Treatment of acute lymphoblastic leukaemia ARIAD Pharma Ltd 2/02/2010
EU/3/09/716 Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] Treatment of chronic myeloid leukaemia ARIAD Pharma Ltd 2/02/2010
EU/3/09/717 Ecopipam Treatment of Lesch-Nyhan disease Dr Alain Munoz 3/02/2010
EU/3/09/718 Fingolimod Treatment of chronic inflammatory demyelinating polyneuropathy Novartis Europharm Ltd 2/02/2010
EU/3/09/719 Givinostat Treatment of polycythaemia vera Italfarmaco S.p.A 3/02/2010
EU/3/09/720 Lentiviral vector containing the human ABCA4 gene Treatment of Stargardt´s disease Oxford Biomedica (UK) Ltd 2/02/2010
EU/3/09/723 Recombinant fusion protein linking human coagulation factor IX with human albumin Treatment of haemophilia B CSL Behring GmbH 4/02/2010
EU/3/09/724 Recombinant human monoclonal antibody to human interleukin (IL)-17A of the IgG1/k class Treatment of chronic non-infectious uveitis Novartis Europharm Ltd 2/02/2010
EU/3/09/725 RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´[2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 2/02/2010
EU/3/10/726 Taliglucerase alfa Treatment of Gaucher Disease Protalix B.V 23/03/2010
EU/3/10/727 Lentiviral vector containing the human MYO7A gene Treatment of retinitis pigmentosa in Usher syndrome 1B Oxford Biomedica (UK) Ltd 23/03/2010
EU/3/10/728 Davunetide Treatment of progressive supranuclear palsy FGK Representative Service GmbH 23/03/2010
EU/3/10/730 Raloxifene hydrochloride Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 10/06/2010
EU/3/10/731 Bafetinib Treatment of chronic myeloid leukaemia Eudax Srl 10/06/2010
EU/3/10/732 Entinostat Treatment of Hodgkin's lymphoma Nexus Oncology Ltd. 10/06/2010
EU/3/10/733 Glyceryl tri-(4-phenylbutyrate) Treatment of carbamoyl-phosphate synthase-1 deficiency Hyperion Therapeutics Limited 10/06/2010
EU/3/10/734 Glyceryl tri-(4-phenylbutyrate) Treatment of ornithine carbamoyltransferase deficiency Hyperion Therapeutics Limited 10/06/2010
EU/3/10/735 Glyceryl tri-(4-phenylbutyrate) Treatment of citrullinaemia type 1 Hyperion Therapeutics Limited 10/06/2010
EU/3/10/736 Glyceryl tri-(4-phenylbutyrate) Treatment of argininosuccinic aciduria Hyperion Therapeutics Limited 10/06/2010
EU/3/10/737 Glyceryl tri-(4-phenylbutyrate) Treatment of hyperargininaemia Hyperion Therapeutics Limited 10/06/2010
EU/3/10/738 Glyceryl tri-(4-phenylbutyrate) Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Hyperion Therapeutics Limited 10/06/2010
EU/3/10/739 Glyceryl tri-(4-phenylbutyrate) Treatment of citrullinaemia type 2 Hyperion Therapeutics Limited 10/06/2010
EU/3/10/740 Perifosine Treatment of multiple myeloma Æterna Zentaris GmbH 10/06/2010
EU/3/10/741 Pralatrexate Treatment of cutaneous T-cell lymphoma Choice Pharma Limited 10/06/2010
EU/3/10/742 2-methoxymethyl-2-hydroxymethyl-1-azabicyclo[2,2,2]octan-3-one Treatment of acute myeloid leukaemia Aprea AB 10/06/2010
EU/3/10/744 Adrenomedullin Treatment of acute lung injury Mondobiotech Laboratories AG 9/06/2010
EU/3/10/745 Dexamethasone (40 mg tablet) Treatment of multiple myeloma Laboratoires CTRS (Cell Therapies Research & Services) 9/06/2010
EU/3/10/746 Maytansinoid-conjugated humanised monoclonal antibody against CD56 Treatment of Merkel cell carcinoma ImmunoGen Europe Limited 9/06/2010
EU/3/10/747 N-{2-Chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N´-(5-methyl-3-isoxazolyl) urea hydrochloride monohydrate Treatment of renal cell carcinoma Aveo Pharma Ltd 9/06/2010
EU/3/10/748 Pravastatin / zoledronic acid Treatment of Hutchinson-Gilford progeria Prenyl BIO SAS 9/06/2010
EU/3/10/749 Recombinant human anti-interferon gamma monoclonal antibody Treatment of haemophagocytic lymphohistiocytosis NovImmune B.V. 9/06/2010
EU/3/10/750 Rifapentine Treatment of tuberculosis Sanofi Aventis 9/06/2010
EU/3/10/751 Synthetic double-stranded siRNA oligonucleotide directed against p53 mRNA Prevention of delayed graft function after renal transplantation Verius Limited 9/06/2010
EU/3/10/752 Velaglucerase alfa Treatment of Gaucher disease Shire Pharmaceuticals Ireland Limited 9/06/2010 VPRIV
EU/1/10/646/...
26/08/2010
EU/3/10/753 6alpha-ethyl-chenodeoxycholic acid Treatment of primary biliary cirrhosis Intercept Pharma 27/07/2010
EU/3/10/754 Heparin-activated recombinant human fibroblast growth factor 1 (on a biodegradable device made from alpha-calcium sulphate hemihydrate) Treatment of traumatic spinal cord injury BioArctic Neuroscience AB 27/07/2010
EU/3/10/755 Octenidine dihydrochloride Prevention of late-onset sepsis in premature infants of less than or equal to 32 weeks of gestational age Schülke & Mayr GmbH 27/07/2010
EU/3/10/756 Tranilast Prevention of scarring post glaucoma filtration surgery Altacor Ltd 27/07/2010
EU/3/10/757 Pomalidomide Treatment of primary myelofibrosis Celgene Europe Limited 27/07/2010
EU/3/10/758 Pomalidomide Treatment of post-polycythaemia vera myelofibrosis Celgene Europe Limited 27/07/2010
EU/3/10/759 Pomalidomide Treatment of post-essential thrombocythaemia myelofibrosis Celgene Europe Limited 27/07/2010
EU/3/10/760 (3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt Treatment of ovarian cancer Merck Sharp & Dohme Limited 4/08/2010
EU/3/10/761 3-(6-(1-(2,2-difluorobenzo [d] [1,3] dioxol-5-yl)cyclopropanecarboxamido)-3-methylpyridin-2-yl)benzoic acid Treatment of cystic fibrosis Voisin Consulting SARL 4/08/2010
EU/3/10/762 Bosutinib Treatment of chronic myeloid leukaemia Pfizer Limited 4/08/2010
EU/3/10/764 Everolimus Treatment of tuberous sclerosis Novartis Europharm Ltd 4/08/2010 Votubia
EU/1/11/710/...
2/09/2011
EU/3/10/765 Midostaurin Treatment of mastocytosis Novartis Europharm Ltd 4/08/2010
EU/3/10/766 Pyr-His-Trp-Ser-Tyr-D-Lys(doxorubicinylglutarate)-Leu-Arg-Pro-Gly-NH2, acetate salt Treatment of ovarian cancer Æterna Zentaris GmbH 4/08/2010
EU/3/10/767 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene Treatment of post-essential thrombocythaemia myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
EU/3/10/768 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene Treatment of primary myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
EU/3/10/769 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene Treatment of post-polycythaemia vera myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
EU/3/10/770 1-[2-(Benzo[1,2,5]thiadiazol-5-ylamino)-6-(2,6-dichloro-phenyl)-pyrido[2,3-d]pyrimidin-7-yl]-3-tert-butyl-urea Treatment of acute myeloid leukaemia Sanofi Aventis 20/09/2010
EU/3/10/771 Abarelix Treatment of low-flow priapism Speciality European Pharma Ltd 20/09/2010
EU/3/10/772 Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) SANFILIPPO Therapeutics SAS 20/09/2010
EU/3/10/773 Allogeneic T cells encoding an exogenous TK gene Treatment of acute myeloid leukaemia LTKFarma 20/09/2010
EU/3/10/774 Allogeneic human dermal fibroblasts Treatment of epidermolysis bullosa Intercytex Ltd 20/09/2010
EU/3/10/775 Autologous bone marrow-derived mononuclear cell fraction Treatment of thromboangiitis obliterans (Buerger's disease) t2cure GmbH 20/09/2010
EU/3/10/776 Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose Treatment of ovarian cancer Prima Biomed GmbH 20/09/2010
EU/3/10/777 Cyclic pyranopterin monophosphate Treatment of molybdenum cofactor deficiency type A Orphatec Pharmaceuticals GmbH 20/09/2010
EU/3/10/778 Cysteamine bitartrate (gastroresistant) Treatment of cystinosis Raptor Pharmaceuticals Europe BV 20/09/2010
EU/3/10/779 Eflornithine Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 20/09/2010
EU/3/10/780 Forodesine Treatment of chronic lymphocytic leukaemia Mundipharma Research Limited 20/09/2010
EU/3/10/781 Glutathione-pegylated liposomal doxorubicin hydrochloride Treatment of glioma to-BBB Technologies BV 20/09/2010
EU/3/10/782 Nafamostat mesilate Treatment of cystic fibrosis Mucokinetica Ltd 20/09/2010
EU/3/10/783 Recombinant fusion protein consisting of human coagulation factor VIII attached to the Fc domain of human IgG1 Treatment of haemophilia A Biogen Idec Limited 20/09/2010
EU/3/10/784 Recombinant porcine factor VIII (B domain deleted) Treatment of haemophilia A Inspiration Biopharmaceuticals EU Limited 20/09/2010
EU/3/10/785 Vorinostat Treatment of malignant mesothelioma Merck Sharp & Dohme Limited 20/09/2010
EU/3/10/786 Heat-killed Mycobacterium vaccae (whole cell) Treatment of tuberculosis Immodulon Therapeutics Ltd 20/09/2010
EU/3/10/787 (3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt Treatment of mantle cell lymphoma Merck Sharp & Dohme Limited 1/10/2010
EU/3/10/788 (S)-10-[(dimethylamino)methyl]-4-ethyl-9-hydroxy-4-O-[alpha-(2´´, 4´´, 5´´, 7´´-tetranitro-9´´-fluorenylideneaminooxy)propionyl]-1H-pyrano[3´, 4´, 6´, 7´]indolizino[1,2-beta]-quinoline-3, 14-(4H), 12H)-dione, hydrochloride Treatment of hepatocellular carcinoma TLC Biopharmaceuticals B.V. 1/10/2010
EU/3/10/789 16-base single-stranded peptide nucleic acid oligonucleotide linked to a 7-amino acid peptide Treatment of medulloblastoma Biogenera srl 1/10/2010
EU/3/10/791 Ciclosporin Treatment of moderate and severe closed traumatic brain injury NeuroVive Pharmaceutical AB 1/10/2010
EU/3/10/792 Maytansinoid-conjugated humanised monoclonal antibody against CD56 Treatment of small cell lung cancer ImmunoGen Europe Limited 1/10/2010
EU/3/10/793 N-(6-(2-aminophenylamino)-6-oxohexyl)-4-methylbenzamide Treatment of Friedreich's ataxia Repligen Europe Limited 1/10/2010
EU/3/10/794 N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate Treatment of primary myelofibrosis Sanofi Aventis 1/10/2010
EU/3/10/795 Pralatrexate Treatment of Hodgkin's lymphoma Allos Therapeutics Limited 1/10/2010
EU/3/10/796 Recombinant humanised anti-human interleukin-1 beta monoclonal antibody Treatment of Behçet's disease Les Laboratoires Servier 1/10/2010
EU/3/10/797 Recombinant humanised monoclonal antibody to human Nogo-A protein of the IgG1/kappa class Treatment of amyotrophic lateral sclerosis Glaxo Group Limited 1/10/2010
EU/3/10/798 Synthetic double-stranded short interfering RNA oligonucleotide directed against proopiomelanocortin Treatment of adrenocorticotropin-dependent Cushing´s syndrome UKR Regulatory Affairs Ltd 1/10/2010
EU/3/10/799 Tecovirimat Treatment of cowpox infection SIGA Pharmaceuticals (Europe) Ltd 1/10/2010
EU/3/10/802 2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione Treatment of idiopathic pulmonary fibrosis GenKyoTex Innovation S.A.S 26/11/2010
EU/3/10/803 Chimeric monoclonal antibody against claudin-18 splice variant 2 Treatment of gastric cancer GANYMED Pharmaceuticals AG 26/11/2010
EU/3/10/804 Methylthioninium Treatment of progressive supranuclear palsy Prof. Claude Wischik 26/11/2010
EU/3/10/805 Methylthioninium Treatment of behavioural variant frontotemporal dementia Prof. Claude Wischik 26/11/2010
EU/3/10/806 Methylthioninium Treatment of progressive non-fluent aphasia Prof. Claude Wischik 26/11/2010
EU/3/10/807 Methylthioninium Treatment of frontotemporal dementia with parkinsonism-17 Prof. Claude Wischik 26/11/2010
EU/3/10/808 Murine monoclonal antibody against CD26 Treatment of graft-versus-host disease ADIENNE S.r.l. 26/11/2010
EU/3/10/809 Nanoparticle albumin-bound paclitaxel Treatment of pancreatic cancer Celgene Europe Limited 26/11/2010
EU/3/10/810 N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate Treatment of post-essential thrombocythaemia myelofibrosis Sanofi Aventis 26/11/2010
EU/3/10/811 N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate Treatment of post-polycythaemia vera myelofibrosis Sanofi Aventis 26/11/2010
EU/3/10/812 Recombinant fusion protein consisting of the extracellular portion of human activin receptor IIB linked to the human IgG1 Fc domain Treatment of Duchenne muscular dystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
EU/3/10/813 Recombinant human arylsulfatase A Treatment of metachromatic leukodystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
EU/3/10/814 Recombinant human von Willebrand factor Treatment of von Willebrand disease Baxter Innovations GmbH 26/11/2010
EU/3/10/815 Sildenafil citrate Treatment of postcardiotomy right ventricular failure Pfizer Limited 26/11/2010
EU/3/10/816 7-beta-hydroxycholesteryl-3-beta-oleate Treatment of glioma Intsel Chimos SA 17/12/2010
EU/3/10/817 Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene Treatment of rhodopsin-linked retinitis pigmentosa Genable Technologies Ltd 17/12/2010
EU/3/10/818 Human heterologous liver cells (for infusion) Treatment of citrullinaemia type 1 Cytonet GmbH & Co. KG 17/12/2010
EU/3/10/819 Human heterologous liver cells (for infusion) Treatment of hyperargininaemia Cytonet GmbH & Co. KG 17/12/2010
EU/3/10/820 Human heterologous liver cells (for infusion) Treatment of argininosuccinic aciduria Cytonet GmbH & Co. KG 17/12/2010
EU/3/10/821 Human heterologous liver cells (for infusion) Treatment of carbamoyl-phosphate synthase-1 deficiency Cytonet GmbH & Co. KG 17/12/2010
EU/3/10/822 Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene Treatment of Fanconi anaemia type A Center for Biomedical Network Research on Rare Diseases (CIBERER) 17/12/2010
EU/3/10/823 Lomitapide Treatment of familial chylomicronaemia Aegerion Pharmaceuticals 17/12/2010
EU/3/10/824 N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl) amino] isonicotinamide hydrochloride Treatment of acute myeloid leukaemia Merck KGaA 17/12/2010
EU/3/10/825 Ovine anti-colchicine polyclonal antibody fragments Treatment of colchicine poisoning Laboratoires SERB 17/12/2010
EU/3/10/826 Para-aminosalicylic acid Treatment of tuberculosis Lucane Pharma SA 17/12/2010
EU/3/10/827 Recombinant human lysosomal acid lipase Treatment of lysosomal acid lipase deficiency Synageva BioPharma Ltd. 17/12/2010
EU/3/10/828 Silibinin-C-2',3-dihydrogensuccinate, disodium salt Prevention of recurrent hepatitis C in liver transplant recipients Rottapharm S.p.A 17/12/2010
EU/3/10/829 Tesetaxel Treatment of gastric cancer Genta Development Limited 17/12/2010
EU/3/10/830 Veliparib Treatment of ovarian cancer Abbott Laboratories 17/12/2010
EU/3/10/831 Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin Treatment of mantle cell lymphoma Biovest Europe Limited 23/02/2011
EU/3/10/832 Deferiprone Treatment of sickle cell disease Apotex Europe B.V. 23/02/2011
EU/3/10/833 Doxorubicin hydrochloride (in heat-sensitive liposomes) Treatment of hepatocellular carcinoma Biological Consulting Europe Ltd 23/02/2011
EU/3/10/834 Human plasmin Treatment of acute peripheral arterial occlusion Grifols Deutschland GmbH 23/02/2011
EU/3/10/835 Maytansinoid-conjugated humanised monoclonal antibody against CD56 Treatment of multiple myeloma ImmunoGen Europe Limited 23/02/2011
EU/3/10/836 Paquinimod Treatment of systemic sclerosis Active Biotech AB 23/02/2011
EU/3/10/840 Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 Treatment of acute lymphoblastic leukaemia SymbioTec GmbH 23/02/2011
EU/3/10/841 Tasimelteon Treatment of non-24-hour sleep-wake disorders in blind people with no light perception Vanda Pharmaceuticals Limited 23/02/2011
EU/3/10/842 Nimorazole Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Azanta A/S 23/02/2011
EU/3/10/843 Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix Prevention of arteriovenous access failure in haemodialysis patients Gregory Fryer Associates Ltd 23/02/2011
EU/3/10/844 Axitinib Treatment of renal cell carcinoma Pfizer Limited 23/02/2011
EU/3/10/845 Dry extract from birch bark (DER 0.1-0.2:1), extraction solvent n-heptane 95% (V/V) Treatment of epidermolysis bullosa Birken AG 23/02/2011
EU/3/10/846 Paclitaxel (aqueous gel) Treatment of oesophagus carcinoma BTG plc 23/02/2011
EU/3/10/847 Pegylated B-domain-deleted sequence-modified recombinant human factor VIII Treatment of haemophilia A Bayer Schering Pharma AG 23/02/2011
EU/3/10/848 Sodium thiosulfate Treatment of calciphylaxis Dr Franz Köhler Chemie GmbH 23/02/2011
EU/3/11/849 (S)-{8-fluoro-2-2[4-(3-methoxyphenyl)-1-piperazinyl]-3-[2-methoxy-5-(trifluoromethyl)-phenyl]-3,4-dihydro-4-quinazolinyl} acetic acid Prevention of cytomegalovirus disease in patients with impaired cell-mediated immunity deemed at risk AiCuris GmbH & Co. KG 15/04/2011
EU/3/11/850 Darinaparsin Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) ZIOPHARM Oncology Ltd 15/04/2011
EU/3/11/851 Glufosfamide Treatment of pancreatic cancer Theradex (Europe) Ltd. 15/04/2011
EU/3/11/852 Human anthrax monoclonal antibody Treatment of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 15/04/2011
EU/3/11/853 Ombrabulin Treatment of soft tissue sarcoma Sanofi Aventis 15/04/2011
EU/3/11/854 Vorinostat Treatment of multiple myeloma Merck Sharp & Dohme Limited 15/04/2011
EU/3/11/855 Recombinant fusion protein linking human coagulation factor VIIa with human albumin Treatment of haemophilia A CSL Behring GmbH 15/04/2011
EU/3/11/856 Recombinant thymidine phosphorylase encapsulated in autologous erythrocytes Treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) due to thymidine phosphorylase deficiency St George's University of London 15/04/2011
EU/3/11/857 Synthetic double-stranded siRNA oligonucleotide directed against transthyretin mRNA Treatment of familial amyloid polyneuropathy Voisin Consulting SARL 15/04/2011
EU/3/11/858 R-baclofen Treatment of fragile X syndrome Lakeside Regulatory Consulting Services Ltd 15/04/2011
EU/3/11/859 [N-((2S,3R,3aS,3´R,4a´R,6S,6a´R,6b´S,7aR,12a´S,12b´S,Z)-3,6,11´,12b´-tetramethyl-2´,3a,3´,4,4´,4a´,5,5´,6,6´,6a´,6b´,7,7a,7´,8´,10´,12´,12a´,12b´-icosahydro-1´H,3H-spiro[furo[3,2-b]pyridine-2,9´-naphtho[2,1-a]azulene]-3´-yl)methanesulfonamide hydrochloride] Treatment of chondrosarcoma Voisin Consulting S.A.R.L. 13/05/2011
EU/3/11/860 Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene Treatment of Leber´s hereditary optic neuropathy Institut de la Vision 13/05/2011
EU/3/11/861 9-cis-Retinyl acetate Treatment of Leber's congenital amaurosis QLT Ophthalmics (UK), Ltd 13/05/2011
EU/3/11/862 Apomorphine hydrochloride Treatment of moderate and severe traumatic brain injury Dr Elkan Raphael Gamzu 13/05/2011
EU/3/11/863 Recombinant fusion protein linking human coagulation factor VIIa with human albumin Treatment of haemophilia B CSL Behring GmbH 13/05/2011
EU/3/11/864 Adeno-associated viral vector containing the human ARSB gene Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Fondazione Telethon 13/05/2011
EU/3/11/865 9-cis-Retinyl acetate Treatment of retinitis pigmentosa QLT Ophthalmics (UK), Ltd 13/05/2011
EU/3/11/866 Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2 Treatment of acute myeloid leukaemia Fate Therapeutics, LTD 13/05/2011
EU/3/11/867 Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2 Treatment of acute myeloid leukaemia Fate Therapeutics, LTD 13/05/2011
EU/3/11/868 Lenalidomide Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 13/05/2011
EU/3/11/869 Lisuride hydrogen maleate Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Sinoxa Pharma UG 13/05/2011
EU/3/11/870 S-nitrosoglutathione Treatment of pre-eclampsia Salupont Consulting Ltd 13/05/2011
EU/3/11/871 Salirasib Treatment of pancreatic cancer TMC Pharma Services Ltd 21/06/2011
EU/3/11/872 Sulfonated monophosphorylated mannose oligosaccharide Treatment of hepatocellular carcinoma S-cubed Ltd 21/06/2011
EU/3/11/873 Human dermal fibroblasts cultured on a bioresorbable polyglactin mesh Treatment of epidermolysis bullosa TMC Pharma Services Ltd 21/06/2011
EU/3/11/874 Human embryonic stem-cell-derived retinal pigment epithelial cells Treatment of Stargardt’s disease TMC Pharma Services Ltd 21/06/2011
EU/3/11/875 Metronidazole Treatment of pouchitis FORMAC Pharmaceuticals NV 21/06/2011
EU/3/11/876 Viral vector containing DNA encoding the human SMN protein Treatment of 5q spinal muscular atrophy University of Sheffield 21/06/2011
EU/3/11/877 Adeno-associated viral vector serotype 9 containing the human sulfamidase gene Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Laboratorios del Dr. Esteve, S.A. 21/06/2011
EU/3/11/878 Allogeneic T cells encoding an exogenous TK gene Treatment of acute lymphoblastic leukaemia LTKFarma 21/06/2011
EU/3/11/879 Chimeric monoclonal antibody against GD2 Treatment of neuroblastoma United Therapeutics Europe Ltd 21/06/2011
EU/3/11/880 Genetically modified human adenovirus encoding human PH20 hyaluronidase Treatment of pancreatic cancer VCN Biosciences S.L. 21/06/2011
EU/3/11/881 Acadesine Treatment of multiple myeloma Advancell - Advanced In Vitro Cell Technologies S.A. 5/08/2011
EU/3/11/882 Fresolimumab Treatment of focal segmental glomerulosclerosis Genzyme Europe BV 5/08/2011
EU/3/11/883 Low molecular weight dextran sulfate Treatment for mobilisation of progenitor cells prior to stem cell transplantation TikoMed AB 5/08/2011
EU/3/11/884 Methyl O-4-O-[2-[2-[2-[2-[[N-[(1R)-1-[[4-(aminoiminomethyl)phenyl]methyl]-2-oxo-2-(1-piperidinyl)ethyl]-N2-[(4-methoxy-2,3,6-trimethylphenyl)sulfonyl]-L-a-asparaginyl-4-aminobutanoyl-N6-[5-[(3aS,4S,6aR)-hexahydro-2-oxo-1H-thieno[3,4-d]imidazol-4-yl]-1-oxopentyl]-L-lysyl]amino]ethoxy]ethoxy]ethoxy]ethyl]-2,3-di-O-methyl-6-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-ß-D-glucopyranuronosyl-(1->4)-O-2,3,6-tri-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-a-L-idopyranuronosyl-(1->4)-3-O-methyl-a-D-glucopyranoside 2,6-bis(hydrogen sulfate) octasodium salt Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Endotis Pharma 5/08/2011
EU/3/11/885 Mixture of seven synthetic fragments consisting of p21 RAS peptides Treatment of pancreatic cancer Targovax AS 5/08/2011
EU/3/11/886 N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt Treatment of post-polycythaemia vera myelofibrosis YM BioSciences (UK) Limited 5/08/2011
EU/3/11/887 N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt Treatment of post-essential thrombocythaemia myelofibrosis YM BioSciences (UK) Limited 5/08/2011
EU/3/11/888 N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt Treatment of primary myelofibrosis YM BioSciences (UK) Limited 5/08/2011
EU/3/11/889 Pegylated recombinant Erwinia chrysanthemi L-asparaginase Treatment of acute lymphoblastic leukaemia EUSA Pharma SAS 5/08/2011
EU/3/11/890 Peretinoin Treatment of hepatocellular carcinoma Kowa Pharmaceutical Europe Co. Ltd. 5/08/2011
EU/3/11/891 Human anthrax monoclonal antibody Post-exposure prophylaxis of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 5/08/2011
EU/3/11/892 5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride Treatment of 5q spinal muscular atrophy Repligen Europe Limited 30/08/2011
EU/3/11/893 Cardiotrophin-1 Treatment of acute liver failure Digna Biotech S.L. 30/08/2011
EU/3/11/894 Everolimus Treatment of gastric cancer Novartis Europharm Ltd 30/08/2011
EU/3/11/895 Hydroxy-propyl-beta-cyclodextrin Treatment of Niemann-Pick disease, type C Susan French 30/08/2011
EU/3/11/896 Multilamellar microvesicle comprising phosphatidylcholine, sphingomyelin, phosphatidylethanolamine, phosphatidylserine, phospatidylinositol and cholesterol Treatment of cystic fibrosis Lamellar Biomedical Ltd 30/08/2011
EU/3/11/897 N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide Treatment of tuberculosis Pfizer Limited 30/08/2011
EU/3/11/898 Sirolimus Treatment of chronic non-infectious uveitis Santen Oy 30/08/2011
EU/3/11/899 2,2'-{2-[(1R)-1-({[(2,5-dichlorobenzoyl)amino]acetyl}amino)-3-methylbutyl]-5-oxo-1,3,2-dioxaborolane-4,4-diyl}diacetic acid Treatment of multiple myeloma Takeda Global Research and Development Centre (Europe) Ltd. 27/09/2011
EU/3/11/900 20-pentaerythritol poly (oxy-1,2-ethanediyl)-carboxymethyl-glycinate-7-ethyl-10-hydroxycamptothecine 10-[1,4'-bipiperidine]-1'-carboxylate Treatment of ovarian cancer Nektar Therapeutics UK Ltd 27/09/2011
EU/3/11/901 Dinaciclib Treatment of chronic lymphocytic leukaemia Merck Sharp & Dohme Limited 27/09/2011
EU/3/11/902 Eflornithine Treatment of neuroblastoma Cancer Prevention Pharma Limited 27/09/2011
EU/3/11/903 Genetically modified Lactococcus lactis bacteria containing the human trefoil factor 1 gene Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy ActoGeniX N.V. 27/09/2011
EU/3/11/904 Heterologous human adult liver-derived stem cells Treatment of ornithine transcarbamylase deficiency Fresenius Medical Care Deutschland GmbH 27/09/2011
EU/3/11/905 Kifunensine Treatment of alpha-sarcoglycanopathy Généthon 27/09/2011
EU/3/11/906 Kifunensine Treatment of beta-sarcoglycanopathy Généthon 27/09/2011
EU/3/11/907 Kifunensine Treatment of delta-sarcoglycanopathy Généthon 27/09/2011
EU/3/11/908 Kifunensine Treatment of gamma-sarcoglycanopathy Généthon 27/09/2011
EU/3/11/909 Macitentan Treatment of pulmonary arterial hypertension Actelion Registration Limited 27/09/2011
EU/3/11/910 NH2-Cys-Ser-Ser-Val-Thr-Ala-Trp-Thr-Thr-Gly-Cys-Gly-CONH2 Treatment of traumatic spinal cord injury PHARMAXON 27/09/2011
EU/3/11/911 Recombinant human galactocerebrosidase Treatment of globoid cell leukodystrophy (Krabbe disease) ACE BioSciences A/S 27/09/2011
EU/3/11/912 Reparixin Prevention of graft rejection in pancreatic islet transplantation Dompé S.p.A. 27/09/2011
EU/3/11/913 Resminostat Treatment of hepatocellular carcinoma 4SC AG 27/09/2011
EU/3/11/914 Smilagenin Treatment of amyotrophic lateral sclerosis Phytopharm plc 27/09/2011
EU/3/11/915 1-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl]thieno[3,2-c]pyridin-3-yl}phenyl)-3-(3-fluorophenyl)urea Treatment of acute myeloid leukaemia Abbott Laboratories 27/10/2011
EU/3/11/916 2-hydroxyoleic acid Treatment of glioma Lipopharma Therapeutics SL 27/10/2011
EU/3/11/917 Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Institut Pasteur 27/10/2011
EU/3/11/918 Brivanib alaninate Treatment of hepatocellular carcinoma Bristol-Myers Squibb Pharma EEIG 27/10/2011
EU/3/11/919 Clonidine hydrochloride Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy BioAlliance Pharma 27/10/2011
EU/3/11/920 Gallium (68Ga)-pasireotide tetraxetan Diagnosis of gastro-entero-pancreatic neuroendocrine tumours OctreoPharm Sciences GmbH 27/10/2011
EU/3/11/921 Glycosylation independent lysosomal targeting tagged recombinant human acid alpha glucosidase Treatment of glycogen storage disease type II (Pompe's disease) BioMarin Europe Ltd. 27/10/2011
EU/3/11/922 Human platelet antigen-1a immunoglobulin Prevention of fetal and neonatal alloimmune thrombocytopenia due to human platelet antigen-1a incompatibility Prophylix Pharma AS 27/10/2011
EU/3/11/923 L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-, complex with keyhole limpet haemocyanin Treatment of glioma Orphix Consulting GmbH 27/10/2011
EU/3/11/924 Lenalidomide Treatment of mantle cell lymphoma Celgene Europe Limited 27/10/2011
EU/3/11/925 Mifepristone Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin Voisin Consulting SARL 27/10/2011
EU/3/11/926 Recombinant human minibody against complement component C5 Treatment of primary membranoproliferative glomerulonephritis ADIENNE S.r.l. 27/10/2011
EU/3/11/927 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol, sodium salt and palmitic acid Treatment of cystic fibrosis Pharm Research Associates (UK) Limited 27/10/2011
EU/3/11/928 Cysteamine Treatment of cystic fibrosis NovaBiotics Ltd 9/12/2011
EU/3/11/929 Adeno-associated viral vector serotype 8 containing the human AIPL1 gene Treatment of Leber’s congenital amaurosis type 4 Fondazione Telethon 9/12/2011
EU/3/11/930 Resminostat Treatment of Hodgkin's lymphoma 4SC AG 9/12/2011
EU/3/11/931 Plerixafor Adjunctive treatment to cytotoxic therapy in acute myeloid leukaemia Genzyme Europe B.V. 9/12/2011
EU/3/11/932 Pegylated proline-interferon alpha-2b Treatment of polycythaemia vera AOP Orphan Pharmaceuticals AG 9/12/2011
EU/3/11/933 Nanoliposomal irinotecan Treatment of pancreatic cancer Merrimack Pharmaceuticals UK Limited 9/12/2011
EU/3/11/934 4-[[9-[(3S)-tetrahydro-3-furanyl]-8-[(2,4,6-trifluorophenyl)amino]-9H-purin-2-yl]amino]-trans-cyclohexanol Treatment of idiopathic pulmonary fibrosis Celgene Europe Ltd 9/12/2011
EU/3/11/935 Interferon gamma Treatment of Friedreich's ataxia Prof. Roberto Testi 9/12/2011
EU/3/11/936 Human haptoglobin Treatment of sickle cell disease Bio Products Laboratory Ltd 9/12/2011
EU/3/11/937 Alpha-tocotrienol quinone Treatment of Leigh syndrome Edison Orphan Pharma BV 9/12/2011
EU/3/11/938 Adeno-associated viral vector containing the human factor IX gene Treatment of haemophilia B Amsterdam Molecular Therapeutics BV 11/01/2012
EU/3/11/939 Brentuximab vedotin Treatment of cutaneous T-cell lymphoma Takeda Global Research and Development Centre (Europe) Ltd 11/01/2012
EU/3/11/940 Chimeric locked nucleic acid-deoxynucleoside phosphorothioate-linked oligonucleotide directed against microRNA-451 Treatment of polycythaemia vera Miragen Therapeutics Europe Ltd 11/01/2012
EU/3/11/941 Lipopolysaccharide of Ochrobactrum intermedium Prevention of sepsis in at-risk premature infants of less than or equal to 32 weeks of gestational age Diomune S.L. 11/01/2012
EU/3/11/942 Liposomal combination of cytarabine and daunorubicin Treatment of acute myeloid leukaemia Celator (UK) Ltd 11/01/2012
EU/3/11/943 Mogamulizumab Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) ProStrakan Limited 11/01/2012
EU/3/11/944 N,N'-bis(2-mercaptoethyl)isophthalamide Treatment of mercury toxicity CTI Science Limited 11/01/2012
EU/3/11/945 Ornithine phenylacetate Treatment of acute liver failure Dr Ulrich Granzer 11/01/2012
EU/3/11/946 Recombinant homodimer of the human annexin V Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Astellas Pharma Europe B.V. 11/01/2012
EU/3/11/947 Recombinant protein consisting of modified human growth hormone releasing hormone and the translocation and endopeptidase domains of botulinum toxin serotype D Treatment of acromegaly Syntaxin Limited 11/01/2012
EU/3/11/948 Sodium phenylbutyrate Treatment of 5q spinal muscular atrophy GMP-Orphan SAS 11/01/2012
EU/3/12/949 Sodium phenylbutyrate Treatment of citrullinaemia type 1 Lucane Pharma SA 9/02/2012
EU/3/12/950 Sodium phenylbutyrate Treatment of ornithine transcarbamylase deficiency Lucane Pharma SA 9/02/2012
EU/3/12/951 Sodium phenylbutyrate Treatment of carbamoyl-phosphate synthase-1 deficiency Lucane Pharma SA 9/02/2012
EU/3/12/952 Nimorazole maleate Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Conventia Medical LLP 9/02/2012
EU/3/12/953 (1S,3S)-3-amino-4-(difluoromethylene) cyclopentanecarboxylic acid hydrochloride Treatment of West syndrome Catalent Pharma Solutions Limited 9/02/2012
EU/3/12/954 S[+] apomorphine Treatment of amyotrophic lateral sclerosis University of Sheffield 9/02/2012
EU/3/12/955 Doxycycline hyclate Treatment of familial amyloid polyneuropathy Giampaolo Merlini 2/04/2012
EU/3/12/956 Human monoclonal antibody against Fas ligand Treatment of pemphigus PinCell s.r.l. 9/02/2012
EU/3/12/957 Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene Treatment of X-linked chronic granulomatous disease Généthon 9/02/2012
EU/3/12/958 N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine and folic acid Diagnosis of positive folate receptor status in ovarian cancer Endocyte Europe B.V. 9/02/2012
EU/3/12/959 Vincaleukoblastin-23-oic acid, O4-deacetyl-2-[(2-mercaptoethoxy)carbonyl]hydrazide, disulfide with N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-L-gamma-glutamyl-L-alpha-aspartyl-L-arginyl-L-alpha-aspartyl-L-alpha-aspartyl-L-cysteine Treatment of ovarian cancer Endocyte Europe B.V. 9/02/2012
EU/3/12/960 Glucagon Treatment of congenital hyperinsulinism Biodel UK Limited 5/03/2012
EU/3/12/961 Doxycycline hyclate Treatment of systemic amyloidosis caused by beta-2 microglobulin Giampaolo Merlini 5/03/2012
EU/3/12/964 Oleylphosphocholine Treatment of leishmaniasis Dafra Pharma International NV 23/04/2012
EU/3/12/965 Ketoconazole Treatment of Cushing’s syndrome Laboratoire HRA Pharma 23/04/2012
EU/3/12/966 (1-methyl-2-nitro-1H-imidazole-5-yl)methyl N,N'-bis(2-bromoethyl) diamidophosphate Treatment of soft tissue sarcoma Nexus Oncology Ltd. 5/03/2012
EU/3/12/967 Sodium nitrite Treatment of pulmonary arterial hypertension FGK Representative Service GmbH 5/03/2012
EU/3/12/968 Human monoclonal antibody targeting Staphylococcus aureus alpha-toxin Treatment of pneumonia caused by Staphylococcus aureus Envestia Limited 5/03/2012
EU/3/12/970 6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2(3H)-one Treatment of amyotrophic lateral sclerosis ICON Clinical Research (UK) Limited 5/03/2012
EU/3/12/971 Heterologous human adult liver-derived stem cells Treatment of carbamoyl-phosphate synthase-1 deficiency Fresenius Medical Care Deutschland GmbH 5/03/2012
EU/3/12/972 Sialic acid Treatment of hereditary inclusion body myopathy NDA Regulatory Science Ltd 5/03/2012
EU/3/12/973 Recombinant human beta-glucuronidase Treatment of mucopolysaccharidosis type VII (Sly syndrome) NDA Regulatory Science Ltd 21/03/2012
EU/3/12/974 Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene Treatment of primary hyperoxaluria type 1 Amsterdam Molecular Therapeutics BV 21/03/2012
EU/3/12/975 Carbetocin Treatment of Prader-Willi syndrome Ferring Pharmaceuticals A/S 21/03/2012
EU/3/12/976 Antisense oligonucleotide targeted to the SMN2 gene Treatment of 5q spinal muscular atrophy Isis USA Ltd 2/04/2012
EU/3/12/977 Linsitinib Treatment of adrenal cortical carcinoma Astellas Pharma Europe B.V. 2/04/2012
EU/3/12/978 Melatonin Treatment of perinatal asphyxia Dr Nicola J Robertson 2/04/2012
EU/3/12/979 Sodium thiosulfate Treatment of calciphylaxis Aptiv Solutions (UK) Limited 2/04/2012
EU/3/12/980 Genistein sodium salt dihydrate Treatment of mucopolysaccharidosis type III (Sanfilippo syndrome) Axcentua Pharmaceuticals AB 2/04/2012
EU/3/12/981 Adenovirus associated viral vector serotype 2 containing the human RPE65 gene Treatment of Leber’s congenital amaurosis Alan Boyd Consultants Ltd 2/04/2012
EU/3/12/982 Dipalmitoylphosphatidylcholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol, sodium salt, synthetic surfactant protein C analogue and synthetic surfactant protein B analogue Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Chiesi Farmaceutici S.P.A. 2/04/2012
EU/3/12/983 Heterologous human adult liver-derived stem cells Treatment of acute liver failure Fresenius Medical Care Deutschland GmbH 26/04/2012
EU/3/12/984 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4 d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one Treatment of chronic lymphocytic leukaemia Nexus Oncology Ltd. 26/04/2012
EU/3/12/985 Recombinant human methionine proinsulin Treatment of retinitis pigmentosa ProRetina Therapeutics, S.L. 26/04/2012
EU/3/12/986 Pomalidomide Treatment of systemic sclerosis Celgene Europe Limited 26/04/2012
EU/3/12/987 (E)-2,4,6-trimethoxystyryl-3-carboxymethylamino-4-methoxybenzyl-sulfone sodium salt Treatment of myelodysplastic syndromes JJGConsultancy Ltd 26/04/2012
EU/3/12/988 Halofuginone Hydrobromide Treatment of Duchenne muscular dystrophy Biological Consulting Europe Ltd 26/04/2012
EU/3/12/989 2-Allyl-1-[6-(1-hydroxy-1-methylethyl)pyridin-2-yl]-6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-1,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin-3-one Treatment of ovarian cancer Merck Sharp & Dohme Limited 26/04/2012
EU/3/12/990 Vosaroxin Treatment of acute myeloid leukaemia Sunesis Europe Ltd 26/04/2012
EU/3/12/991 Exon 45 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 26/04/2012
EU/3/12/992 Exon 53 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 26/04/2012
EU/3/12/993 N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide Treatment of neurofibromatosis type 2 Sirius Regulatory Consulting Limited 26/04/2012
EU/3/12/995 Pegylated recombinant factor VIII Treatment of haemophilia A Novo Nordisk A/S 26/04/2012