Navigation path

Pharmaceuticals - Community Register

  

Community register of orphan medicinal products


GRANTED  

Product information

Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)

EU orphan designation number: EU/3/07/445   
Active ingredient: Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Indication: Prevention of corneal graft rejection
Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, F-91000 Evry, France

   Public summary of scientific opinion    

 

European Commission proceduresGoto top of the page

Close date procedure Procedure type EMEA number Decision summary publ decision docs annex
19/04/2007 Centralised Orphan - Designation EMEA/OD/091/06 (2007)1802 of 17/04/2007