Navigation path

Pharmaceuticals - Community Register

  

Community register of orphan medicinal products


GRANTED  

Product information

Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)

EU orphan designation number: EU/3/07/445   
Active ingredient: Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Indication: Prevention of corneal graft rejection
Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, 91000 Evry, France

   Public summary of scientific opinion    

European Commission proceduresGoto top of the page

Close date procedure Procedure type EMEA number Decision summary publ decision docs annex
19/04/2007 Orphan designation EMEA/OD/091/06 (2007)1802 of 17/04/2007