Navigation path

Pharmaceuticals - Community Register


Community register of orphan medicinal products


Product information


EU orphan designation number: EU/3/03/161   
Active ingredient: Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Indication: Treatment of neovascular glaucoma
Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, F-91000 Evry, France

   Public summary of scientific opinion    

European Commission proceduresGoto top of the page

Close date procedure Procedure type EMEA number Decision summary publ decision docs annex
06/10/2003 Orphan designation EMEA/OD/015/03 (2003)3565 of 02/10/2003