Navigation path

Pharmaceuticals - Community Register

  

Community register of orphan medicinal products


GRANTED  

Product information

Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)

EU orphan designation number: EU/3/03/161   
Active ingredient: Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Indication: Treatment of neovascular glaucoma
Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, 91000 Evry, France

   Public summary of scientific opinion    

European Commission proceduresGoto top of the page

Close date procedure Procedure type EMEA number Decision summary publ decision docs annex
06/10/2003 Orphan designation EMEA/OD/015/03 (2003)3565 of 02/10/2003