Navigation path

Pharmaceuticals - Union Register


Register of orphan medicinal products


Product information


EU orphan designation number: EU/3/03/160   
Active ingredient: Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Indication: Treatment of retinopathy of prematurity
Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, 91000 Evry, France

   Public summary of scientific opinion    

European Commission proceduresGoto top of the page

Close date procedure Procedure type EMEA number Decision summary publ decision docs annex
6/10/2003 Orphan designation EMEA/OD/014/03 (2003)3564 of 2/10/2003