Navigation path

Community Register of medicinal products

Community register of orphan medicinal products


GRANTED  

Product information

Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)

EU orphan designation number: EU/3/03/160   
Active ingredient: Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Indication: Treatment of retinopathy of prematurity
Sponsor: Gene Signal SAS
4 rue Pierre Fontaine, F-91000 Evry, France

   Public summary of scientific opinion    

 

European Commission proceduresGoto top of the page

Close date procedure Procedure type EMEA number Decision summary publ decision docs annex
06/10/2003 Centralised Orphan - Designation EMEA/OD/014/03 (2003)3564 of 02/10/2003