European Commission
Public Health
Accessibility tools
Service tools
Language selector
- Current languageen
Navigation path
- European Commission
- Public health
- Reference documents
- Register
- Orphan products
- Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Community Register of medicinal products
Community register of orphan medicinal products | GRANTED |
Product information |
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
| EU orphan designation number: | EU/3/03/160
|
| Active ingredient: | Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) |
| Indication: | Treatment of retinopathy of prematurity |
| Sponsor: | Gene Signal SAS
4 rue Pierre Fontaine, F-91000 Evry, France |
Public summary of scientific opinion
European Commission procedures
| Close date procedure | Procedure type | EMEA number | Decision | summary publ | decision docs | annex |
| 06/10/2003 | Centralised Orphan - Designation | EMEA/OD/014/03 | (2003)3564 of 02/10/2003 |