Navigation path

Pharmaceuticals - Community Register


Full list of products by active substance: A

1  2  3  4  5  6  7  8  9  A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z 

Active substance Brand name EU Number Human or veterinary Procedure type details
a-1-acid glycoprotein   EU/3/03/164 Human Orphan designation details
  ,,   EU/3/03/138 Human Orphan designation details
AASSGVSTPGSAGHDIITEQPRS   EU/3/15/1492 Human Orphan designation details
abacavir / Lamivudine Kivexa EU/1/04/298 Human Centralised details
abacavir, lamivudine, zidovudine Trizivir EU/1/00/156 Human Centralised details
abacavir sulfate Ziagen EU/1/99/112 Human Centralised details
Abarelix   EU/3/10/771 Human Orphan designation details
abatacept Orencia EU/1/07/389 Human Centralised details
Abetimus sodium   EU/3/01/064 Human Orphan designation details
abiraterone Zytiga EU/1/11/714 Human Centralised details
Acadesine   EU/3/11/881 Human Orphan designation details
  ,,   EU/3/05/280 Human Orphan designation details
Acalabrutinib   EU/3/16/1624 Human Orphan designation details
  ,,   EU/3/16/1625 Human Orphan designation details
  ,,   EU/3/16/1626 Human Orphan designation details
Acamprosate calcium   EU/3/14/1337 Human Orphan designation details
Acebutolol hydrochloride   EU/3/16/1742 Human Orphan designation details
Acetylcysteine   EU/3/04/259 Human Orphan designation details
Acetylleucine   EU/3/17/1949 Human Orphan designation details
  ,,   EU/3/17/1848 Human Orphan designation details
Acetylsalicylic acid   EU/3/04/208 Human Orphan designation details
Acipimox Olbetam   Human Referral details
  ,, acipimox   Human Referral details
aclidinium bromide Bretaris Genuair EU/1/12/781 Human Centralised details
  ,, Eklira Genuair EU/1/12/778 Human Centralised details
aclidinium bromide / formoterol fumarate dihydrate Brimica Genuair EU/1/14/963 Human Centralised details
  ,, Duaklir Genuair EU/1/14/964 Human Centralised details
A combination of H-Lys-Lys-Gly-Pro-Arg-Cys(SH)-Leu-Thr-Arg-Tyr-Tyr-Ser-Ser-Phe-Val-Asn-Met-Glu-Gly-Lys-Lys-OH and H-Lys-Lys-Gly-Asp-Asn-Ile-Met-Val-Thr-Phe-Arg-Asn-Gln-Ala-Ser-Arg-Pro-Tyr-Gly-Lys-Lys-OH   EU/3/14/1360 Human Orphan designation details
Actinobacillus pleuropneumoniae serotype 1 (strain NT3) and
Actinobacillus pleuropneumoniae serotype 2 (strains PO, U3, B4, SZ II)
expressing ApxI toxoid min. 28.9 ELISA unit/ml*
  ApxII toxoid min. 16.7 ELISA unit/ml
  ApxIII toxoid min. 6.8 ELISA unit/ml
* Elisa unit/ml calculated serological titre in sera of immunised rabbits
Coglapix suspension for injection for pigs   Veterinary Referral details
adalimumab AMGEVITA EU/1/16/1164 Human Centralised details
  ,, Cyltezo EU/1/17/1240 Human Centralised details
  ,, Humira EU/1/03/256 Human Centralised details
  ,, Imraldi EU/1/17/1216 Human Centralised details
  ,, SOLYMBIC EU/1/16/1163 Human Centralised details
  ,, Trudexa EU/1/03/257 Human Centralised details
adefovir dipivoxil Hepsera EU/1/03/251 Human Centralised details
Adeno-associated viral vector containing a modified U7-snRNA gene   EU/3/05/297 Human Orphan designation details
Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene   EU/3/10/817 Human Orphan designation details
Adeno-associated viral vector containing modified U1 snRNA   EU/3/09/663 Human Orphan designation details
Adeno-associated viral vector containing porphobilinogen deaminase gene   EU/3/09/632 Human Orphan designation details
Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene   EU/3/11/917 Human Orphan designation details
Adeno-associated viral vector containing the human alpha-sarcoglycan gene   EU/3/08/573 Human Orphan designation details
Adeno-associated viral vector containing the human ARSB gene   EU/3/11/864 Human Orphan designation details
Adeno associated viral vector containing the human calpain 3 gene   EU/3/06/359 Human Orphan designation details
Adeno-associated viral vector containing the human factor IX gene   EU/3/11/938 Human Orphan designation details
  ,,   EU/3/15/1501 Human Orphan designation details
Adeno-associated viral vector containing the human gamma-sarcoglycan gene   EU/3/04/233 Human Orphan designation details
Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene   EU/3/11/860 Human Orphan designation details
Adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5 (prior to administration of 17-dimethylaminoethylamino-17-demethoxygeldanamycin)   EU/3/12/1069 Human Orphan designation details
Adeno-associated viral vector expressing lipoprotein lipase   EU/3/04/194 Human Orphan designation details
Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene   EU/3/12/974 Human Orphan designation details
Adeno-associated viral vector serotype 2/2 containing a gene encoding the channelrhodopsin-2 protein   EU/3/16/1740 Human Orphan designation details
Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human alpha L-iduronidase gene   EU/3/17/1955 Human Orphan designation details
Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human iduronate 2-sulfatase gene   EU/3/17/1956 Human Orphan designation details
Adeno-associated viral vector serotype 2.7m8 containing the ChrimsonR-tdTomato gene   EU/3/16/1693 Human Orphan designation details
Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1   EU/3/14/1278 Human Orphan designation details
Adeno-associated viral vector serotype 2 containing the human REP1 gene   EU/3/14/1290 Human Orphan designation details
Adeno-associated viral vector serotype 5 containing a B-domain deleted variant of human coagulation factor VIII gene   EU/3/16/1622 Human Orphan designation details
Adeno-associated viral vector serotype 5 containing the human ABCA4 gene   EU/3/08/609 Human Orphan designation details
Adeno-associated viral vector serotype 5 containing the human CHM gene   EU/3/15/1482 Human Orphan designation details
Adeno-associated viral vector serotype 5 containing the human RLBP1 gene   EU/3/16/1741 Human Orphan designation details
Adeno-associated viral vector serotype 5 encoding a microRNA targeted to human huntingtin gene   EU/3/17/1957 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human acid alpha-glucosidase gene   EU/3/18/2007 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human AIPL1 gene   EU/3/11/929 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human alpha-galactosidase A gene   EU/3/17/1849 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human CNGA3 gene under the control of a cone arrestin promoter   EU/3/16/1795 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human factor VII gene   EU/3/14/1430 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human glucose-6-phosphatase gene   EU/3/16/1771 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human GUCY2D gene   EU/3/14/1256 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human MD1 gene   EU/3/14/1381 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human MTM1 gene   EU/3/15/1539 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene   EU/3/14/1321 Human Orphan designation details
  ,,   EU/3/16/1772 Human Orphan designation details
  ,,   EU/3/14/1338 Human Orphan designation details
Adeno-associated viral vector serotype 8 encoding engineered rhodopsin DNA-binding repressor and human rhodopsin expression cassettes   EU/3/16/1796 Human Orphan designation details
Adeno-associated viral vector serotype 8 encoding human ornithine transcarbamylase   EU/3/16/1623 Human Orphan designation details
Adeno-associated viral vector serotype 8 encoding the human ATP7B gene under the control of the human alpha-1 antitrypsin promoter   EU/3/15/1573 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human cardiac calsequestrin gene   EU/3/14/1296 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human glucocerebrosidase gene   EU/3/15/1468 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human HGSNAT gene   EU/3/15/1491 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human iduronate-2-sulfatase gene   EU/3/15/1540 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human mini-dystrophin gene   EU/3/16/1716 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene   EU/3/12/1095 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human SMN gene   EU/3/15/1509 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human sulfamidase gene   EU/3/11/877 Human Orphan designation details
Adeno-associated viral vector serotype 9 encoding miRNA against human superoxide dismutase 1   EU/3/18/2008 Human Orphan designation details
Adeno-associated viral vector serotype Anc80 containing the truncated human ATP7B gene under the control of the human alpha-1 antitrypsin promoter   EU/3/17/1898 Human Orphan designation details
Adeno-associated viral vector serotype LK03 encoding human ornithine transcarbamylase   EU/3/17/1850 Human Orphan designation details
Adeno-associated viral vector serotype rh.10 carrying the human N-sulfoglucosamine sulfohydrolase cDNA   EU/3/14/1389 Human Orphan designation details
Adeno-associated viral vector serotype rh10 containing the human factor IX gene   EU/3/15/1599 Human Orphan designation details
Adeno-associated viral vector serotype rh.10 expressing beta-galactosidase   EU/3/17/1851 Human Orphan designation details
Adenoviral vector containing human p53 gene   EU/3/06/404 Human Orphan designation details
Adenoviral vector of serotype 5 modified to contain a chimeric sequence consisting of a minimal urokinase-type plasminogen activator receptor promoter preceded by three Notch-responsive elements, and coated with oligopeptide end-modified poly (beta-amino) esters   EU/3/17/1917 Human Orphan designation details
Adenoviral vector serotype 5 containing the vascular endothelial growth factor D isoform (preprocessed short form) from a CMV promoter   EU/3/14/1415 Human Orphan designation details
Adenovirus-associated vector containing human Fas-c gene   EU/3/12/1002 Human Orphan designation details
Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs   EU/3/10/772 Human Orphan designation details
Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene   EU/3/15/1518 Human Orphan designation details
  ,,   EU/3/12/981 Human Orphan designation details
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene   EU/3/07/484 Human Orphan designation details
  ,,   EU/3/07/486 Human Orphan designation details
Adenovirus associated viral vector serotype 5 containing the human pde6β gene   EU/3/13/1142 Human Orphan designation details
Adenovirus associated viral vector serotype 5 containing the human RPE65 gene   EU/3/15/1577 Human Orphan designation details
Adenovirus associated viral vector serotype 5 containing the human RPGR gene   EU/3/16/1715 Human Orphan designation details
Adenovirus associated viral vector serotype 8 containing the human AIPL1 gene   EU/3/17/1950 Human Orphan designation details
Adenovirus associated viral vector serotype 8 containing the human CNGB3 gene   EU/3/15/1578 Human Orphan designation details
Adenovirus-associated viral vector serotype 8 containing the human RPGR gene   EU/3/18/1975 Human Orphan designation details
Adenovirus-Interferon gamma – coding DNA sequence   EU/3/03/150 Human Orphan designation details
Adenovirus-mediated Herpes simplex Virus-thymidine kinase gene   EU/3/01/083 Human Orphan designation details
Adenovirus serotype 5 containing partial E1A deletion and an integrin-binding domain   EU/3/14/1396 Human Orphan designation details
Adenovirus-specific T-cells derived from allogeneic donor leukocytes, expanded ex vivo   EU/3/13/1227 Human Orphan designation details
Adrenomedullin   EU/3/10/744 Human Orphan designation details
Adult human bone-marrow-derived, ex-vivo-expanded, pooled allogeneic mesenchymal stromal cells   EU/3/15/1499 Human Orphan designation details
afamelanotide Scenesse EU/1/14/969 Human Centralised details
  ,,   EU/3/09/648 Human Orphan designation details
  ,,   EU/3/14/1285 Human Orphan designation details
afatinib Giotrif EU/1/13/879 Human Centralised details
aflibercept Eylea EU/1/12/797 Human Centralised details
  ,, ZALTRAP EU/1/12/814 Human Centralised details
afoxolaner NexGard EU/2/13/159 Veterinary Centralised details
Afoxolaner / milbemycin oxime NEXGARD SPECTRA EU/2/14/177 Veterinary Centralised details
Agalsidase alfa Replagal EU/1/01/189 Human Centralised details
Agalsidase beta Fabrazyme EU/1/01/188 Human Centralised details
Agammaglobulinaemia tyrosine kinase   EU/3/17/1951 Human Orphan designation details
Aganirsen   EU/3/14/1275 Human Orphan designation details
agomelatine Thymanax   Human Centralised Refusal details
  ,,     ,, EU/1/08/498 Human Centralised details
  ,, Valdoxan EU/1/08/499 Human Centralised details
A highly purified formulation of Staphylococcus aureus protein A   EU/3/15/1562 Human Orphan designation details
alatrofloxacin Trovan IV EU/1/98/060 Human Centralised details
  ,, Turvel IV EU/1/98/062 Human Centralised details
albiglutide Eperzan EU/1/13/908 Human Centralised details
albutrepenonacog alfa IDELVION EU/1/16/1095 Human Centralised details
Aldesleukin (inhalation use)   EU/3/03/146 Human Orphan designation details
alectinib Alecensa EU/1/16/1169 Human Centralised details
Alemtuzumab Lemtrada EU/1/13/869 Human Centralised details
  ,, MabCampath EU/1/01/193 Human Centralised details
Alendronate sodium / Colecalciferol Actonel Combi D   Human Referral details
  ,, Adrovance EU/1/06/364 Human Centralised details
  ,, Fosavance EU/1/05/310 Human Centralised details
  ,, Norsed Combi D and associated names   Human Referral details
  ,, Norsed plus Calcium D   Human Referral details
  ,, Norsedcombi   Human Referral details
  ,, Opticalcio D3   Human Referral details
  ,, Optinate Plus Ca & D   Human Referral details
alendronate sodium trihydricum Alendros 70   Human Referral details
alendronic acid Alendonicht   Human Referral details
  ,, Alendronate Hexal   Human Referral details
  ,, Alendronate Sandoz   Human Referral details
  ,, Forosa   Human Referral details
Alendronic acid and alfacalcidol Tevabone   Human Referral details
  ,, Valebo   Human Referral details
alendronic acid, clodronic acid, etidronic acid, ibandronic acid, neridronic acid, pamidronic acid, risedronic acid and tiludronic acid Acide Ibandronique   Human Referral details
  ,, Acido Alendronico   Human Referral details
  ,, Acido Ibandronico   Human Referral details
  ,, Acido clodronico   Human Referral details
  ,, Acrel   Human Referral details
  ,, Acrelcombi   Human Referral details
  ,, ActoCalD   Human Referral details
  ,, Actocalcio   Human Referral details
  ,, Actokit   Human Referral details
  ,, Actonel   Human Referral details
  ,, Adelan semanal   Human Referral details
  ,, Adronat   Human Referral details
  ,, Akost   Human Referral details
  ,, Aldrion   Human Referral details
  ,, Aledrolet   Human Referral details
  ,, Alefos   Human Referral details
  ,, Alehelm   Human Referral details
  ,, Alemol   Human Referral details
  ,, Alenat   Human Referral details
  ,, Alenato   Human Referral details
  ,, Alenax   Human Referral details
  ,, Alendis   Human Referral details
  ,, Alendor   Human Referral details
  ,, Alendorion   Human Referral details
  ,, Alendral   Human Referral details
  ,, Alendran   Human Referral details
  ,, Alendratol   Human Referral details
  ,, Alendrion   Human Referral details
  ,, Alendrixen   Human Referral details
  ,, Alendro   Human Referral details
  ,, AlendroLek   Human Referral details
  ,, AlendroLich   Human Referral details
  ,, Alendroarrow   Human Referral details
  ,, Alendrocare   Human Referral details
  ,, Alendrofarm   Human Referral details
  ,, Alendrogen   Human Referral details
  ,, Alendrogyn   Human Referral details
  ,, Alendrohexal   Human Referral details
  ,, Alendrokit   Human Referral details
  ,, Alendromax   Human Referral details
  ,, Alendromed   Human Referral details
  ,, Alendron   Human Referral details
  ,, Alendron beta   Human Referral details
  ,, Alendronat   Human Referral details
  ,, Alendronate   Human Referral details
  ,, Alendronate sodium   Human Referral details
  ,, Alendronato   Human Referral details
  ,, Alendronax   Human Referral details
  ,, Alendroninezuur   Human Referral details
  ,, Alendronorm   Human Referral details
  ,, Alendronsav   Human Referral details
  ,, Alendronstad   Human Referral details
  ,, Alendronsäure   Human Referral details
  ,, Alendroonhape   Human Referral details
  ,, Alendropol   Human Referral details
  ,, Alendros   Human Referral details
  ,, Alendrossa   Human Referral details
  ,, Alendrostad   Human Referral details
  ,, Alenic   Human Referral details
  ,, Alenotop   Human Referral details
  ,, Alenpol   Human Referral details
  ,, Alenvir semanal   Human Referral details
  ,, Alenwin   Human Referral details
  ,, Aleostito   Human Referral details
  ,, Alost   Human Referral details
  ,, Amidrox   Human Referral details
  ,, Andronik   Human Referral details
  ,, Anfozan   Human Referral details
  ,, Apo-Alendronat   Human Referral details
  ,, Aredia   Human Referral details
  ,, Aronade   Human Referral details
  ,, Arthroplus   Human Referral details
  ,, Aston   Human Referral details
  ,, Atronate   Human Referral details
  ,, Aurena   Human Referral details
  ,, Aurodren   Human Referral details
  ,, Avestra   Human Referral details
  ,, Axidronat   Human Referral details
  ,, Baxogar   Human Referral details
  ,, Bifoal Semanal   Human Referral details
  ,, Bifodron   Human Referral details
  ,, Bonasol   Human Referral details
  ,, Bondapen   Human Referral details
  ,, Boneact   Human Referral details
  ,, Bonefos   Human Referral details
  ,, Bonendro   Human Referral details
  ,, Bonmate   Human Referral details
  ,, Calbion Semanal   Human Referral details
  ,, Calcisedron-D   Human Referral details
  ,, Caldronate   Human Referral details
  ,, Claronate   Human Referral details
  ,, Clasteon   Human Referral details
  ,, Clastoban   Human Referral details
  ,, Clastodron   Human Referral details
  ,, Climaclod   Human Referral details
  ,, Clodeosten   Human Referral details
  ,, Clodrobon   Human Referral details
  ,, Clodron   Human Referral details
  ,, Clodronate de sodium   Human Referral details
  ,, Clodronato   Human Referral details
  ,, Clodronic acid   Human Referral details
  ,, Clody   Human Referral details
  ,, Dargol   Human Referral details
  ,, Debenal   Human Referral details
  ,, Dedarin   Human Referral details
  ,, Delfoza   Human Referral details
  ,, Densidron   Human Referral details
  ,, Deparex   Human Referral details
  ,, Didrokit   Human Referral details
  ,, Didronel   Human Referral details
  ,, Difonate   Human Referral details
  ,, Difosfon-S   Human Referral details
  ,, Difosfonal   Human Referral details
  ,, Dimidronat   Human Referral details
  ,, Diporos   Human Referral details
  ,, Disodio Clodronato   Human Referral details
  ,, Disodium Clodronate   Human Referral details
  ,, Disodium Pamidronate   Human Referral details
  ,, Doryx   Human Referral details
  ,, Dralenos   Human Referral details
  ,, Drofaz   Human Referral details
  ,, Dronacid   Human Referral details
  ,, Dronal   Human Referral details
  ,, Dronatex   Human Referral details
  ,, Dronavic   Human Referral details
  ,, EN-por   Human Referral details
  ,, Ebedronat   Human Referral details
  ,, Ellidronat   Human Referral details
  ,, Enimon   Human Referral details
  ,, Epolar   Human Referral details
  ,, Epsilonat   Human Referral details
  ,, Etanorden   Human Referral details
  ,, Etical   Human Referral details
  ,, Etidron   Human Referral details
  ,, Etidronat   Human Referral details
  ,, Etidronate   Human Referral details
  ,, Etidronic acid   Human Referral details
  ,, Farmemax   Human Referral details
  ,, Fasamax   Human Referral details
  ,, Flador   Human Referral details
  ,, Forosa   Human Referral details
  ,, Fortimax   Human Referral details
  ,, Fortipan   Human Referral details
  ,, Fosalen   Human Referral details
  ,, Fosamax   Human Referral details
  ,, Fosandron   Human Referral details
  ,, Fosatrol   Human Referral details
  ,, Fosazom   Human Referral details
  ,, Fosteofos   Human Referral details
  ,, Fostepor   Human Referral details
  ,, Fostolin   Human Referral details
  ,, Genalen   Human Referral details
  ,, Gendarin   Human Referral details
  ,, Gendron   Human Referral details
  ,, Hantrux   Human Referral details
  ,, Ibamyl   Human Referral details
  ,, Ibandromylan   Human Referral details
  ,, Ibandronate   Human Referral details
  ,, Ibandronic acid   Human Referral details
  ,, Ibandronsäure   Human Referral details
  ,, Instrel   Human Referral details
  ,, Juverital   Human Referral details
  ,, Kalosso   Human Referral details
  ,, Karadronat   Human Referral details
  ,, Kendarin   Human Referral details
  ,, Kwas alendronowy   Human Referral details
  ,, Ledronin   Human Referral details
  ,, Lefosan Semanal   Human Referral details
  ,, Lendrate   Human Referral details
  ,, Lindron   Human Referral details
  ,, Lodronat   Human Referral details
  ,, Lorine   Human Referral details
  ,, Loron   Human Referral details
  ,, Losentra   Human Referral details
  ,, Loss   Human Referral details
  ,, Lozostun   Human Referral details
  ,, Lytos   Human Referral details
  ,, Massidron   Human Referral details
  ,, Matekit   Human Referral details
  ,, Medarin   Human Referral details
  ,, Meldoz   Human Referral details
  ,, Miosen   Human Referral details
  ,, Moralen   Human Referral details
  ,, Mosmass   Human Referral details
  ,, Moticlod   Human Referral details
  ,, Motivus   Human Referral details
  ,, Natrijev   Human Referral details
  ,, Natriumrisedronaat   Human Referral details
  ,, Neridronic acid   Human Referral details
  ,, Nerixia   Human Referral details
  ,, Niklod   Human Referral details
  ,, Nofemix   Human Referral details
  ,, Nofrattil   Human Referral details
  ,, Norifaz   Human Referral details
  ,, Norsed   Human Referral details
  ,, Novapam   Human Referral details
  ,, Opticalcio   Human Referral details
  ,, Optinate   Human Referral details
  ,, Osaston   Human Referral details
  ,, Osodens   Human Referral details
  ,, Ossinat   Human Referral details
  ,, Ostac   Human Referral details
  ,, Ostacid   Human Referral details
  ,, Ostadil   Human Referral details
  ,, Ostalert   Human Referral details
  ,, Ostalis   Human Referral details
  ,, Ostaven   Human Referral details
  ,, Ostemax   Human Referral details
  ,, Ostenil   Human Referral details
  ,, Osteodidronel   Human Referral details
  ,, Osteomel   Human Referral details
  ,, Osteonat   Human Referral details
  ,, Osteonorm   Human Referral details
  ,, Osteoron   Human Referral details
  ,, Osteos   Human Referral details
  ,, Osteotab   Human Referral details
  ,, Ostepam   Human Referral details
  ,, Osteum   Human Referral details
  ,, Ostodronic   Human Referral details
  ,, Ostolek   Human Referral details
  ,, Ostopor   Human Referral details
  ,, Pamerit   Human Referral details
  ,, Pamidia   Human Referral details
  ,, Pamidran   Human Referral details
  ,, Pamidrin   Human Referral details
  ,, Pamidro   Human Referral details
  ,, Pamidrocell   Human Referral details
  ,, Pamidron   Human Referral details
  ,, Pamidronaat   Human Referral details
  ,, Pamidronaatdinatrium   Human Referral details
  ,, Pamidronat   Human Referral details
  ,, Pamidronat Dinatrium Hospira   Human Referral details
  ,, Pamidronatdinatrium   Human Referral details
  ,, Pamidronate   Human Referral details
  ,, Pamidronate de sodium   Human Referral details
  ,, Pamidronato   Human Referral details
  ,, Pamidrone   Human Referral details
  ,, Pamidronic acid   Human Referral details
  ,, Pamifos   Human Referral details
  ,, Paminject   Human Referral details
  ,, Pamired   Human Referral details
  ,, Pamisol   Human Referral details
  ,, Pamistad   Human Referral details
  ,, Pamitor   Human Referral details
  ,, Polerixen   Human Referral details
  ,, Porocalm   Human Referral details
  ,, Porodron   Human Referral details
  ,, Quodixor   Human Referral details
  ,, Racidrix   Human Referral details
  ,, Ralenost   Human Referral details
  ,, Randronate   Human Referral details
  ,, Ranos   Human Referral details
  ,, Realen   Human Referral details
  ,, Rekostin   Human Referral details
  ,, Resorpate   Human Referral details
  ,, Ribidron   Human Referral details
  ,, Ribodronat   Human Referral details
  ,, Ribodronato   Human Referral details
  ,, Ridate   Human Referral details
  ,, Ridon   Human Referral details
  ,, Ridracid   Human Referral details
  ,, Rigat   Human Referral details
  ,, Rinon   Human Referral details
  ,, Risadis   Human Referral details
  ,, Risdronostad   Human Referral details
  ,, Risedronaatnatrium   Human Referral details
  ,, Risedronat   Human Referral details
  ,, Risedronate   Human Referral details
  ,, Risedronate sodium   Human Referral details
  ,, Risedronatnatrium   Human Referral details
  ,, Risedronato   Human Referral details
  ,, Risedronato de sódio   Human Referral details
  ,, Risedronic acid   Human Referral details
  ,, Riselib   Human Referral details
  ,, Risemyl   Human Referral details
  ,, Risendros   Human Referral details
  ,, Riseos   Human Referral details
  ,, Risepallin   Human Referral details
  ,, Riseratio   Human Referral details
  ,, Risonate   Human Referral details
  ,, Risontel   Human Referral details
  ,, Risostad   Human Referral details
  ,, Rizida   Human Referral details
  ,, Romax   Human Referral details
  ,, Sedron   Human Referral details
  ,, Semandrol Semanal   Human Referral details
  ,, Sindronat   Human Referral details
  ,, Siranin   Human Referral details
  ,, Skelid   Human Referral details
  ,, Terixen   Human Referral details
  ,, Teva nat   Human Referral details
  ,, Tevabone   Human Referral details
  ,, Tevalen   Human Referral details
  ,, Tevanat   Human Referral details
  ,, Tevanate   Human Referral details
  ,, Tevanel   Human Referral details
  ,, Texpami   Human Referral details
  ,, Tiloetca   Human Referral details
  ,, Tiludronic acid   Human Referral details
  ,, Trabecan   Human Referral details
  ,, Traxovical   Human Referral details
  ,, Uteritrin   Human Referral details
  ,, Vionate   Human Referral details
  ,, Zakodronate   Human Referral details
  ,, Zectoel   Human Referral details
  ,, Zemaros   Human Referral details
  ,, Zilar   Human Referral details
  ,, Ziveteno   Human Referral details
  ,, Zulgar   Human Referral details
  ,, alendronic acid, clodronic acid, etidronic acid, ibandronic acid, neridronic acid, pamidronic acid, risedronic acid and tiludronic acid   Human Referral details
alendronic acid / colecalciferol Vantavo EU/1/09/572 Human Centralised details
A lentiviral vector pseudotyped by the Indiana serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins   EU/3/14/1417 Human Orphan designation details
A lentiviral vector pseudotyped by the New-Jersey serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins   EU/3/14/1418 Human Orphan designation details
Alfimeprase   EU/3/05/322 Human Orphan designation details
Alginate oligosaccharide (G-block) fragment   EU/3/07/475 Human Orphan designation details
alglucosidase alfa Myozyme EU/1/06/333 Human Centralised details
Alicaforsen   EU/3/09/641 Human Orphan designation details
Alipogene tiparvovec Glybera EU/1/12/791 Human Centralised details
alirocumab Praluent EU/1/15/1031 Human Centralised details
Alisertib   EU/3/12/1074 Human Orphan designation details
  ,,   EU/3/12/1064 Human Orphan designation details
aliskiren Enviage EU/1/07/406 Human Centralised details
  ,, Rasilez EU/1/07/405 Human Centralised details
  ,, Riprazo EU/1/07/409 Human Centralised details
  ,, Sprimeo EU/1/07/407 Human Centralised details
  ,, Tekturna EU/1/07/408 Human Centralised details
aliskiren / amlodipine Rasilamlo EU/1/11/686 Human Centralised details
aliskiren / amlodipine / hydrochlorothiazide Rasitrio EU/1/11/730 Human Centralised details
aliskiren hemifumarate / hydrochlorothiazide Rasilez HCT EU/1/08/491 Human Centralised details
aliskiren / hydrochlorothiazide Riprazo HCT EU/1/11/680 Human Centralised details
  ,, Sprimeo HCT EU/1/11/683 Human Centralised details
alitretinoin Panretin EU/1/00/149 Human Centralised details
Allantoin   EU/3/13/1232 Human Orphan designation details
Allogeneic adipose-derived adult mesenchymal stem cells contained in a fibrin-based bioengineered dermis   EU/3/14/1407 Human Orphan designation details
Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma   EU/3/13/1211 Human Orphan designation details
Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix   EU/3/10/843 Human Orphan designation details
Allogeneic bone-marrow derived ex-vivo expanded multipotent adult progenitor cells   EU/3/13/1233 Human Orphan designation details
Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media   EU/3/14/1388 Human Orphan designation details
  ,,   EU/3/13/1129 Human Orphan designation details
Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2   EU/3/11/866 Human Orphan designation details
Allogeneic CD34+ cells expanded ex vivo with an aryl hydrocarbon receptor antagonist   EU/3/14/1382 Human Orphan designation details
Allogeneic CD4+ and CD25+ T lymphocytes ex vivo incubated with GP120   EU/3/18/1976 Human Orphan designation details
Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus   EU/3/15/1439 Human Orphan designation details
  ,,   EU/3/15/1438 Human Orphan designation details
  ,,   EU/3/15/1440 Human Orphan designation details
Allogeneic cytomegalovirus-specific cytotoxic T lymphocytes   EU/3/16/1773 Human Orphan designation details
Allogeneic donor-derived ex-vivo expanded T lymphocytes transduced with a retroviral vector containing inducible caspase 9 and truncated CD19   EU/3/16/1674 Human Orphan designation details
Allogeneic Epstein-Barr virus specific cytotoxic T lymphocytes   EU/3/16/1627 Human Orphan designation details
Allogeneic ex-vivo-expanded human umbilical cord blood-derived mesenchymal stem cells   EU/3/15/1503 Human Orphan designation details
Allogeneic ex vivo expanded umbilical cord blood cells   EU/3/09/619 Human Orphan designation details
  ,,   EU/3/09/665 Human Orphan designation details
  ,,   EU/3/09/649 Human Orphan designation details
  ,,   EU/3/09/618 Human Orphan designation details
  ,,   EU/3/09/664 Human Orphan designation details
Allogeneic ex-vivo-expanded umbilical cord blood-derived hematopoietic CD34+ progenitor cells and allogeneic non-expanded umbilical cord blood-derived hematopoietic mature myeloid and lymphoid cells   EU/3/17/1852 Human Orphan designation details
Allogeneic ex vivo-generated natural killer cells from CD34+ umbilical cord blood progenitor cells   EU/3/14/1395 Human Orphan designation details
Allogeneic fetal human retinal progenitor cells expanded ex vivo   EU/3/16/1620 Human Orphan designation details
Allogeneic human adult stem cells, isolated from skeletal muscle and expanded ex vivo   EU/3/15/1519 Human Orphan designation details
Allogeneic human dendritic cells derived from a CD34+ progenitor cell line   EU/3/12/969 Human Orphan designation details
Allogeneic human dermal fibroblasts   EU/3/10/774 Human Orphan designation details
Allogeneic human umbilical cord tissue-derived cells   EU/3/08/534 Human Orphan designation details
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells   EU/3/13/1155 Human Orphan designation details
  ,,   EU/3/12/1088 Human Orphan designation details
Allogeneic peripheral blood mononuclear cells incubated ex vivo with 16, 16-dimethyl prostaglandin E2 and dexamethasone   EU/3/16/1774 Human Orphan designation details
Allogeneic peripheral blood mononuclear cells induced to an early apoptotic state   EU/3/14/1426 Human Orphan designation details
Allogeneic T cells encoding an exogenous TK gene   EU/3/10/773 Human Orphan designation details
  ,,   EU/3/11/878 Human Orphan designation details
Allogeneic T cells genetically modified with a retroviral vector encoding for a truncated form of the human low affinity nerve growth factor receptor (ΔLNGFR) and the herpes simplex I virus thymidine kinase (HSV-TK Mut2) Zalmoxis EU/1/16/1121 Human Centralised details
Allogeneic umbilical cord blood CD34+ cells cultured ex vivo with Notch ligand Delta1   EU/3/17/1958 Human Orphan designation details
Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2   EU/3/15/1546 Human Orphan designation details
  ,,   EU/3/11/867 Human Orphan designation details
Allogeneic, umbilical cord blood-derived, ex vivo-expanded, haematopoietic CD133+ cells / allogeneic, umbilical cord blood-derived, non-expanded, haematopoietic CD133- cells   EU/3/14/1413 Human Orphan designation details
Allopurinol sodium   EU/3/12/1076 Human Orphan designation details
  ,,   EU/3/15/1493 Human Orphan designation details
alogliptin Vipidia EU/1/13/844 Human Centralised details
alogliptin / metformin Vipdomet EU/1/13/843 Human Centralised details
alogliptin / pioglitazone Incresync EU/1/13/842 Human Centralised details
Alpha-1 antitrypsin (inhalation use)   EU/3/04/244 Human Orphan designation details
  ,,   EU/3/04/243 Human Orphan designation details
Alpha-1 proteinase inhibitor   EU/3/06/350 Human Orphan designation details
Alpha-1 proteinase inhibitor (for inhalation use)   EU/3/12/1045 Human Orphan designation details
Alpha-1 proteinase inhibitor (inhalation use)   EU/3/08/546 Human Orphan designation details
  ,,   EU/3/07/474 Human Orphan designation details
Alpha-Galactosidase A   EU/3/00/003 Human Orphan designation details
  ,,   EU/3/00/002 Human Orphan designation details
Alpha-tocopherol   EU/3/16/1775 Human Orphan designation details
Alpha-tocopherol and ascorbic acid   EU/3/17/1832 Human Orphan designation details
Alpha-tocotrienol quinone   EU/3/11/937 Human Orphan designation details
Alteplase Actilyse   Human Referral details
Altrenogest Altrenogest   Veterinary Referral details
  ,, Suifertil 4 mg/ml Oral Solution for Pigs and associated names   Veterinary Referral details
  ,, Synchroplan   Veterinary Referral details
Alvocidib   EU/3/07/485 Human Orphan designation details
  ,,   EU/3/15/1437 Human Orphan designation details
Amatuximab   EU/3/13/1222 Human Orphan designation details
Ambrisentan Volibris EU/1/08/451 Human Centralised details
  ,,   EU/3/05/273 Human Orphan designation details
  ,,   EU/3/10/790 Human Orphan designation details
ambroxol and bromhexine AMBROinfant   Human Referral details
  ,, Abrobion   Human Referral details
  ,, Aflegan   Human Referral details
  ,, Afrodor   Human Referral details
  ,, Ambex   Human Referral details
  ,, Ambixol   Human Referral details
  ,, Amboral   Human Referral details
  ,, Ambrex   Human Referral details
  ,, Ambrin   Human Referral details
  ,, Ambro   Human Referral details
  ,, Ambro-AbZ   Human Referral details
  ,, Ambro-CT   Human Referral details
  ,, Ambro-Hemopharm Hustensaft   Human Referral details
  ,, Ambro-ratiopharm   Human Referral details
  ,, Ambrobene   Human Referral details
  ,, Ambrobeta   Human Referral details
  ,, Ambrobeta Saft   Human Referral details
  ,, Ambrohexal   Human Referral details
  ,, Ambroksol   Human Referral details
  ,, Ambroksolijev klorid Berlin-Chemie   Human Referral details
  ,, Ambroksols Stirol   Human Referral details
  ,, Ambrolan   Human Referral details
  ,, Ambrolex R   Human Referral details
  ,, Ambrosan   Human Referral details
  ,, Ambrosan kapky   Human Referral details
  ,, Ambrosol Teva   Human Referral details
  ,, Ambrosolvan   Human Referral details
  ,, Ambrospray   Human Referral details
  ,, Ambrotaxer   Human Referral details
  ,, Ambrotus   Human Referral details
  ,, Ambrox-Denk   Human Referral details
  ,, Ambroxhexal   Human Referral details
  ,, Ambroxin-Tropfen   Human Referral details
  ,, Ambroxine   Human Referral details
  ,, Ambroxo Brause   Human Referral details
  ,, Ambroxo Hermes   Human Referral details
  ,, Ambroxol   Human Referral details
  ,, Ambroxolhydrochloride Cyathus   Human Referral details
  ,, Ambroxoli hydrochloridum Fontane   Human Referral details
  ,, Ambroxolo   Human Referral details
  ,, Amdox-Puren   Human Referral details
  ,, Amobronc   Human Referral details
  ,, Anavix   Human Referral details
  ,, Aprinol   Human Referral details
  ,, Axol   Human Referral details
  ,, BISOLVOMYCINE   Human Referral details
  ,, BROMFLUEX   Human Referral details
  ,, BRONCHOSAN   Human Referral details
  ,, BRONHOSOLV   Human Referral details
  ,, Bactopumon   Human Referral details
  ,, Balsoprim suspensión   Human Referral details
  ,, Basiflux   Human Referral details
  ,, Benflux   Human Referral details
  ,, Bisolangin   Human Referral details
  ,, Bisolaryn gegen Halzschmerzen   Human Referral details
  ,, Bisolex   Human Referral details
  ,, Bisolmed   Human Referral details
  ,, Bisolvon   Human Referral details
  ,, Braxol   Human Referral details
  ,, Bromax   Human Referral details
  ,, Bromexina   Human Referral details
  ,, Bromhex   Human Referral details
  ,, Bromhexin   Human Referral details
  ,, Bromhexine   Human Referral details
  ,, Bromocal   Human Referral details
  ,, Bron-Hal   Human Referral details
  ,, Bronchi-Mereprine   Human Referral details
  ,, Broncho-Euphyllin retard   Human Referral details
  ,, Bronchotussine   Human Referral details
  ,, Broncoliber   Human Referral details
  ,, Broncolyn   Human Referral details
  ,, Broncosil   Human Referral details
  ,, Bronquidiazina CR suspensión   Human Referral details
  ,, Brontex   Human Referral details
  ,, Bronxol   Human Referral details
  ,, Broomhexine HCI   Human Referral details
  ,, Broomhexinehydrochloride   Human Referral details
  ,, Broxol   Human Referral details
  ,, Brufix   Human Referral details
  ,, Bunafon   Human Referral details
  ,, C1000 Hoestdrank Broomhexine HCl   Human Referral details
  ,, Celibron   Human Referral details
  ,, Clamoxyl mucolítico   Human Referral details
  ,, Deflegmin   Human Referral details
  ,, Dinobroxol jarabe   Human Referral details
  ,, Doxam   Human Referral details
  ,, Doxy   Human Referral details
  ,, Drenoxol   Human Referral details
  ,, Ebertuss   Human Referral details
  ,, Entus Junior   Human Referral details
  ,, Entus Max   Human Referral details
  ,, Envil kaszel   Human Referral details
  ,, Expit   Human Referral details
  ,, Flavamed   Human Referral details
  ,, Flecoxin   Human Referral details
  ,, Flegamina   Human Referral details
  ,, Flegatussin   Human Referral details
  ,, Fluibron   Human Referral details
  ,, Fluibrox   Human Referral details
  ,, Fluidrenol   Human Referral details
  ,, Flutoxil   Human Referral details
  ,, Formulamucol   Human Referral details
  ,, Gammaxol   Human Referral details
  ,, Gogolox   Human Referral details
  ,, Grenovix   Human Referral details
  ,, Grippostad Ambro   Human Referral details
  ,, HEMA Hoestdrank Broomhexine HCl   Human Referral details
  ,, Halixol   Human Referral details
  ,, Hoestdrank Broomhexine HCl   Human Referral details
  ,, Hoesttabletten Broomhexine HCl   Human Referral details
  ,, Hyvotex   Human Referral details
  ,, IDYL Hoestdrank Broomhexine HCl   Human Referral details
  ,, IDYL hoesttabletten   Human Referral details
  ,, JUMBO Hoestdrank Broomhexine HCl   Human Referral details
  ,, JUMBO hoesttabletten broomhexine HCl   Human Referral details
  ,, Kriolen   Human Referral details
  ,, Kruidvat HOESTDRANK Broomhexine HCl   Human Referral details
  ,, LYSOPAĎNE MAUX DE GORGE AMBROXOL   Human Referral details
  ,, Lactucol   Human Referral details
  ,, Lasolvan   Human Referral details
  ,, Leidapharm Hoestdrank Broomhexine HCl   Human Referral details
  ,, Lindoxyl K   Human Referral details
  ,, Lintos   Human Referral details
  ,, Lisomucin   Human Referral details
  ,, Lizipadol   Human Referral details
  ,, Lysopadol   Human Referral details
  ,, MEDIPEKT   Human Referral details
  ,, MEDOX   Human Referral details
  ,, MUCOFREE   Human Referral details
  ,, MUCOVIN   Human Referral details
  ,, Medovent   Human Referral details
  ,, Mollipect   Human Referral details
  ,, Motosol   Human Referral details
  ,, Mucibron   Human Referral details
  ,, Muciclar   Human Referral details
  ,, Mucoangin   Human Referral details
  ,, Mucoangine   Human Referral details
  ,, Mucoaricodil   Human Referral details
  ,, Mucobroxol   Human Referral details
  ,, Mucodrenol   Human Referral details
  ,, Mucolin   Human Referral details
  ,, Mucolisin   Human Referral details
  ,, Mucosan   Human Referral details
  ,, Mucosin   Human Referral details
  ,, Mucosolvan   Human Referral details
  ,, Mucospas   Human Referral details
  ,, Mucotosse   Human Referral details
  ,, Mucovix   Human Referral details
  ,, Mukambro   Human Referral details
  ,, Muxol   Human Referral details
  ,, NASOPAX   Human Referral details
  ,, NEDAC SORBO   Human Referral details
  ,, Naxpa jarabe   Human Referral details
  ,, Neo-bronchol   Human Referral details
  ,, Nibren   Human Referral details
  ,, Nirolex tosse e catarro   Human Referral details
  ,, Otrivin Broomhexine HCI   Human Referral details
  ,, Paxirasol   Human Referral details
  ,, Physiosolvan   Human Referral details
  ,, Pro-Ambrosan   Human Referral details
  ,, Provixen-N   Human Referral details
  ,, Pädiamuc Saft   Human Referral details
  ,, ROMHEXIN SLAVIA   Human Referral details
  ,, Rexambro   Human Referral details
  ,, STREPSILS EXPECTORANT   Human Referral details
  ,, Saribal   Human Referral details
  ,, Secretil   Human Referral details
  ,, Sigamuc   Human Referral details
  ,, Solvolan   Human Referral details
  ,, Spasmo-Mucosolvan   Human Referral details
  ,, Spectorum Expectorante   Human Referral details
  ,, Stefolant   Human Referral details
  ,, Stopex na vykašliavanie   Human Referral details
  ,, Strubelin   Human Referral details
  ,, Surbronc   Human Referral details
  ,, Surfactal   Human Referral details
  ,, Tauglicolo   Human Referral details
  ,, Tauxolo   Human Referral details
  ,, Tevoril   Human Referral details
  ,, Tosse   Human Referral details
  ,, Tosseque   Human Referral details
  ,, Toularynx Bromhexine   Human Referral details
  ,, Trekpleister HOESTDRANK Broomhexine HCl   Human Referral details
  ,, Trekpleister hoesttabletten   Human Referral details
  ,, Tusmed   Human Referral details
  ,, Tussal Expectorans   Human Referral details
  ,, Tussefar   Human Referral details
  ,, Tussisol   Human Referral details
  ,, VICKS EXPECTORANT AMBROXOL   Human Referral details
  ,, Ventibron   Human Referral details
  ,, Ventoliber   Human Referral details
  ,, Vicks Hoestdrank broomhexinehydrochloride   Human Referral details
  ,, Vicks tosse mucolitico   Human Referral details
  ,, Viscomucil   Human Referral details
  ,, Wick Hustenlöser Therapie   Human Referral details
  ,, Wick Schleimlöser   Human Referral details
  ,, Zerinol Gola   Human Referral details
  ,, ambroxol or bromhexine   Human Referral details
Amfepramone Amfepramone   Human Referral details
  ,, Anorex   Human Referral details
  ,, Atractil   Human Referral details
  ,, Delgamer   Human Referral details
  ,, Dietil - Retard   Human Referral details
  ,, Dobesin   Human Referral details
  ,, Essential Nutrition Diethylopropion Hydrochloride Tablets 25 mg   Human Referral details
  ,, Linea   Human Referral details
  ,, Linea Valeas   Human Referral details
  ,, Menutil   Human Referral details
  ,, Moderatan   Human Referral details
  ,, Prefamone   Human Referral details
  ,, Regenon   Human Referral details
  ,, Tenuate Dospan   Human Referral details
  ,, Tenuate Retard   Human Referral details
amifampridine Firdapse EU/1/09/601 Human Centralised details
Amikacin sulfate   EU/3/14/1397 Human Orphan designation details
  ,,   EU/3/14/1259 Human Orphan designation details
Amikacin sulfate (liposomal)   EU/3/06/387 Human Orphan designation details
Amiloride hydrochloride dihydrate   EU/3/03/147 Human Orphan designation details
aminocaproic acid Acepramin   Human Referral details
  ,, Aminocaproic acid containing medicinal products   Human Referral details
  ,, Caproamin FIDES   Human Referral details
  ,, Epsicaprom   Human Referral details
amitriptyline Redomex   Human Referral details
  ,, Redomex Diffucaps   Human Referral details
  ,, Saroten   Human Referral details
  ,, Saroten Retard   Human Referral details
  ,, Saroten Tabs   Human Referral details
  ,, Saroten and associated names   Human Referral details
  ,, Sarotex   Human Referral details
  ,, Sarotex Retard   Human Referral details
A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein   EU/3/05/317 Human Orphan designation details
amlodipine Amlodipine Pfizer   Human Referral details
  ,, Amlodipine besilate   Human Referral details
  ,, Amlodipino Pharmacia   Human Referral details
  ,, Amlor   Human Referral details
  ,, Istin   Human Referral details
  ,, Lodipressin   Veterinary Centralised Refusal details
  ,, Monopina   Human Referral details
  ,, Norvas   Human Referral details
  ,, Norvasc and associated names   Human Referral details
amlodipine besylate / valsartan / hydrochlorothiazide Copalia HCT EU/1/09/575 Human Centralised details
  ,, Dafiro HCT EU/1/09/574 Human Centralised details
  ,, Exforge HCT EU/1/09/569 Human Centralised details
  ,, Imprida HCT EU/1/09/570 Human Centralised details
Amlodipine maleate Amlodipine Wörwag   Human Referral details
  ,, Amlovita   Human Referral details
  ,, Pidolma   Human Referral details
amlodipine/valsartan Amlodipine/Valsartan Mylan EU/1/16/1092 Human Centralised details
  ,, Copalia EU/1/06/372 Human Centralised details
  ,, Dafiro EU/1/06/371 Human Centralised details
  ,, Exforge EU/1/06/370 Human Centralised details
  ,, Imprida EU/1/06/373 Human Centralised details
Ammonium tetrathiomolybdate   EU/3/08/539 Human Orphan designation details
Amonafide L-malate   EU/3/07/483 Human Orphan designation details
amoxicillin Amoxicilline Biogaran   Human Referral details
  ,, Amoxil and associated names   Human Referral details
  ,, Clamoxyl   Human Referral details
  ,, Stabox 15% LA   Veterinary Referral details
  ,, Suramox 15% LA - Stabox 15% LA   Veterinary Referral details
Amoxicillin and clavulanic acid Amoxicilina/Ác. Clavulanico ALLEN   Human Referral details
  ,, Amoxicilline/Clavulaanzuur   Human Referral details
  ,, Augmentin   Human Referral details
  ,, Augmentine   Human Referral details
  ,, Clavamel   Human Referral details
  ,, Clavamox   Human Referral details
  ,, Clavepen   Human Referral details
  ,, Clavulin   Human Referral details
  ,, Clavumox   Human Referral details
  ,, Neoduplamox   Human Referral details
  ,, Noprilam   Human Referral details
  ,, Pangamox   Human Referral details
  ,, Penilan   Human Referral details
  ,, Spektramox   Human Referral details
Amoxicillin, clavulanic acid Clavudale 50 mg   Veterinary Referral details
  ,, STRENZEN 500/125 mg/g powder for use in drinking water for pigs   Veterinary Referral details
amoxicillin, clavulanic acid and prednisolone Nisamox Lactating Cow Intramammary Suspension   Veterinary Referral details
Amoxicillin trihydrate Solamocta   Veterinary Referral details
Amoxicillin trihydrate, potassium clavulanate, prednisolone Synulox Lactating Cow   Veterinary Referral details
Amphotericin B (for inhalation use)   EU/3/06/391 Human Orphan designation details
amprenavir Agenerase EU/1/00/148 Human Centralised details
Amrubicin hydrochloride   EU/3/08/538 Human Orphan designation details
anagrelide Anagrelide   Human Referral details
  ,, Anagrelide Mylan EU/1/17/1256 Human Centralised details
  ,, Xagrid EU/1/04/295 Human Centralised details
  ,, anagrelide   Human Referral details
Anagrelide Hydrochloride   EU/3/00/010 Human Orphan designation details
Anakinra Kineret EU/1/02/203 Human Centralised details
anamorelin Adlumiz   Human Centralised Refusal details
anastrazole Arimidex   Human Referral details
  ,, Arimidex and associated names   Human Referral details
anidulafungin Ecalta EU/1/07/416 Human Centralised details
A non-covalent trimer of tumour necrosis factor fused to an antibody specific to the extra-domain B of fibronectin in single-chain variable fragment format   EU/3/16/1739 Human Orphan designation details
anti-CD147 murine monoclonal IgM   EU/3/02/123 Human Orphan designation details
Anti-EphA2 monoclonal antibody conjugated to maleimidocaproyl monomethylauristatin phenylalanine   EU/3/09/682 Human Orphan designation details
Anti epidermal growth factor receptor antibody h-R3   EU/3/04/220 Human Orphan designation details
Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody   EU/3/04/193 Human Orphan designation details
Anti-H5N1 equine immunoglobulin F(ab')2 fragments   EU/3/15/1512 Human Orphan designation details
Anti-melanoma Mab fragments Tecnemab-K-1 EU/1/96/019 Human Centralised details
Antisense NF-Kß p65 Oligonucleotide   EU/3/02/106 Human Orphan designation details
Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3'   EU/3/06/416 Human Orphan designation details
Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA   EU/3/16/1641 Human Orphan designation details
Antisense oligonucleotide directed against TGF-beta2 mRNA   EU/3/15/1506 Human Orphan designation details
Antisense oligonucleotide targeted to the SMN2 gene   EU/3/12/976 Human Orphan designation details
Antisense oligonucleotide targeting exon 13 in the USH2A gene   EU/3/17/1899 Human Orphan designation details
Antisense oligonucleotide targeting exon 73 in the COL7A1 gene   EU/3/17/1938 Human Orphan designation details
Antisense oligonucleotide targeting the F508delta mutation of CFTR   EU/3/13/1195 Human Orphan designation details
Antisense oligonucleotide targeting the USH2A gene   EU/3/17/1853 Human Orphan designation details
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)   EU/3/07/445 Human Orphan designation details
  ,,   EU/3/03/160 Human Orphan designation details
  ,,   EU/3/03/161 Human Orphan designation details
antithrombin alfa ATryn EU/1/06/355 Human Centralised details
Anti-von Willebrand Aptamer   EU/3/08/547 Human Orphan designation details
Antroquinonol   EU/3/16/1812 Human Orphan designation details
apixaban Eliquis EU/1/11/691 Human Centralised details
Aplidine   EU/3/03/151 Human Orphan designation details
  ,,   EU/3/04/245 Human Orphan designation details
apomorphine hydrochloride Ixense EU/1/01/181 Human Centralised details
  ,, Taluvian EU/1/01/182 Human Centralised details
  ,, Uprima EU/1/01/180 Human Centralised details
  ,,   EU/3/11/862 Human Orphan designation details
Apomorphine hydrochloride (inhalation use)   EU/3/06/349 Human Orphan designation details
Apomorphine (oromucosal use)   EU/3/01/072 Human Orphan designation details
apremilast Otezla EU/1/14/981 Human Centralised details
  ,,   EU/3/13/1180 Human Orphan designation details
aprepitant Emend EU/1/03/262 Human Centralised details
Aprotinin Antilysin Spofa   Human Referral details
  ,, Aprotinin   Human Referral details
  ,, Gordox   Human Referral details
  ,, Pantinol   Human Referral details
  ,, Traskolan   Human Referral details
  ,, Trasylol   Human Referral details
  ,, Trasynin   Human Referral details
Arcitumomab CEA-Scan EU/1/96/023 Human Centralised details
Arimoclomol   EU/3/06/406 Human Orphan designation details
Arimoclomol citrate   EU/3/14/1376 Human Orphan designation details
  ,,   EU/3/16/1659 Human Orphan designation details
Aripiprazole ABILIFY MAINTENA EU/1/13/882 Human Centralised details
  ,, Abilify EU/1/04/276 Human Centralised details
  ,, Aripiprazole   Human Referral details
  ,, Aripiprazole Accord EU/1/15/1045 Human Centralised details
  ,, Aripiprazole Mylan Pharma EU/1/15/1005 Human Centralised details
  ,, Aripiprazole Sandoz EU/1/15/1029 Human Centralised details
  ,, Aripiprazole Zentiva EU/1/15/1009 Human Centralised details
Arsenic trioxide Trisenox EU/1/02/204 Human Centralised details
  ,,   EU/3/00/008 Human Orphan designation details
  ,,   EU/3/07/460 Human Orphan designation details
  ,,   EU/3/01/032 Human Orphan designation details
  ,,   EU/3/01/031 Human Orphan designation details
  ,,   EU/3/00/017 Human Orphan designation details
  ,,   EU/3/16/1797 Human Orphan designation details
  ,,   EU/3/16/1610 Human Orphan designation details
artesunate   EU/3/07/430 Human Orphan designation details
  ,,   EU/3/12/1079 Human Orphan designation details
  ,,   EU/3/15/1521 Human Orphan designation details
  ,,   EU/3/07/510 Human Orphan designation details
ascorbic acid   EU/3/08/531 Human Orphan designation details
  ,,   EU/3/16/1776 Human Orphan designation details
asenapine Sycrest EU/1/10/640 Human Centralised details
asfotase alfa Strensiq EU/1/15/1015 Human Centralised details
asparaginase Spectrila EU/1/15/1072 Human Centralised details
Asp-Arg-Val-Tyr-Ile-His-Pro   EU/3/14/1241 Human Orphan designation details
  ,,   EU/3/17/1879 Human Orphan designation details
  ,,   EU/3/12/1047 Human Orphan designation details
Asunercept   EU/3/17/1900 Human Orphan designation details
ataluren Translarna EU/1/13/902 Human Centralised details
  ,,   EU/3/14/1380 Human Orphan designation details
  ,,   EU/3/15/1561 Human Orphan designation details
  ,,   EU/3/12/1010 Human Orphan designation details
atazanavir Atazanavir Mylan EU/1/16/1091 Human Centralised details
atazanavir / cobicistat EVOTAZ EU/1/15/1025 Human Centralised details
atazanavir sulphate Reyataz EU/1/03/267 Human Centralised details
atezolizumab Tecentriq EU/1/17/1220 Human Centralised details
Atomoxetine, Citalopram, Escitalopram, Fluoxetine, Fluvoxamine, Mianserine, Milnacipran, Mirtazapine, Paroxetine, Reboxetine, Sertraline and Venlafaxine APO-Fluoxetin   Human Referral details
  ,, Adofen   Human Referral details
  ,, Afeksin   Human Referral details
  ,, Affex   Human Referral details
  ,, Akarin   Human Referral details
  ,, Alexandras   Human Referral details
  ,, Aliantil   Human Referral details
  ,, Allenopar   Human Referral details
  ,, Alphamirt   Human Referral details
  ,, Alphazagen   Human Referral details
  ,, Altisben   Human Referral details
  ,, Andepin   Human Referral details
  ,, Andepril   Human Referral details
  ,, Antideprimal   Human Referral details
  ,, Apertia   Human Referral details
  ,, Apo-Fluoxetine   Human Referral details
  ,, Apo-Parox   Human Referral details
  ,, Apo-Sertral   Human Referral details
  ,, Apodepi   Human Referral details
  ,, Aremis   Human Referral details
  ,, Arintapin   Human Referral details
  ,, Arintapina   Human Referral details
  ,, Arketis   Human Referral details
  ,, Aropax   Human Referral details
  ,, Aroxetin   Human Referral details
  ,, Asentra   Human Referral details
  ,, Athymil   Human Referral details
  ,, Augort   Human Referral details
  ,, Aurex   Human Referral details
  ,, Besitran   Human Referral details
  ,, Biofloxoral   Human Referral details
  ,, Bioglan Fluoxetine   Human Referral details
  ,, Biopram   Human Referral details
  ,, Bioxetin   Human Referral details
  ,, Biozac & Prozit   Human Referral details
  ,, Casbol   Human Referral details
  ,, Cerotor   Human Referral details
  ,, Ciazil   Human Referral details
  ,, Cimax   Human Referral details
  ,, Cinapen   Human Referral details
  ,, Ciprager   Human Referral details
  ,, Cipralex   Human Referral details
  ,, Cipram   Human Referral details
  ,, Cipramil   Human Referral details
  ,, Ciprapinie   Human Referral details
  ,, Ciprotan   Human Referral details
  ,, Ciral   Human Referral details
  ,, Cita   Human Referral details
  ,, CitaLich   Human Referral details
  ,, Citabax   Human Referral details
  ,, Citacip   Human Referral details
  ,, Citadur   Human Referral details
  ,, Citadura   Human Referral details
  ,, Citaham   Human Referral details
  ,, Citalec   Human Referral details
  ,, Citaleq   Human Referral details
  ,, Citalexal   Human Referral details
  ,, Citalhexal   Human Referral details
  ,, Citalo-Q   Human Referral details
  ,, Citalobexal   Human Referral details
  ,, Citalogea   Human Referral details
  ,, Citalogen   Human Referral details
  ,, Citalon   Human Referral details
  ,, Citalonte   Human Referral details
  ,, Citalop   Human Referral details
  ,, Citalophex   Human Referral details
  ,, Citalopram   Human Referral details
  ,, Citalostad   Human Referral details
  ,, Citalvir   Human Referral details
  ,, Citamocal   Human Referral details
  ,, Citapram   Human Referral details
  ,, Citarcana   Human Referral details
  ,, Citavie   Human Referral details
  ,, Citoglan   Human Referral details
  ,, Citor   Human Referral details
  ,, Clexiclor   Human Referral details
  ,, Cloriflox   Human Referral details
  ,, Combar   Human Referral details
  ,, Dagrilan   Human Referral details
  ,, Dalcipran   Human Referral details
  ,, Daparox   Human Referral details
  ,, Davedax   Human Referral details
  ,, Deborax   Human Referral details
  ,, Denerval   Human Referral details
  ,, Deoxatine   Human Referral details
  ,, Depar   Human Referral details
  ,, Depesert   Human Referral details
  ,, Deprenon   Human Referral details
  ,, Deprex   Human Referral details
  ,, Deprexen   Human Referral details
  ,, Deprexetin   Human Referral details
  ,, Deprexin   Human Referral details
  ,, Deprimaks   Human Referral details
  ,, Deprozel   Human Referral details
  ,, Deroxat   Human Referral details
  ,, Desifluvoxamin   Human Referral details
  ,, Desital   Human Referral details
  ,, Diesan   Human Referral details
  ,, Digassim   Human Referral details
  ,, Dinalexin   Human Referral details
  ,, Divarius   Human Referral details
  ,, Dobupal   Human Referral details
  ,, Doc Sertraline   Human Referral details
  ,, Docfluoxetine   Human Referral details
  ,, Dumirox   Human Referral details
  ,, Dumyrox   Human Referral details
  ,, Edronax   Human Referral details
  ,, Efectin   Human Referral details
  ,, Efexor   Human Referral details
  ,, Effexor   Human Referral details
  ,, Efique   Human Referral details
  ,, Elindra   Human Referral details
  ,, Elopram   Human Referral details
  ,, Emaxo   Human Referral details
  ,, Emocal   Human Referral details
  ,, Ennos   Human Referral details
  ,, Entact   Human Referral details
  ,, Eostar   Human Referral details
  ,, Eoxat   Human Referral details
  ,, Esertia   Human Referral details
  ,, Esprital   Human Referral details
  ,, Euplix   Human Referral details
  ,, Eutimil   Human Referral details
  ,, Evexor   Human Referral details
  ,, Exostrept   Human Referral details
  ,, Faverin   Human Referral details
  ,, Faxine   Human Referral details
  ,, Fefluzin   Human Referral details
  ,, Felicium   Human Referral details
  ,, Felipram   Human Referral details
  ,, Felixsan   Human Referral details
  ,, Fevarin   Human Referral details
  ,, Finmirtaza   Human Referral details
  ,, Finpharma   Human Referral details
  ,, Finscope   Human Referral details
  ,, Flizak   Human Referral details
  ,, Floccin   Human Referral details
  ,, Flonital   Human Referral details
  ,, Flotina   Human Referral details
  ,, Floxet   Human Referral details
  ,, Floxin   Human Referral details
  ,, Floxyfral   Human Referral details
  ,, Flucti-nerton   Human Referral details
  ,, Fluctin   Human Referral details
  ,, Fluctine   Human Referral details
  ,, Flumirex   Human Referral details
  ,, Fluneurin   Human Referral details
  ,, Fluoksetiini   Human Referral details
  ,, Fluoksetyna   Human Referral details
  ,, Fluox   Human Referral details
  ,, Fluoxa   Human Referral details
  ,, Fluoxe-Q   Human Referral details
  ,, Fluoxemed   Human Referral details
  ,, Fluoxemerck   Human Referral details
  ,, Fluoxenase   Human Referral details
  ,, Fluoxeren   Human Referral details
  ,, Fluoxetin   Human Referral details
  ,, Fluoxetina   Human Referral details
  ,, Fluoxetine   Human Referral details
  ,, Fluoxetop   Human Referral details
  ,, Fluoxgamma   Human Referral details
  ,, Fluoxibene   Human Referral details
  ,, Fluoxifar   Human Referral details
  ,, Fluoxin   Human Referral details
  ,, Fluoxistad   Human Referral details
  ,, Fluoxkaps   Human Referral details
  ,, Fluoxone   Human Referral details
  ,, Fluoxtab   Human Referral details
  ,, Flustad   Human Referral details
  ,, Flutin   Human Referral details
  ,, Fluval   Human Referral details
  ,, Fluvohexal   Human Referral details
  ,, Fluvosol   Human Referral details
  ,, Fluvox   Human Referral details
  ,, Fluvoxabeta   Human Referral details
  ,, Fluvoxadura   Human Referral details
  ,, Fluvoxam   Human Referral details
  ,, Fluvoxamin   Human Referral details
  ,, Fluvoxamina   Human Referral details
  ,, Fluvoxamine   Human Referral details
  ,, Fluvoxaminemaleaat   Human Referral details
  ,, Fluvoxaminmaleat   Human Referral details
  ,, Flux   Human Referral details
  ,, Fluxadir   Human Referral details
  ,, Fluxantin   Human Referral details
  ,, Fluxet   Human Referral details
  ,, Fluxetil   Human Referral details
  ,, Fluxil   Human Referral details
  ,, FluxoMed   Human Referral details
  ,, Fluxone   Human Referral details
  ,, Fokeston   Human Referral details
  ,, Folizol   Human Referral details
  ,, Fondur   Human Referral details
  ,, Fontex   Human Referral details
  ,, Fonzac   Human Referral details
  ,, Foxet   Human Referral details
  ,, Framex   Human Referral details
  ,, Frimaind   Human Referral details
  ,, Futuril   Human Referral details
  ,, Genamirt   Human Referral details
  ,, Genprol   Human Referral details
  ,, Gerozac   Human Referral details
  ,, Gladem   Human Referral details
  ,, Glaxopar   Human Referral details
  ,, Grinflux   Human Referral details
  ,, Hapilux   Human Referral details
  ,, Hexazipin   Human Referral details
  ,, Hiemalix   Human Referral details
  ,, Ibixetin   Human Referral details
  ,, Inpharmco-Mianserin   Human Referral details
  ,, Ipsumor   Human Referral details
  ,, Irenor   Human Referral details
  ,, Isoxatine   Human Referral details
  ,, Ixel   Human Referral details
  ,, Ladose   Human Referral details
  ,, Lantanon   Human Referral details
  ,, Lecimar   Human Referral details
  ,, Lerivon   Human Referral details
  ,, Lexapro   Human Referral details
  ,, Lisemir   Human Referral details
  ,, Lontax   Human Referral details
  ,, Loxopram   Human Referral details
  ,, Loxozapin   Human Referral details
  ,, Luramon   Human Referral details
  ,, Lustragen   Human Referral details
  ,, Lustral   Human Referral details
  ,, Lustramerck   Human Referral details
  ,, Luvox   Human Referral details
  ,, Magrilan   Human Referral details
  ,, Maveral   Human Referral details
  ,, Mediparox   Human Referral details
  ,, Medizapin   Human Referral details
  ,, Medoxatine   Human Referral details
  ,, Megafors   Human Referral details
  ,, Meloxat   Human Referral details
  ,, Meparox   Human Referral details
  ,, Meradel   Human Referral details
  ,, Miabene   Human Referral details
  ,, Miagen   Human Referral details
  ,, Mianeurin   Human Referral details
  ,, Miansemerck   Human Referral details
  ,, Mianserin   Human Referral details
  ,, Mianserine   Human Referral details
  ,, Mianserixx   Human Referral details
  ,, Miaxan   Human Referral details
  ,, Milnacipran   Human Referral details
  ,, Miralix   Human Referral details
  ,, Mirap   Human Referral details
  ,, Mirta   Human Referral details
  ,, Mirta-ratiopharm   Human Referral details
  ,, MirtaLich   Human Referral details
  ,, Mirtabene   Human Referral details
  ,, Mirtachem   Human Referral details
  ,, Mirtacur   Human Referral details
  ,, Mirtadepi   Human Referral details
  ,, Mirtagamma   Human Referral details
  ,, Mirtal   Human Referral details
  ,, Mirtalphagen   Human Referral details
  ,, Mirtamed   Human Referral details
  ,, Mirtamerck   Human Referral details
  ,, Mirtapharm   Human Referral details
  ,, Mirtapin   Human Referral details
  ,, Mirtaratio   Human Referral details
  ,, Mirtaril   Human Referral details
  ,, Mirtaron   Human Referral details
  ,, Mirtascope   Human Referral details
  ,, Mirtasole   Human Referral details
  ,, Mirtastada   Human Referral details
  ,, Mirtatifi   Human Referral details
  ,, Mirtatsapiini   Human Referral details
  ,, Mirtazapin   Human Referral details
  ,, Mirtazapina   Human Referral details
  ,, Mirtazapine   Human Referral details
  ,, Mirtazelon   Human Referral details
  ,, Mirtazza   Human Referral details
  ,, Mirtel   Human Referral details
  ,, Mirtoral   Human Referral details
  ,, Mirzaten   Human Referral details
  ,, Mizac   Human Referral details
  ,, Mizapin   Human Referral details
  ,, Motivan   Human Referral details
  ,, Mutan   Human Referral details
  ,, Myroxine   Human Referral details
  ,, Míron   Human Referral details
  ,, Nodepe   Human Referral details
  ,, Norebox   Human Referral details
  ,, Norserin   Human Referral details
  ,, Norset   Human Referral details
  ,, Norzac   Human Referral details
  ,, Novalbac   Human Referral details
  ,, NuFluo   Human Referral details
  ,, Nycoflox   Human Referral details
  ,, Optipar   Human Referral details
  ,, Oropram   Human Referral details
  ,, Orthon   Human Referral details
  ,, Osepar   Human Referral details
  ,, Oxactin   Human Referral details
  ,, Oxepar   Human Referral details
  ,, Oxetine   Human Referral details
  ,, Paluxetil   Human Referral details
  ,, Paratonina   Human Referral details
  ,, Paraxodil   Human Referral details
  ,, Paretin   Human Referral details
  ,, Parhun   Human Referral details
  ,, ParoLich   Human Referral details
  ,, Paroc   Human Referral details
  ,, Parocetan   Human Referral details
  ,, Parogen   Human Referral details
  ,, Paroksetiini   Human Referral details
  ,, Parolex   Human Referral details
  ,, Paroneurin   Human Referral details
  ,, Paroscope   Human Referral details
  ,, Paroser   Human Referral details
  ,, Parox   Human Referral details
  ,, Paroxat   Human Referral details
  ,, Paroxedura   Human Referral details
  ,, Paroxegen   Human Referral details
  ,, Paroxetabs   Human Referral details
  ,, Paroxetin   Human Referral details
  ,, Paroxetina   Human Referral details
  ,, Paroxetine   Human Referral details
  ,, Paroxiflex   Human Referral details
  ,, Paroximed   Human Referral details
  ,, Paroxistad   Human Referral details
  ,, Parsyn   Human Referral details
  ,, Pasero   Human Referral details
  ,, Pasorex   Human Referral details
  ,, Paxeratio   Human Referral details
  ,, Paxetin   Human Referral details
  ,, Paxil   Human Referral details
  ,, Paxinol   Human Referral details
  ,, Paxpar   Human Referral details
  ,, Paxt   Human Referral details
  ,, Pharmasole   Human Referral details
  ,, Pharmazapine   Human Referral details
  ,, Plazeron   Human Referral details
  ,, Portal   Human Referral details
  ,, Positivum   Human Referral details
  ,, Pram   Human Referral details
  ,, Pramexyl   Human Referral details
  ,, Prandulin Semanal   Human Referral details
  ,, Presar   Human Referral details
  ,, Pricital   Human Referral details
  ,, Prilect   Human Referral details
  ,, Primoxatine   Human Referral details
  ,, Prisdal   Human Referral details
  ,, Prisma   Human Referral details
  ,, Prosimed   Human Referral details
  ,, Proxerene   Human Referral details
  ,, Prozac   Human Referral details
  ,, Prozamel   Human Referral details
  ,, Prozatan   Human Referral details
  ,, Psipax   Human Referral details
  ,, Ranbaxy   Human Referral details
  ,, Ranflutin   Human Referral details
  ,, Reboxetine   Human Referral details
  ,, Redoxamin   Human Referral details
  ,, Rejkapram   Human Referral details
  ,, Relapaz   Human Referral details
  ,, Remergil   Human Referral details
  ,, Remergon   Human Referral details
  ,, Remeron   Human Referral details
  ,, Remood   Human Referral details
  ,, Reneuron   Human Referral details
  ,, Rexer   Human Referral details
  ,, Rexetin   Human Referral details
  ,, Ronal   Human Referral details
  ,, Roxac   Human Referral details
  ,, SNRIs   Human Referral details
  ,, SSRIs, SNRIs   Human Referral details
  ,, Salipax   Human Referral details
  ,, Sartuzin   Human Referral details
  ,, Selective serotonin reuptake inhibitors (SSRIs)   Human Referral details
  ,, Selectus   Human Referral details
  ,, Sepram   Human Referral details
  ,, Serad   Human Referral details
  ,, Serelan   Human Referral details
  ,, Sereupin   Human Referral details
  ,, Serital   Human Referral details
  ,, Serlain   Human Referral details
  ,, Serlan   Human Referral details
  ,, Serlift   Human Referral details
  ,, Serlinan   Human Referral details
  ,, Serocel   Human Referral details
  ,, Serodur   Human Referral details
  ,, Seroliber   Human Referral details
  ,, Seromex   Human Referral details
  ,, Seronil   Human Referral details
  ,, Seroplex   Human Referral details
  ,, Seropram   Human Referral details
  ,, Serorex   Human Referral details
  ,, Serotonin and norepinephrine reuptake inhibitors (SNRIs)   Human Referral details
  ,, Serotor   Human Referral details
  ,, Seroxat   Human Referral details
  ,, Serseitran   Human Referral details
  ,, Sertahexal   Human Referral details
  ,, Sertaxilin   Human Referral details
  ,, Sertra   Human Referral details
  ,, Sertrabeck   Human Referral details
  ,, Sertrabt   Human Referral details
  ,, Sertral   Human Referral details
  ,, Sertralex   Human Referral details
  ,, Sertralin   Human Referral details
  ,, Sertralina   Human Referral details
  ,, Sertraline   Human Referral details
  ,, Sertraratio   Human Referral details
  ,, Sertratifi   Human Referral details
  ,, Sertrawitt   Human Referral details
  ,, Sertrix   Human Referral details
  ,, Seról   Human Referral details
  ,, Setralexin   Human Referral details
  ,, Sipralexa   Human Referral details
  ,, Sofelin   Human Referral details
  ,, Somac   Human Referral details
  ,, Sopax   Human Referral details
  ,, Stephadilat-S   Human Referral details
  ,, Stimuloton   Human Referral details
  ,, Strattera   Human Referral details
  ,, Stressless   Human Referral details
  ,, Tagonis   Human Referral details
  ,, Talocit   Human Referral details
  ,, Tarzapine   Human Referral details
  ,, Tatig   Human Referral details
  ,, Tazamel   Human Referral details
  ,, Thiramil   Human Referral details
  ,, Tirzamed   Human Referral details
  ,, Titroxatine   Human Referral details
  ,, Tolmin   Human Referral details
  ,, Tolvin   Human Referral details
  ,, Tolvon   Human Referral details
  ,, Tralinan   Human Referral details
  ,, Tralix   Human Referral details
  ,, Trapar   Human Referral details
  ,, Tresleen   Human Referral details
  ,, Trevilor   Human Referral details
  ,, Tuneluz   Human Referral details
  ,, Valdren   Human Referral details
  ,, Vandral   Human Referral details
  ,, Varoxetin   Human Referral details
  ,, Vastat   Human Referral details
  ,, Velafax   Human Referral details
  ,, Venlafaxin   Human Referral details
  ,, Venlafaxine   Human Referral details
  ,, Venlax   Human Referral details
  ,, Venlaxor   Human Referral details
  ,, Xeredien   Human Referral details
  ,, Xetin   Human Referral details
  ,, Xetiran   Human Referral details
  ,, Zafluox   Human Referral details
  ,, Zeelinax   Human Referral details
  ,, Zenon   Human Referral details
  ,, Zicomber   Human Referral details
  ,, Zinovat   Human Referral details
  ,, Zismirt   Human Referral details
  ,, Zispin   Human Referral details
  ,, Zistap   Human Referral details
  ,, Zoloft   Human Referral details
  ,, Zyloram   Human Referral details
Atorvastatin Atorvastatin   Human Referral details
  ,,     ,,   Human Referral details
  ,, Atorvastatin Pfizer   Human Referral details
  ,, Atorvastatina   Human Referral details
  ,, Atorvastatina Nostrum   Human Referral details
  ,, Atorvastatina Parke-Davis   Human Referral details
  ,, Atorvastatina Pharmacia   Human Referral details
  ,, Cardyl   Human Referral details
  ,,     ,,   Human Referral details
  ,, Edovin   Human Referral details
  ,,     ,,   Human Referral details
  ,, Lipita   Human Referral details
  ,, Lipitor   Human Referral details
  ,,     ,,   Human Referral details
  ,, Lipitor and associated names   Human Referral details
  ,, Liprimar   Human Referral details
  ,,     ,,   Human Referral details
  ,, Obradon   Human Referral details
  ,,     ,,   Human Referral details
  ,, Orbeos   Human Referral details
  ,,     ,,   Human Referral details
  ,, Prevencor   Human Referral details
  ,,     ,,   Human Referral details
  ,, Sortis   Human Referral details
  ,,     ,,   Human Referral details
  ,,     ,,   Human Referral details
  ,, Tahor   Human Referral details
  ,,     ,,   Human Referral details
  ,, Texzor   Human Referral details
  ,,     ,,   Human Referral details
  ,, Torvast   Human Referral details
  ,,     ,,   Human Referral details
  ,, Totalip   Human Referral details
  ,,     ,,   Human Referral details
  ,, Xarator   Human Referral details
  ,,     ,,   Human Referral details
  ,,     ,,   Human Referral details
  ,, Zarator   Human Referral details
  ,,     ,,   Human Referral details
  ,,     ,,   Human Referral details
atosiban Atosiban SUN EU/1/13/852 Human Centralised details
  ,, Tractocile EU/1/99/124 Human Centralised details
Autologous adipose tissue-derived mesenchymal stem cells   EU/3/17/1854 Human Orphan designation details
Autologous adipose tissue-derived stromal vascular fraction cells   EU/3/15/1464 Human Orphan designation details
Autologous adult bone marrow-derived non-expanded CD133+ haematopoietic stem cells   EU/3/17/1862 Human Orphan designation details
Autologous bone marrow-derived mesenchymal stromal cells secreting neurotrophic factors   EU/3/13/1148 Human Orphan designation details
Autologous bone marrow-derived mononuclear cell fraction   EU/3/10/775 Human Orphan designation details
Autologous CD34+ cells transduced with a lentiviral vector containing the human ADA gene   EU/3/13/1134 Human Orphan designation details
Autologous CD34+ cells transduced with a lentiviral vector containing the human RAG1 gene   EU/3/14/1257 Human Orphan designation details
Autologous CD34+ cells transduced with a lentiviral vector containing the human SGSH gene   EU/3/14/1280 Human Orphan designation details
Autologous CD34+ cells transduced with a lentiviral vector containing the human Wiskott-Aldrich syndrome gene   EU/3/13/1196 Human Orphan designation details
Autologous CD34+ cells transduced with lentiviral vector encoding the human beta globin gene   EU/3/16/1660 Human Orphan designation details
Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA   EU/3/07/446 Human Orphan designation details
Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene   EU/3/12/998 Human Orphan designation details
Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene   EU/3/05/313 Human Orphan designation details
Autologous CD34+ cells transfected with retroviral vector containing the human gp91(phox) gene   EU/3/06/393 Human Orphan designation details
autologous CD34+ enriched cell fraction that contains CD34+ cells transduced with retroviral vector that encodes for the human ADA cDNA sequence Strimvelis EU/1/16/1097 Human Centralised details
Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human beta A-T87Q-globin gene   EU/3/14/1263 Human Orphan designation details
  ,,   EU/3/12/1091 Human Orphan designation details
Autologous CD4+ and CD8+ T cells expressing a CD19-specific chimeric antigen receptor   EU/3/17/1890 Human Orphan designation details
Autologous CD4+ and CD8+ T-cells transduced with lentiviral vector containing an affinity-enhanced T-cell receptor targeting the New York esophageal antigen-1   EU/3/16/1694 Human Orphan designation details
Autologous collagen type II-specific regulatory T cells   EU/3/14/1405 Human Orphan designation details
Autologous dendritic cells incubated ex vivo with zebularine and factor VIII   EU/3/16/1813 Human Orphan designation details
Autologous dendritic cells pulsed with allogeneic tumour cell lysate   EU/3/13/1229 Human Orphan designation details
Autologous dendritic cells pulsed with autologous tumour cell lysate   EU/3/07/431 Human Orphan designation details
Autologous dendritic cells pulsed with killed ovarian cancer cells and matured by TLR3 ligand ex vivo   EU/3/18/2009 Human Orphan designation details
Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose   EU/3/10/776 Human Orphan designation details
Autologous dendritic cells pulsed with RNA from glioma stem cells   EU/3/14/1273 Human Orphan designation details
Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha)   EU/3/14/1247 Human Orphan designation details
Autologous dermal fibroblasts genetically modified ex vivo with a lentiviral vector containing the human COL7A1 gene   EU/3/16/1642 Human Orphan designation details
Autologous Epstein-Barr virus specific T-cells derived from peripheral blood mononuclear cells, expanded ex vivo   EU/3/16/1696 Human Orphan designation details
  ,,   EU/3/16/1695 Human Orphan designation details
Autologous ex-vivo-expanded leucocytes treated with 5-aza-2’-deoxycytidine   EU/3/13/1197 Human Orphan designation details
Autologous ex-vivo-expanded peripheral polyclonal lymphocytes enriched in activated natural killer cells   EU/3/17/1918 Human Orphan designation details
Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene   EU/3/12/957 Human Orphan designation details
Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene   EU/3/09/623 Human Orphan designation details
Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA   EU/3/12/1003 Human Orphan designation details
Autologous human peripheral blood Vdelta1+ T lymphocytes activated in vitro by cytokine and monoclonal antibody treatment   EU/3/15/1566 Human Orphan designation details
Autologous mesenchymal stromal cells on a decellularised tracheal scaffold from a cadaveric donor   EU/3/16/1717 Human Orphan designation details
Autologous mononuclear cells derived from human cord blood   EU/3/16/1743 Human Orphan designation details
  ,,   EU/3/16/1744 Human Orphan designation details
Autologous peripheral blood mononuclear cells activated with PAP-GM-CSF (Sipuleucel-T) Provenge EU/1/13/867 Human Centralised details
Autologous regulatory T cells with an immunophenotype of CD4+CD25hiFoxP3+   EU/3/13/1171 Human Orphan designation details
Autologous renal cell tumor vaccine   EU/3/02/116 Human Orphan designation details
Autologous skeletal myoblasts expanded ex vivo     Human Orphan Refusal details
Autologous stromal vascular cell fraction from adipose tissue   EU/3/16/1643 Human Orphan designation details
Autologous T cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19   EU/3/16/1745 Human Orphan designation details
  ,,   EU/3/14/1266 Human Orphan designation details
Autologous T cells transduced with lentiviral vector encoding an anti-SLAMF7 CD28/CD3-zeta chimeric antigen receptor   EU/3/17/1833 Human Orphan designation details
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor   EU/3/15/1553 Human Orphan designation details
  ,,   EU/3/15/1552 Human Orphan designation details
  ,,   EU/3/15/1579 Human Orphan designation details
  ,,   EU/3/15/1572 Human Orphan designation details
  ,,   EU/3/15/1571 Human Orphan designation details
  ,,   EU/3/14/1393 Human Orphan designation details
Autologous T lymphocyte-enriched population of cells transduced with a lentiviral vector encoding a chimeric antigen receptor targeting human B cell maturation antigen with 4-1BB and CD3-zeta intracellular signalling domains   EU/3/17/1863 Human Orphan designation details
Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex   EU/3/05/270 Human Orphan designation details
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin   EU/3/06/394 Human Orphan designation details
  ,,   EU/3/10/831 Human Orphan designation details
Autologous tumour-derived gp96 heat shock protein-peptide complex   EU/3/09/624 Human Orphan designation details
Autologous urothelial and smooth muscle cells   EU/3/08/574 Human Orphan designation details
  ,,   EU/3/08/537 Human Orphan designation details
Avacopan   EU/3/17/1880 Human Orphan designation details
avanafil Spedra EU/1/13/841 Human Centralised details
avelumab Bavencio EU/1/17/1214 Human Centralised details
  ,,   EU/3/16/1798 Human Orphan designation details
Avian polyclonal IgY antibody against Pseudomonas aeruginosa   EU/3/08/564 Human Orphan designation details
A/Viet Nam/1194/2004 (H5N1) virus surface inactivated antigen Foclivia EU/1/09/577 Human Centralised details
A/Viet Nam/1194/2004 (H5N1) whole virus inactivated antigen Daronrix EU/1/06/381 Human Centralised details
Aviptadil   EU/3/06/395 Human Orphan designation details
  ,,   EU/3/07/473 Human Orphan designation details
Axitinib Inlyta EU/1/12/777 Human Centralised details
  ,,   EU/3/10/844 Human Orphan designation details
Azacitidine Vidaza EU/1/08/488 Human Centralised details
  ,,   EU/3/01/084 Human Orphan designation details
  ,,   EU/3/07/509 Human Orphan designation details
  ,,   EU/3/15/1570 Human Orphan designation details
Azagly-nafarelin Gonazon EU/2/03/040 Veterinary Centralised details
azilsartan medoxomil Edarbi EU/1/11/734 Human Centralised details
  ,, Ipreziv EU/1/11/735 Human Centralised details
aztreonam Cayston EU/1/09/543 Human Centralised details
Aztreonam lysinate (inhalation use)   EU/3/04/204 Human Orphan designation details