Pharmaceuticals - Community Register


Full list of products by INN: A

1  2  3  4  5  6  7  8  9  A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z 
INN Brand name EU Number Human or veterinary Procedure type details
a -1-acid glycoprotein   EU/3/03/138 Human Orphan designation details
A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein   EU/3/05/317 Human Orphan designation details
A/Viet Nam/1194/2004 (H5N1) virus surface inactivated antigen Foclivia EU/1/09/577 Human Centralised details
A/Viet Nam/1194/2004 (H5N1) whole virus inactivated antigen Daronrix EU/1/06/381 Human Centralised details
a-1-acid glycoprotein   EU/3/03/164 Human Orphan designation details
abacavir / Lamivudine Kivexa EU/1/04/298 Human Centralised details
abacavir, lamivudine, zidovudine Trizivir EU/1/00/156 Human Centralised details
abacavir sulfate Ziagen EU/1/99/112 Human Centralised details
Abarelix   EU/3/10/771 Human Orphan designation details
abatacept Orencia EU/1/07/389 Human Centralised details
Abetimus sodium   EU/3/01/064 Human Orphan designation details
abiraterone Zytiga EU/1/11/714 Human Centralised details
Acadesine   EU/3/05/280 Human Orphan designation details
  ,,   EU/3/11/881 Human Orphan designation details
Acetylcysteine   EU/3/04/259 Human Orphan designation details
Acetylsalicylic acid   EU/3/04/208 Human Orphan designation details
Acipimox acipimox   Human Referral details
aclidinium bromide Bretaris Genuair EU/1/12/781 Human Centralised details
  ,, Eklira Genuair EU/1/12/778 Human Centralised details
Adalimumab Humira EU/1/03/256 Human Centralised details
  ,, Trudexa EU/1/03/257 Human Centralised details
adefovir dipivoxil Hepsera EU/1/03/251 Human Centralised details
Adeno associated viral vector containing the human calpain 3 gene   EU/3/06/359 Human Orphan designation details
Adeno-associated viral vector containing a modified U7-snRNA gene   EU/3/05/297 Human Orphan designation details
Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene   EU/3/10/817 Human Orphan designation details
Adeno-associated viral vector containing modified U1 snRNA   EU/3/09/663 Human Orphan designation details
Adeno-associated viral vector containing porphobilinogen deaminase gene   EU/3/09/632 Human Orphan designation details
Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene   EU/3/11/917 Human Orphan designation details
Adeno-associated viral vector containing the human alpha-sarcoglycan gene   EU/3/08/573 Human Orphan designation details
Adeno-associated viral vector containing the human ARSB gene   EU/3/11/864 Human Orphan designation details
Adeno-associated viral vector containing the human factor IX gene   EU/3/11/938 Human Orphan designation details
Adeno-associated viral vector containing the human gamma-sarcoglycan gene   EU/3/04/233 Human Orphan designation details
Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene   EU/3/11/860 Human Orphan designation details
Adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5 (prior to administration of 17-dimethylaminoethylamino-17-demethoxygeldanamycin)   EU/3/12/1069 Human Orphan designation details
Adeno-associated viral vector expressing lipoprotein lipase   EU/3/04/194 Human Orphan designation details
Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene   EU/3/12/974 Human Orphan designation details
Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1   EU/3/14/1278 Human Orphan designation details
Adeno-associated viral vector serotype 2 containing the human REP1 gene   EU/3/14/1290 Human Orphan designation details
Adeno-associated viral vector serotype 5 containing the human ABCA4 gene   EU/3/08/609 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human AIPL1 gene   EU/3/11/929 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human GUCY2D gene   EU/3/14/1256 Human Orphan designation details
Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene   EU/3/14/1321 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human cardiac calsequestrin gene   EU/3/14/1296 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene   EU/3/12/1095 Human Orphan designation details
Adeno-associated viral vector serotype 9 containing the human sulfamidase gene   EU/3/11/877 Human Orphan designation details
Adenoviral vector containing human p53 gene   EU/3/06/404 Human Orphan designation details
Adenovirus associated viral vector serotype 2 containing the human RPE65 gene   EU/3/12/981 Human Orphan designation details
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene   EU/3/07/484 Human Orphan designation details
  ,,   EU/3/07/486 Human Orphan designation details
Adenovirus associated viral vector serotype 5 containing the human pde6 gene   EU/3/13/1142 Human Orphan designation details
Adenovirus-associated vector containing human Fas-c gene   EU/3/12/1002 Human Orphan designation details
Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs   EU/3/10/772 Human Orphan designation details
Adenovirus-Interferon gamma coding DNA sequence   EU/3/03/150 Human Orphan designation details
Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene   EU/3/01/083 Human Orphan designation details
Adenovirus-specific T-cells derived from allogeneic donor leukocytes, expanded ex vivo   EU/3/13/1227 Human Orphan designation details
Adrenomedullin   EU/3/10/744 Human Orphan designation details
Afamelanotide   EU/3/09/648 Human Orphan designation details
  ,,   EU/3/14/1285 Human Orphan designation details
afatinib Giotrif EU/1/13/879 Human Centralised details
aflibercept Eylea EU/1/12/797 Human Centralised details
  ,, ZALTRAP EU/1/12/814 Human Centralised details
afoxolaner NexGard EU/2/13/159 Veterinary Centralised details
Agalsidase alfa Replagal EU/1/01/189 Human Centralised details
Agalsidase beta Fabrazyme EU/1/01/188 Human Centralised details
Aganirsen   EU/3/14/1275 Human Orphan designation details
agomelatine Thymanax EU/1/08/498 Human Centralised details
  ,,     ,,   Human Centralised Refusal details
  ,, Valdoxan EU/1/08/499 Human Centralised details
alatrofloxacin Trovan IV EU/1/98/060 Human Centralised details
  ,, Turvel IV EU/1/98/062 Human Centralised details
albiglutide Eperzan EU/1/13/908 Human Centralised details
Aldesleukin (inhalation use)   EU/3/03/146 Human Orphan designation details
Alemtuzumab Lemtrada EU/1/13/869 Human Centralised details
  ,, MabCampath EU/1/01/193 Human Centralised details
Alendronate sodium / Colecalciferol Adrovance EU/1/06/364 Human Centralised details
  ,, Fosavance EU/1/05/310 Human Centralised details
  ,, Norsed Combi D and associated names   Human Referral details
alendronate sodium trihydricum Alendros 70   Human Referral details
alendronic acid Alendronate Hexal   Human Referral details
alendronic acid / colecalciferol Vantavo EU/1/09/572 Human Centralised details
Alendronic acid and alfacalcidol Valebo   Human Referral details
alendronic acid, clodronic acid, etidronic acid, ibandronic acid, neridronic acid, pamidronic acid, risedronic acid and tiludronic acid alendronic acid, clodronic acid, etidronic acid, ibandronic acid, neridronic acid, pamidronic acid, risedronic acid and tiludronic acid   Human Referral details
Alfimeprase   EU/3/05/322 Human Orphan designation details
Alginate oligosaccharide (G-block) fragment   EU/3/07/475 Human Orphan designation details
alglucosidase alfa Myozyme EU/1/06/333 Human Centralised details
Alicaforsen   EU/3/09/641 Human Orphan designation details
Alipogene tiparvovec Glybera EU/1/12/791 Human Centralised details
Alisertib   EU/3/12/1064 Human Orphan designation details
  ,,   EU/3/12/1074 Human Orphan designation details
aliskiren Enviage EU/1/07/406 Human Centralised details
  ,, Rasilez EU/1/07/405 Human Centralised details
  ,, Riprazo EU/1/07/409 Human Centralised details
  ,, Sprimeo EU/1/07/407 Human Centralised details
  ,, Tekturna EU/1/07/408 Human Centralised details
aliskiren / amlodipine Rasilamlo EU/1/11/686 Human Centralised details
aliskiren / amlodipine / hydrochlorothiazide Rasitrio EU/1/11/730 Human Centralised details
aliskiren / hydrochlorothiazide Riprazo HCT EU/1/11/680 Human Centralised details
  ,, Sprimeo HCT EU/1/11/683 Human Centralised details
aliskiren hemifumarate / hydrochlorothiazide Rasilez HCT EU/1/08/491 Human Centralised details
alitretinoin Panretin EU/1/00/149 Human Centralised details
Allantoin   EU/3/13/1232 Human Orphan designation details
Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma   EU/3/13/1211 Human Orphan designation details
Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix   EU/3/10/843 Human Orphan designation details
Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media   EU/3/13/1129 Human Orphan designation details
Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2   EU/3/11/866 Human Orphan designation details
Allogeneic bone-marrow derived ex-vivo expanded multipotent adult progenitor cells   EU/3/13/1233 Human Orphan designation details
Allogeneic ex vivo expanded umbilical cord blood cells   EU/3/09/618 Human Orphan designation details
  ,,   EU/3/09/619 Human Orphan designation details
  ,,   EU/3/09/649 Human Orphan designation details
  ,,   EU/3/09/664 Human Orphan designation details
  ,,   EU/3/09/665 Human Orphan designation details
Allogeneic human dendritic cells derived from a CD34+ progenitor cell line   EU/3/12/969 Human Orphan designation details
Allogeneic human dermal fibroblasts   EU/3/10/774 Human Orphan designation details
Allogeneic human umbilical cord tissue-derived cells   EU/3/08/534 Human Orphan designation details
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells   EU/3/12/1088 Human Orphan designation details
  ,,   EU/3/13/1155 Human Orphan designation details
Allogeneic T cells encoding an exogenous TK gene   EU/3/10/773 Human Orphan designation details
  ,,   EU/3/11/878 Human Orphan designation details
Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2   EU/3/11/867 Human Orphan designation details
Allopurinol sodium   EU/3/12/1076 Human Orphan designation details
alogliptin Vipidia EU/1/13/844 Human Centralised details
alogliptin / metformin Vipdomet EU/1/13/843 Human Centralised details
alogliptin / pioglitazone Incresync EU/1/13/842 Human Centralised details
Alpha-1 antitrypsin (inhalation use)   EU/3/04/243 Human Orphan designation details
  ,,   EU/3/04/244 Human Orphan designation details
Alpha-1 proteinase inhibitor   EU/3/06/350 Human Orphan designation details
Alpha-1 proteinase inhibitor (for inhalation use)   EU/3/12/1045 Human Orphan designation details
Alpha-1 proteinase inhibitor (inhalation use)   EU/3/07/474 Human Orphan designation details
  ,,   EU/3/08/546 Human Orphan designation details
Alpha-Galactosidase A   EU/3/00/002 Human Orphan designation details
  ,,   EU/3/00/003 Human Orphan designation details
Alpha-tocotrienol quinone   EU/3/11/937 Human Orphan designation details
Alteplase Actilyse   Human Referral details
altrenogest Suifertil 4 mg/ml Oral Solution for Pigs and associated names   Veterinary Referral details
Alvocidib   EU/3/07/485 Human Orphan designation details
Amatuximab   EU/3/13/1222 Human Orphan designation details
Ambrisentan   EU/3/05/273 Human Orphan designation details
  ,,   EU/3/10/790 Human Orphan designation details
  ,, Volibris EU/1/08/451 Human Centralised details
Amfepramone Amfepramone   Human Referral details
amifampridine Firdapse EU/1/09/601 Human Centralised details
Amikacin sulfate   EU/3/14/1259 Human Orphan designation details
Amikacin sulfate (liposomal)   EU/3/06/387 Human Orphan designation details
Amiloride hydrochloride dihydrate   EU/3/03/147 Human Orphan designation details
aminocaproic acid Aminocaproic acid containing medicinal products   Human Referral details
amlodipine Norvasc and associated names   Human Referral details
amlodipine / valsartan Copalia EU/1/06/372 Human Centralised details
  ,, Dafiro EU/1/06/371 Human Centralised details
  ,, Exforge EU/1/06/370 Human Centralised details
  ,, Imprida EU/1/06/373 Human Centralised details
amlodipine besylate / valsartan / hydrochlorothiazide Copalia HCT EU/1/09/575 Human Centralised details
  ,, Dafiro HCT EU/1/09/574 Human Centralised details
  ,, Exforge HCT EU/1/09/569 Human Centralised details
  ,, Imprida HCT EU/1/09/570 Human Centralised details
Amlodipine maleate Amlodipine Wrwag   Human Referral details
  ,, Amlovita   Human Referral details
  ,, Pidolma   Human Referral details
Ammonium tetrathiomolybdate   EU/3/08/539 Human Orphan designation details
Amonafide L-malate   EU/3/07/483 Human Orphan designation details
Amoxicillin Suramox 15% LA - Stabox 15% LA   Veterinary Referral details
Amoxicillin and clavulanic acid Augmentin   Human Referral details
Amoxicillin, clavulanic acid Clavudale 50 mg   Veterinary Referral details
  ,, STRENZEN 500/125 mg/g powder for use in drinking water for pigs   Veterinary Referral details
amoxicillin, clavulanic acid and prednisolone Nisamox Lactating Cow Intramammary Suspension   Veterinary Referral details
Amoxicillin trihydrate, potassium clavulanate, prednisolone Synulox Lactating Cow   Veterinary Referral details
Amphotericin B (for inhalation use)   EU/3/06/391 Human Orphan designation details
amprenavir Agenerase EU/1/00/148 Human Centralised details
Amrubicin hydrochloride   EU/3/08/538 Human Orphan designation details
anagrelide Anagrelide   Human Referral details
  ,, Xagrid EU/1/04/295 Human Centralised details
Anagrelide Hydrochloride   EU/3/00/010 Human Orphan designation details
Anakinra Kineret EU/1/02/203 Human Centralised details
anastrazole Arimidex   Human Referral details
  ,, Arimidex and associated names   Human Referral details
anidulafungin Ecalta EU/1/07/416 Human Centralised details
Anti epidermal growth factor receptor antibody h-R3   EU/3/04/220 Human Orphan designation details
anti-CD147 murine monoclonal IgM   EU/3/02/123 Human Orphan designation details
Anti-EphA2 monoclonal antibody conjugated to maleimidocaproyl monomethylauristatin phenylalanine   EU/3/09/682 Human Orphan designation details
Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody   EU/3/04/193 Human Orphan designation details
Anti-melanoma Mab fragments Tecnemab-K-1 EU/1/96/019 Human Centralised details
Antisense NF-K p65 Oligonucleotide   EU/3/02/106 Human Orphan designation details
Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3'   EU/3/06/416 Human Orphan designation details
Antisense oligonucleotide targeted to the SMN2 gene   EU/3/12/976 Human Orphan designation details
Antisense oligonucleotide targeting the F508delta mutation of CFTR   EU/3/13/1195 Human Orphan designation details
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)   EU/3/03/160 Human Orphan designation details
  ,,   EU/3/03/161 Human Orphan designation details
  ,,   EU/3/07/445 Human Orphan designation details
antithrombin alfa ATryn EU/1/06/355 Human Centralised details
Anti-von Willebrand Aptamer   EU/3/08/547 Human Orphan designation details
apixaban Eliquis EU/1/11/691 Human Centralised details
Aplidine   EU/3/03/151 Human Orphan designation details
  ,,   EU/3/04/245 Human Orphan designation details
Apomorphine hydrochloride   EU/3/11/862 Human Orphan designation details
  ,, Ixense EU/1/01/181 Human Centralised details
  ,, Taluvian EU/1/01/182 Human Centralised details
  ,, Uprima EU/1/01/180 Human Centralised details
Apomorphine hydrochloride (inhalation use)   EU/3/06/349 Human Orphan designation details
Apomorphine (oromucosal use)   EU/3/01/072 Human Orphan designation details
Apremilast   EU/3/13/1180 Human Orphan designation details
aprepitant Emend EU/1/03/262 Human Centralised details
Aprotinin Aprotinin   Human Referral details
Arcitumomab CEA-Scan EU/1/96/023 Human Centralised details
Arimoclomol   EU/3/06/406 Human Orphan designation details
Aripiprazole ABILIFY MAINTENA EU/1/13/882 Human Centralised details
  ,, Abilify EU/1/04/276 Human Centralised details
Arsenic trioxide   EU/3/00/008 Human Orphan designation details
  ,,   EU/3/00/017 Human Orphan designation details
  ,,   EU/3/01/031 Human Orphan designation details
  ,,   EU/3/01/032 Human Orphan designation details
  ,,   EU/3/07/460 Human Orphan designation details
  ,, Trisenox EU/1/02/204 Human Centralised details
artesunate   EU/3/07/430 Human Orphan designation details
  ,,   EU/3/07/510 Human Orphan designation details
  ,,   EU/3/12/1079 Human Orphan designation details
ascorbic acid   EU/3/08/531 Human Orphan designation details
asenapine Sycrest EU/1/10/640 Human Centralised details
Asp-Arg-Val-Tyr-Ile-His-Pro   EU/3/12/1047 Human Orphan designation details
  ,,   EU/3/14/1241 Human Orphan designation details
Ataluren   EU/3/12/1010 Human Orphan designation details
  ,, Translarna EU/1/13/902 Human Centralised details
atazanavir sulphate Reyataz EU/1/03/267 Human Centralised details
Atomoxetine, Citalopram, Escitalopram, Fluoxetine, Fluvoxamine, Mianserine, Milnacipran, Mirtazapine, Paroxetine, Reboxetine, Sertraline and Venlafaxine SSRIs, SNRIs   Human Referral details
Atorvastatin Atorvastatin   Human Referral details
  ,, Lipitor and associated names   Human Referral details
  ,, Sortis   Human Referral details
atosiban Atosiban SUN EU/1/13/852 Human Centralised details
  ,, Tractocile EU/1/99/124 Human Centralised details
Autologous bone marrow-derived mesenchymal stromal cells secreting neurotrophic factors   EU/3/13/1148 Human Orphan designation details
Autologous bone marrow-derived mononuclear cell fraction   EU/3/10/775 Human Orphan designation details
Autologous CD34+ cells transduced with a lentiviral vector containing the human ADA gene   EU/3/13/1134 Human Orphan designation details
Autologous CD34+ cells transduced with a lentiviral vector containing the human RAG1 gene   EU/3/14/1257 Human Orphan designation details
Autologous CD34+ cells transduced with a lentiviral vector containing the human SGSH gene   EU/3/14/1280 Human Orphan designation details
Autologous CD34+ cells transduced with a lentiviral vector containing the human Wiskott-Aldrich syndrome gene   EU/3/13/1196 Human Orphan designation details
Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA   EU/3/07/446 Human Orphan designation details
Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene   EU/3/12/998 Human Orphan designation details
Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene   EU/3/05/313 Human Orphan designation details
Autologous CD34+ cells transfected with retroviral vector containing the human gp91(phox) gene   EU/3/06/393 Human Orphan designation details
Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human beta A-T87Q-globin gene   EU/3/14/1263 Human Orphan designation details
Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human betaA-T87Q-globin gene   EU/3/12/1091 Human Orphan designation details
Autologous dendritic cells pulsed with allogeneic tumour cell lysate   EU/3/13/1229 Human Orphan designation details
Autologous dendritic cells pulsed with autologous tumour cell lysate   EU/3/07/431 Human Orphan designation details
Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose   EU/3/10/776 Human Orphan designation details
Autologous dendritic cells pulsed with RNA from glioma stem cells   EU/3/14/1273 Human Orphan designation details
Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha)   EU/3/14/1247 Human Orphan designation details
Autologous ex-vivo-expanded leucocytes treated with 5-aza-2-deoxycytidine   EU/3/13/1197 Human Orphan designation details
Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene   EU/3/12/957 Human Orphan designation details
Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene   EU/3/09/623 Human Orphan designation details
Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA   EU/3/12/1003 Human Orphan designation details
Autologous peripheral blood mononuclear cells activated with PAP-GM-CSF (Sipuleucel-T) Provenge EU/1/13/867 Human Centralised details
Autologous regulatory T cells with an immunophenotype of CD4+CD25hiFoxP3+   EU/3/13/1171 Human Orphan designation details
Autologous renal cell tumor vaccine   EU/3/02/116 Human Orphan designation details
Autologous T cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19   EU/3/14/1266 Human Orphan designation details
Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex   EU/3/05/270 Human Orphan designation details
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin   EU/3/06/394 Human Orphan designation details
  ,,   EU/3/10/831 Human Orphan designation details
Autologous tumour-derived gp96 heat shock protein-peptide complex   EU/3/09/624 Human Orphan designation details
Autologous urothelial and smooth muscle cells   EU/3/08/537 Human Orphan designation details
  ,,   EU/3/08/574 Human Orphan designation details
avanafil Spedra EU/1/13/841 Human Centralised details
Avian polyclonal IgY antibody against Pseudomonas aeruginosa   EU/3/08/564 Human Orphan designation details
Aviptadil   EU/3/06/395 Human Orphan designation details
  ,,   EU/3/07/473 Human Orphan designation details
Axitinib   EU/3/10/844 Human Orphan designation details
  ,, Inlyta EU/1/12/777 Human Centralised details
Azacitidine   EU/3/01/084 Human Orphan designation details
  ,,   EU/3/07/509 Human Orphan designation details
  ,, Vidaza EU/1/08/488 Human Centralised details
Azagly-nafarelin Gonazon EU/2/03/040 Veterinary Centralised details
azilsartan medoxomil Edarbi EU/1/11/734 Human Centralised details
  ,, Ipreziv EU/1/11/735 Human Centralised details
aztreonam Cayston EU/1/09/543 Human Centralised details
Aztreonam lysinate (inhalation use)   EU/3/04/204 Human Orphan designation details