Navigation path

Community Register of medicinal products

Register of designated Orphan Medicinal Products (alphabetical)

Product EU Designation Designated Orphan Indication Sponsor Designation date Tradename
EU Centralised Nr
implemented by
[N-((2S,3R,3aS,3´R,4a´R,6S,6a´R,6b´S,7aR,12a´S,12b´S,Z)-3,6,11´,12b´-tetramethyl-2´,3a,3´,4,4´,4a´,5,5´,6,6´,6a´,6b´,7,7a,7´,8´,10´,12´,12a´,12b´-icosahydro-1´H,3H-spiro[furo[3,2-b]pyridine-2,9´-naphtho[2,1-a]azulene]-3´-yl)methanesulfonamide hydrochloride] EU/3/11/859 Treatment of chondrosarcoma Voisin Consulting S.A.R.L. 13/05/2011
(-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate EU/3/08/560 Treatment of moderate and severe closed traumatic brain injury KeyNeurotek Pharmaceuticals AG 5/09/2008
EU/3/02/115 Treatment of uremic pruritus Toray International U.K. Limited 11/09/2002
(S)-10-[(dimethylamino)methyl]-4-ethyl-9-hydroxy-4-O-[alpha-(2´´, 4´´, 5´´, 7´´-tetranitro-9´´-fluorenylideneaminooxy)propionyl]-1H-pyrano[3´, 4´, 6´, 7´]indolizino[1,2-beta]-quinoline-3, 14-(4H), 12H)-dione, hydrochloride EU/3/10/788 Treatment of hepatocellular carcinoma TLC Biopharmaceuticals B.V. 1/10/2010
(1-methyl-2-nitro-1H-imidazole-5-yl)methyl N,N'-bis(2-bromoethyl) diamidophosphate EU/3/12/966 Treatment of soft tissue sarcoma Nexus Oncology Ltd. 5/03/2012
(1R, 2R)-Octanoic acid [2-(2’,3’-dihydro-benzo [1,4] dioxin-6’-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt EU/3/07/514 Treatment of Gaucher Disease Genzyme Europe BV 4/12/2007
(1R, 2R, 4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R, 27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxazacyclohentriacontin-3-yl]propyl}-2-methoxy-cyclohexyldimethyl-phosphinate EU/3/05/321 Treatment of primary malignant bone tumours Merck Sharp & Dohme Limited 28/10/2005
(1R, 2R, 4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R, 27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxazacyclohentriacontin-3-yl]propyl}-2-methoxy-cyclohexyldimethyl-phosphinate EU/3/05/312 Treatment of soft tissue sarcoma Merck Sharp & Dohme Limited 26/08/2005
(1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol EU/3/05/314 Treatment of tuberculosis Tibotec BVBA 26/08/2005
(1S,3S)-3-amino-4-(difluoromethylene) cyclopentanecarboxylic acid hydrochloride EU/3/12/953 Treatment of West syndrome Catalent Pharma Solutions Limited 9/02/2012
((2-aminoethyl) carbamic acid (2R,5S,8S,11S,14R,17S,19aS)-11-(4-aminobutyl)-5-benzyl-8-(4-benzyloxy benzyl)-14-(1H-indol-3-ylmethyl)-4,7,10,13,16,19-hexaoxo-17-phenyloctadecahydro-3a,6,9,12,15,18-hexaazacyclopentacyclooctadecen-2-yl ester, di[(S)-2-aminosuccinic acid] salt EU/3/04/200 Treatment of functional gastro-entero-pancreatic endocrine tumours Novartis Europharm Ltd 8/06/2004
(2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide EU/3/05/315 Treatment of progressive myoclonic epilepsies UCB Pharma SA. 26/08/2005
(3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt EU/3/10/760 Treatment of ovarian cancer Merck Sharp & Dohme Limited 4/08/2010
(3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt EU/3/10/787 Treatment of mantle cell lymphoma Merck Sharp & Dohme Limited 1/10/2010
(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride monohydrate EU/3/09/616 Treatment of amyotrophic lateral sclerosis Biogen Idec Limited 27/02/2009
(E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/328 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Celgene Europe Limited 28/10/2005
(E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/279 Treatment of cutaneous T-cell lymphoma Celgene Europe Limited 27/05/2005
(E)-2,4,6-trimethoxystyryl-3-carboxymethylamino-4-methoxybenzyl-sulfone sodium salt EU/3/12/987 Treatment of myelodysplastic syndromes JJGConsultancy Ltd 26/04/2012
(manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21°-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) EU/3/07/522 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Celtic Bio-Pharma Services Ltd 31/01/2008
(R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole EU/3/07/524 Treatment of tuberculosis Otsuka Novel Products GmbH 1/02/2008
(R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate EU/3/09/620 Treatment of myelofibrosis secondary to polycythemia vera or essential thrombocythemia Incyte Corporation Ltd 3/04/2009
(R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate EU/3/08/572 Treatment of chronic idiopathic myelofibrosis Incyte Corporation Ltd 7/11/2008
(S)-{8-fluoro-2-2[4-(3-methoxyphenyl)-1-piperazinyl]-3-[2-methoxy-5-(trifluoromethyl)-phenyl]-3,4-dihydro-4-quinazolinyl} acetic acid EU/3/11/849 Prevention of cytomegalovirus disease in patients with impaired cell-mediated immunity deemed at risk AiCuris GmbH & Co. KG 15/04/2011
(S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine EU/3/07/513 Treatment of tuberculosis Dr Ulrich Granzer 29/11/2007
(S)-3´-(OH)-desazadesferrithiocin-polyether, magnesium salt EU/3/09/647 Treatment of chronic iron overload requiring chelation therapy FerroKin BioSciences Ltd 24/07/2009
(S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate EU/3/09/661 Treatment of carcinoid tumours Lexicon Celtic Limited 8/10/2009
[gly2] Recombinant human glucagon-like peptide EU/3/01/077 Treatment of Short Bowel Syndrome Nycomed Danmark ApS 11/12/2001
[Nle4, D-Phe7]-alpha-melanocyte stimulating hormone EU/3/08/545 Treatment of congenital erythropoietic porphyria Clinuvel (UK) Limited 8/05/2008
[Nle4, D-Phe7]-alpha-melanocyte stimulating hormone EU/3/08/541 Treatment of erythropoietic protoporphyria Clinuvel (UK) Limited 8/05/2008
1-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl]thieno[3,2-c]pyridin-3-yl}phenyl)-3-(3-fluorophenyl)urea EU/3/11/915 Treatment of acute myeloid leukaemia Abbott Laboratories 27/10/2011
1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine EU/3/05/332 Treatment of acute myeloid leukaemia Vion (UK) Limited, ? i3 Research 14/12/2005
1,3-Propanedisulfonic acid, disodium salt EU/3/01/051 Treatment of Systemic Secondary Amyloidosis Kiacta Europe Ltd 31/07/2001
1,5-(Butylimino)-1,5-dideoxy, D-glucitol EU/3/00/006 Treatment of Gaucher Disease Oxford GlycoSciences (UK) Ltd 18/10/2000 Zavesca
EU/1/02/238/...
20/11/2002
1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4 d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one EU/3/12/984 Treatment of chronic lymphocytic leukaemia Nexus Oncology Ltd. 26/04/2012
1-[2-(Benzo[1,2,5]thiadiazol-5-ylamino)-6-(2,6-dichloro-phenyl)-pyrido[2,3-d]pyrimidin-7-yl]-3-tert-butyl-urea EU/3/10/770 Treatment of acute myeloid leukaemia Sanofi Aventis 20/09/2010
1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride EU/3/07/459 Treatment of narcolepsy Bioprojet 10/07/2007
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/769 Treatment of post-polycythaemia vera myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/768 Treatment of primary myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/767 Treatment of post-essential thrombocythaemia myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
16-base single-stranded peptide nucleic acid oligonucleotide linked to a 7-amino acid peptide EU/3/10/789 Treatment of medulloblastoma Biogenera srl 1/10/2010
16-base single-stranded PNA oligonucleotide linked to a 7-aminoacid peptide EU/3/09/692 Treatment of neuroblastoma Biogenera srl 25/11/2009
1-Cyclopropyl-3-[3-(5-morpholin-4-ylmethyl-1H-benzoimidazol-2-yl)-1H-pyrazol-4-yl]-urea EU/3/09/693 Treatment of acute myeloid leukaemia Astex Therapeutics Limited 26/11/2009
1-deoxygalactonojirimycin hydrochloride EU/3/06/368 Treatment of Fabry disease Amicus Therapeutics UK Limited 22/05/2006
2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione EU/3/10/802 Treatment of idiopathic pulmonary fibrosis GenKyoTex Innovation S.A.S 26/11/2010
2,2'-{2-[(1R)-1-({[(2,5-dichlorobenzoyl)amino]acetyl}amino)-3-methylbutyl]-5-oxo-1,3,2-dioxaborolane-4,4-diyl}diacetic acid EU/3/11/899 Treatment of multiple myeloma Takeda Global Research and Development Centre (Europe) Ltd. 27/09/2011
2,2-dimethylbutyric acid, sodium salt EU/3/09/621 Treatment of sickle cell disease Isabelle Ramirez 18/03/2009
2,2-dimethylbutyric acid, sodium salt EU/3/09/617 Treatment of beta-thalassaemia intermedia and major   Isabelle Ramirez 27/02/2009
2,3,4,5 tetrahydro-2,8-dimethyl-5-[2-(6-methyl-3-pyridyl)ethyl]-1H-pyrido[4,3-b]indole dihydrochloride EU/3/08/597 Treatment of Huntington´s disease Innovative Drug European Associates (I.D.E.A.) Limited 20/01/2009
2',3',5'-tri-O-acetyluridine EU/3/09/637 Treatment of 5-fluorouracil overdose Wellstat Therapeutics EU Limited 15/05/2009
2-[[3-({4-[(5-{2-[(3-Fluorophenyl)amino]-2-oxoethyl}-1H-pyrazol-3-yl)amino]-quinazolin-7-yl}oxy)propyl](ethyl)amino]ethyl dihydrogen phosphate trihydrate EU/3/08/590 Treatment of acute myeloid leukaemia AstraZeneca AB 5/12/2008
2-{4-[(5,6-diphenylpyrazin-2-yl)(isopropyl)amino]butoxy}-N-(methylsulfonyl)acetamide EU/3/05/316 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Actelion Registration Ltd 26/08/2005
20-pentaerythritol poly (oxy-1,2-ethanediyl)-carboxymethyl-glycinate-7-ethyl-10-hydroxycamptothecine 10-[1,4'-bipiperidine]-1'-carboxylate EU/3/11/900 Treatment of ovarian cancer Nektar Therapeutics UK Ltd 27/09/2011
2-Allyl-1-[6-(1-hydroxy-1-methylethyl)pyridin-2-yl]-6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-1,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin-3-one EU/3/12/989 Treatment of ovarian cancer Merck Sharp & Dohme Limited 26/04/2012
2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine EU/3/01/082 Treatment of acute lymphoblastic leukaemia Genzyme Europe B.V. 5/02/2002 Evoltra
EU/1/06/334/...
29/05/2006
2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine. EU/3/03/141 Treatment of acute myeloid leukaemia Genzyme Europe BV 8/05/2003
2-hydroxyoleic acid EU/3/11/916 Treatment of glioma Lipopharma Therapeutics SL 27/10/2011
2-iminobiotin EU/3/09/701 Treatment of perinatal asphyxia Neurophyxia B.V. 28/01/2010
2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol EU/3/04/195 Treatment of anaplastic thyroid cancer Dr David Chaplin 14/04/2004
2-methoxymethyl-2-hydroxymethyl-1-azabicyclo[2,2,2]octan-3-one EU/3/10/742 Treatment of acute myeloid leukaemia Aprea AB 10/06/2010
3-(4´aminoisoindoline-l´-one)-1-piperidine-2,6-dione EU/3/03/177 Treatment of multiple myeloma Celgene Europe Limited 12/12/2003 Revlimid
EU/1/07/391/...
14/06/2007
3-(4´aminoisoindoline-1´-one)-1-piperidine-2,6-dione EU/3/04/192 Treatment of myelodysplastic syndromes Celgene Europe Limited 8/03/2004
3-(6-(1-(2,2-difluorobenzo [d] [1,3] dioxol-5-yl)cyclopropanecarboxamido)-3-methylpyridin-2-yl)benzoic acid EU/3/10/761 Treatment of cystic fibrosis Voisin Consulting SARL 4/08/2010
3,4-diaminopyridine phosphate EU/3/02/124 Treatment of Lambert-Eaton myasthenic syndrome BioMarin Europe Limited 18/12/2002 Firdapse
EU/1/09/601/...
23/12/2009
(3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid EU/3/05/277 Treatment of cystic fibrosis Voisin Consulting SARL 27/05/2005
(3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid EU/3/05/278 Treatment of Duchenne muscular dystrophy PTC Therapeutics, Limited 27/05/2005
3-methoxy-pregnenolone EU/3/07/511 Treatment of spinal cord injury MAPREG SAS 4/12/2007
4-(3,5-bis-(hydroxy-phenyl)-1,2,4) triazol-1-yl)-benzoic acid EU/3/02/092 Treatment of chronic iron overload requiring chelation therapy Novartis Europharm Ltd 13/03/2002 Exjade
EU/1/06/356/...
28/08/2006
4,6,8-trihydroxy-10-(3,7,11-trimethyldodeca-2,6,10-trienyl)-5,10-dihydrodibenzo[b,e][1,4]diazepin-11-one EU/3/09/639 Treatment of glioma Albany Regulatory Consulting Limited 15/05/2009
4,7,10,13,16,19-docosahexaenoic acid EU/3/06/412 Treatment of retinitis pigmentosa Celavista Pharmaceuticals Limited 3/11/2006
4-[[9-[(3S)-tetrahydro-3-furanyl]-8-[(2,4,6-trifluorophenyl)amino]-9H-purin-2-yl]amino]-trans-cyclohexanol EU/3/11/934 Treatment of idiopathic pulmonary fibrosis Celgene Europe Ltd 9/12/2011
4-[123I]iodo-L-phenylalanine EU/3/06/386 Diagnosis of glioma Therapeia GmbH & Co. KG 25/07/2006
4-[131I]iodo-L-phenylalanine EU/3/06/363 Treatment of glioma Therapeia GmbH & Co. KG 11/04/2006
4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HC1 EU/3/05/288 Treatment of Huntington´s disease NSAB, Filial af NeuroSearch Sweden AB, Sverige 20/06/2005
4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride EU/3/06/390 Treatment of moderate and severe traumatic brain injury vasopharm GmbH 28/08/2006
4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-ß-D-arabinofuranosyl]-2(1H)-pyrimidinone EU/3/07/477 Treatment of hepatocellular carcinoma Interface International Consultancy Limited 14/09/2007
4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline EU/3/06/356 Treatment of renal cell carcinoma Prodimed S.A. 16/02/2006
4-benzyl-2-naphtalen-1-yl-1,2,4-thiadiazolidine-3,5-dione EU/3/09/679 Treatment of progressive supranuclear palsy NOSCIRA, S.A. 28/10/2009
4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol EU/3/07/487 Treatment of chronic lymphocytic leukaemia BlackSwan Pharma GmbH 14/11/2007
4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one EU/3/05/299 Treatment of pancreatic cancer ICON Clinical Research (UK) Ltd 27/07/2005
5-(2,6-Difluoro-phenoxy)-3(R,S)-{2(S)-[2(S)-(3-methoxycarbonyl-2(S)-{3-methyl-2(S)-[(quinoline-2-carbonyl)-amino]-butyrylamino}-propionylamino)-3-methyl-butyrylamino]-propionylamino}-4-oxo-pentanoic acid methyl ester EU/3/06/403 Treatment of neonatal brain injury CHIESI FARMACEUTICI SpA 23/10/2006
5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole EU/3/08/591 Treatment of Duchenne muscular dystrophy Summit (Oxford) Limited 4/12/2008
5(S)-(2´-hydroxy ethoxy)-20(S)- camptothecin EU/3/07/450 Treatment of osteosarcoma ClinTec International Ltd 8/06/2007
5,6,7,8-Tetrahydrobiopterin EU/3/03/163 Treatment of hyperphenylalaninemia Orphanetics Pharma Entwicklungs GmbH 2/10/2003
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride EU/3/11/892 Treatment of 5q spinal muscular atrophy Repligen Europe Limited 30/08/2011
5´-O-(trans-9´´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine EU/3/07/476 Treatment of acute myleoid leukaemia Clavis Pharma ASA 14/09/2007
5´-O-(trans-9´´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine EU/3/07/476 Treatment of acute myleoid leukaemia Clavis Pharma ASA 14/09/2007
5’-CTG CCA CGT TCT CCT GC-(2’ methoxy)A-(2’ methoxy)C-(2’ methoxy)C-3’ EU/3/04/203 Treatment of myasthenia gravis PPD Global Ltd 21/06/2004
5-aminolevulinic acid hydrochloride EU/3/02/121 Intra-operative photodynamic diagnosis of residual glioma medac Gesellschaft für klinische Spezialpräparate mbH 13/11/2002 Gliolan
EU/1/07/413/...
7/09/2007
5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt EU/3/03/182 Treatment of aneurysmal subarachnoid haemorrhage Axovan Europe Ltd 12/12/2003
5'-O-(trans-9''-octadecenoyl)-1-beta-D-2'-deoxy-2',2'-difluorocytidine EU/3/09/680 Treatment of pancreatic cancer Clovis Oncology UK Limited 28/10/2009
6alpha-ethyl-chenodeoxycholic acid EU/3/10/753 Treatment of primary biliary cirrhosis Intercept Pharma 27/07/2010
6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide EU/3/09/681 Treatment of Huntington´s disease Siena Biotech SpA 28/10/2009
6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2(3H)-one EU/3/12/970 Treatment of amyotrophic lateral sclerosis ICON Clinical Research (UK) Limited 5/03/2012
6-thioguanine (oral liquid) EU/3/09/694 Treatment of acute lymphoblastic leukaemia Only For Children Pharmaceuticals 26/11/2009
7-beta-hydroxycholesteryl-3-beta-oleate EU/3/10/816 Treatment of glioma Intsel Chimos SA 17/12/2010
8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-1,2,4-triazolo[3,4-f][1,6]naphthyridin-3(2H)-one mono-hydrochloride EU/3/09/695 Treatment of ovarian cancer Merck Sharp & Dohme Limited 30/11/2009
9-cis-Retinyl acetate EU/3/11/861 Treatment of Leber's congenital amaurosis QLT Ophthalmics (UK), Ltd 13/05/2011
9-cis-Retinyl acetate EU/3/11/865 Treatment of retinitis pigmentosa QLT Ophthalmics (UK), Ltd 13/05/2011
A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein EU/3/05/317 Treatment of graft-versus-host disease Xenikos BV 26/08/2005
Abarelix EU/3/10/771 Treatment of low-flow priapism Speciality European Pharma Ltd 20/09/2010
Acadesine EU/3/05/280 Treatment of B-cell chronic lymphocytic leukemia (B-CLL) Advancell - Advanced In Vitro Cell Technologies, S.A. 27/05/2005
Acadesine EU/3/11/881 Treatment of multiple myeloma Advancell - Advanced In Vitro Cell Technologies S.A. 5/08/2011
Acetylsalicylic acid EU/3/04/208 Treatment of polycythemia vera Bayer HealthCare AG 29/07/2004
Adeno associated viral vector containing the human calpain 3 gene EU/3/06/359 Treatment of calpainopathy Généthon 6/04/2006
Adeno-associated viral vector serotype 8 containing the human AIPL1 gene EU/3/11/929 Treatment of Leber’s congenital amaurosis type 4 Fondazione Telethon 9/12/2011
Adeno-associated viral vector containing a modified U7-snRNA gene EU/3/05/297 Treatment of Duchenne muscular dystrophy Généthon 27/07/2005
Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene EU/3/10/817 Treatment of rhodopsin-linked retinitis pigmentosa Genable Technologies Ltd 17/12/2010
Adeno-associated viral vector containing modified U1 snRNA EU/3/09/663 Treatment of Duchenne muscular dystrophy Amsterdam Molecular Therapeutics (AMT) B.V. 8/10/2009
Adeno-associated viral vector containing porphobilinogen deaminase gene EU/3/09/632 Treatment of acute intermittent porphyria Amsterdam Molecular Therapeutics BV 29/04/2009
Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene EU/3/11/917 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Institut Pasteur 27/10/2011
Adeno-associated viral vector containing the human alpha-sarcoglycan gene EU/3/08/573 Treatment of alpha-sarcoglycanopathy Généthon 7/11/2008
Adeno-associated viral vector containing the human ARSB gene EU/3/11/864 Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Fondazione Telethon 13/05/2011
Adeno-associated viral vector containing the human factor IX gene EU/3/11/938 Treatment of haemophilia B Amsterdam Molecular Therapeutics BV 11/01/2012
Adeno-associated viral vector containing the human gamma-sarcoglycan gene EU/3/04/233 Treatment of gamma-sarcoglycanopathy Généthon 21/10/2004
Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene EU/3/11/860 Treatment of Leber´s hereditary optic neuropathy Institut de la Vision 13/05/2011
Adeno-associated viral vector expressing lipoprotein lipase EU/3/04/194 Treatment of lipoprotein lipase deficiency Amsterdam Molecular Therapeutics 8/03/2004
Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene EU/3/12/974 Treatment of primary hyperoxaluria type 1 Amsterdam Molecular Therapeutics BV 21/03/2012
Adeno-associated viral vector serotype 5 containing the human ABCA4 gene EU/3/08/609 Treatment of Stargardt’s disease Fondazione Telethon 6/02/2009
Adeno-associated viral vector serotype 9 containing the human sulfamidase gene EU/3/11/877 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Laboratorios del Dr. Esteve, S.A. 21/06/2011
Adenoviral vector containing human p53 gene EU/3/06/404 Treatment of Li Fraumeni Syndrome Gendux Molecular Limited 23/10/2006
Adenovirus associated viral vector serotype 2 containing the human RPE65 gene EU/3/12/981 Treatment of Leber’s congenital amaurosis Alan Boyd Consultants Ltd 2/04/2012
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/486 Treatment of retinitis pigmentosa Centre Hospitalier Universitaire de Nantes 14/11/2007
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/484 Treatment of Leber's congenital amaurosis Centre Hospitalier Universitaire de Nantes 22/10/2007
Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs EU/3/10/772 Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) SANFILIPPO Therapeutics SAS 20/09/2010
Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene EU/3/01/083 Treatment of high-grade glioma with subsequent use of ganciclovir sodium Ark Therapeutics Ltd 6/02/2002
Adrenomedullin EU/3/10/744 Treatment of acute lung injury Mondobiotech Laboratories AG 9/06/2010
Afamelanotide EU/3/09/648 Treatment of solar urticaria Clinuvel UK Limited 24/07/2009
Alginate oligosaccharide (G-block) fragment EU/3/07/475 Treatment of cystic fibrosis AlgiPharma AS 14/09/2007
Alicaforsen EU/3/09/641 Treatment of pouchitis Atlantic Healthcare Limited 15/05/2009
Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix EU/3/10/843 Prevention of arteriovenous access failure in haemodialysis patients Gregory Fryer Associates Ltd 23/02/2011
Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2 EU/3/11/866 Treatment of acute myeloid leukaemia Fate Therapeutics, LTD 13/05/2011
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/619 Treatment of acute myeloid leukaemia TEVA Pharma GmbH 27/02/2009
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/618 Treatment of acute lymphoblastic leukaemia TEVA Pharma GmbH 27/02/2009
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/649 Treatment of Hodgkin lymphoma TEVA Pharma GmbH 24/07/2009
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/664 Treatment of myelodysplastic syndromes TEVA Pharma GmbH 8/10/2009
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/665 Treatment of chronic myeloid leukaemia TEVA Pharma GmbH 8/10/2009
Allogeneic human dermal fibroblasts EU/3/10/774 Treatment of epidermolysis bullosa Intercytex Ltd 20/09/2010
Allogeneic T cells encoding an exogenous TK gene EU/3/11/878 Treatment of acute lymphoblastic leukaemia LTKFarma 21/06/2011
Allogeneic T cells encoding an exogenous TK gene EU/3/10/773 Treatment of acute myeloid leukaemia LTKFarma 20/09/2010
Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2 EU/3/11/867 Treatment of acute myeloid leukaemia Fate Therapeutics, LTD 13/05/2011
Alpha-1 antitrypsin (inhalation use) EU/3/04/244 Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Innovative Drug European Associates (I.D.E.A.) Limited 16/11/2004
Alpha-1 antitrypsin (inhalation use) EU/3/04/243 Treatment of cystic fibrosis Innovative Drug European Associates (I.D.E.A.) Limited 16/11/2004
Alpha-1 proteinase inhibitor EU/3/06/350 Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Octapharma (IP) Limited 16/02/2006
Alpha-1 proteinase inhibitor (inhalation use) EU/3/07/474 Treatment of cystic fibrosis CSL Behring GmbH 14/09/2007
Alpha-1 proteinase inhibitor (inhalation use) EU/3/08/546 Treatment of congenital alpha-1 antitrypsin deficiency Grifols Deutschland GmbH 3/06/2008
Alpha-tocotrienol quinone EU/3/11/937 Treatment of Leigh syndrome Edison Orphan Pharma BV 9/12/2011
Alvocidib EU/3/07/485 Treatment of chronic lymphocytic leukaemia Sanofi Aventis 23/10/2007
Ambrisentan EU/3/05/273 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension European Medical Advisory Services Limited 11/04/2005 Volibris
EU/1/08/451/...
21/04/2008
Amikacin sulfate (liposomal) EU/3/06/387 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Insmed Limited 25/07/2006
Ammonium tetrathiomolybdate EU/3/08/539 Treatment of Wilson´s disease JJGConsultancy Ltd 1/04/2008
Amphotericin B (for inhalation use) EU/3/06/391 Prevention of pulmonary fungal infection in patients deemed at risk Kendle International Ltd 28/08/2006
Amrubicin hydrochloride EU/3/08/538 Treatment of small cell lung cancer Celgene Europe Limited 2/04/2008
Anagrelide Hydrochloride EU/3/00/010 Treatment of essential thrombocythaemia Shire Pharmaceutical Development Ltd 29/12/2000 Xagrid
EU/1/04/295/...
16/11/2004
Anti epidermal growth factor receptor antibody h-R3 EU/3/04/220 Treatment of glioma Oncoscience AG 2/09/2004
Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody EU/3/04/193 Treatment of ovarian cancer Fresenius Biotech GmbH 8/03/2004
Antisense NF-Kß p65 Oligonucleotide EU/3/02/106 Treatment of active ulcerative colitis InDex Pharmaceuticals AB 30/07/2002
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/161 Treatment of neovascular glaucoma Gene Signal SAS 2/10/2003
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/160 Treatment of retinopathy of prematurity Gene Signal SAS 2/10/2003
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/07/445 Prevention of corneal graft rejection Gene Signal SAS 17/04/2007
Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' EU/3/06/416 Treatment of acute myeloid leukaemia EleosInc Limited 3/11/2006
Antisense oligonucleotide targeted to the SMN2 gene EU/3/12/976 Treatment of 5q spinal muscular atrophy Isis USA Ltd 2/04/2012
Aplidine EU/3/04/245 Treatment of multiple myeloma Pharma Mar SA Sociedad Unipersonal 16/11/2004
Apomorphine hydrochloride EU/3/11/862 Treatment of moderate and severe traumatic brain injury Dr Elkan Raphael Gamzu 13/05/2011
Apomorphine hydrochloride (inhalation use) EU/3/06/349 Treatment of off-periods in Parkinson’s disease not responding to oral treatment Vectura Group plc 16/02/2006
Arimoclomol EU/3/06/406 Treatment of amyotrophic lateral sclerosis Orphazyme ApS 26/10/2006
artesunate EU/3/07/430 Treatment of malaria Pharmaorigin ApS 20/02/2007
artesunate EU/3/07/510 Treatment of malaria Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 6/12/2007
ascorbic acid EU/3/08/531 Treatment of Charcot-Marie-Tooth disease type 1A Murigenetics SAS 1/04/2008
Autologous bone marrow-derived mononuclear cell fraction EU/3/10/775 Treatment of thromboangiitis obliterans (Buerger's disease) t2cure GmbH 20/09/2010
Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA EU/3/07/446 Treatment of metachromatic leukodystrophy Fondazione Telethon 13/04/2007
Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene EU/3/05/313 Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency Fondazione Telethon 26/08/2005
Autologous dendritic cells pulsed with autologous tumour cell lysate EU/3/07/431 Treatment of glioma Dorian Regulatory Affairs BV 15/02/2007
Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose EU/3/10/776 Treatment of ovarian cancer Prima Biomed GmbH 20/09/2010
Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene EU/3/12/957 Treatment of X-linked chronic granulomatous disease Généthon 9/02/2012
Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene EU/3/09/623 Treatment of beta-thalassaemia intermedia and major   EGT San Rocco Italia SRL 29/04/2009
EU/3/02/116 Treatment of renal cell carcinoma Liponova GmbH 21/10/2002
Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex EU/3/05/270 Treatment of renal cell carcinoma Antigenics Therapeutics Limited 11/04/2005
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin EU/3/10/831 Treatment of mantle cell lymphoma Biovest Europe Limited 23/02/2011
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin EU/3/06/394 Treatment of follicular lymphoma Biovest Europe Limited 28/08/2006
Autologous tumour-derived gp96 heat shock protein-peptide complex EU/3/09/624 Treatment of glioma Antigenics Therapeutics Limited 29/04/2009
Avian polyclonal IgY antibody against Pseudomonas aeruginosa EU/3/08/564 Treatment of cystic fibrosis Immunsystem I.M.S. AB 23/09/2008
Aviptadil EU/3/07/473 Treatment of sarcoidosis mondoBIOTECH Laboratories Anstalt 14/09/2007
Aviptadil EU/3/06/395 Treatment of acute lung injury mondoBIOTECH Laboratories Anstalt 28/08/2006
Axitinib EU/3/10/844 Treatment of renal cell carcinoma Pfizer Limited 23/02/2011
Azacitidine EU/3/07/509 Treatment of acute myeloid leukaemia Celgene Europe Limited 29/11/2007 Vidaza
EU/1/08/488/...
17/12/2008
Azacitidine EU/3/01/084 Treatment of myelodysplastic syndromes Celgene Europe Limited 6/02/2002 Vidaza
EU/1/08/488/...
17/12/2008
Aztreonam lysinate (inhalation use) EU/3/04/204 Treatment of gram negative bacteria lung infections in cystic fibrosis Gilead Sciences International Limited 21/06/2004 Cayston
EU/1/09/543/...
21/09/2009
Bacterial lipase EU/3/05/323 Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Nordmark Arzneimittel GmbH u. Co. KG 7/11/2005
Bafetinib EU/3/10/731 Treatment of chronic myeloid leukaemia Eudax Srl 10/06/2010
Becatecarin EU/3/06/388 Treatment of cancers of the biliary tree Helsinn Birex Pharmaceuticals Ltd 25/07/2006
Beclomethasone 17, 21-dipropionate (oral use) EU/3/02/093 Treatment of intestinal graft-versus-host disease Soligenix UK Ltd 13/03/2002
Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] EU/3/09/715 Treatment of acute lymphoblastic leukaemia ARIAD Pharma Ltd 2/02/2010
Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] EU/3/09/716 Treatment of chronic myeloid leukaemia ARIAD Pharma Ltd 2/02/2010
Benzoic acid, sodium salt EU/3/02/111 Treatment of non-ketotic hyperglycinaemia Ethicare GmbH 11/09/2002
Beraprost sodium (modified release tablet) EU/3/08/554 Treatment of pulmonary arterial hypertension IDEA Innovative Drugs European Associates Limited 10/07/2008
Beta-artemether / lumefantrine (powder for oral suspension) EU/3/09/702 Treatment of malaria Dafra Pharma International NV 28/01/2010
Betaine anhydrous EU/3/01/045 Treatment of homocystinuria Orphan Europe S.a.r.l. 9/07/2001 Cystadane
EU/1/06/379/...
15/02/2007
Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix EU/3/06/369 Treatment of epidermolysis bullosa CELLERIX S.A. 22/05/2006
Bimosiamose disodium EU/3/05/285 Treatment of acute lung injury Revotar Biopharmaceuticals AG 27/05/2005
Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium EU/3/04/232 Treatment of glioma Sigma Tau Industrie Farmaceutiche Riunite S.p.A 20/10/2004
Blinatumomab EU/3/09/650 Treatment of acute lymphoblastic leukaemia Micromet GmbH 24/07/2009
bosentan EU/3/08/559 Treatment of idiopathic pulmonary fibrosis Actelion Registration Limited 5/09/2008
bosentan EU/3/03/139 Treatment of systemic sclerosis Actelion Registration Limited 17/03/2003 Tracleer
EU/1/02/220/...
7/06/2007
bosentan EU/3/01/019 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Actelion Registration Limited 14/02/2001 Tracleer
EU/1/02/220/...
15/05/2002
Bosutinib EU/3/10/762 Treatment of chronic myeloid leukaemia Pfizer Limited 4/08/2010
Bovine bile extract EU/3/05/287 Treatment of pancreatic cancer Dr Ulrich Granzer 20/06/2005
Brentuximab vedotin EU/3/11/939 Treatment of cutaneous T-cell lymphoma Takeda Global Research and Development Centre (Europe) Ltd 11/01/2012
Brivanib alaninate EU/3/11/918 Treatment of hepatocellular carcinoma Bristol-Myers Squibb Pharma EEIG 27/10/2011
Brivudine EU/3/09/703 Treatment of pancreatic cancer RESprotect GmbH 28/01/2010
Brostallicin EU/3/05/336 Treatment of soft tissue sarcoma AAIPharma S.A. 23/12/2005
Budesonide (oral use) EU/3/06/413 Treatment of Graft-versus-Host disease Dr Falk, Pharma GmbH 3/11/2006
Busulfan (Intravenous use) EU/3/00/011 Busilvex followed by cyclophosphamide (BuCy2) is indicated as conditioning treatment prior to conventional haematopoietic progenitor cell transplantation (HPCT) in adult patients when the combination is considered the best available option.

Busilvex followed by cyclophosphamide (BuCy4) or melphalan (BuMel) is indicated as conditioning treatment prior to conventional haematopoietic progenitor cell transplantation in paediatric patients.		 Pierre Fabre Médicament 29/12/2000 Busilvex
EU/1/03/254/...
9/07/2003
Caffeine citrate EU/3/03/132 Treatment of primary apnoea of premature newborns Chiesi Farmaceutici S.P.A. 17/02/2003 Peyona
EU/1/09/528/...
2/07/2009
Carbetocin EU/3/12/975 Treatment of Prader-Willi syndrome Ferring Pharmaceuticals A/S 21/03/2012
Carboxypeptidase G2 EU/3/02/128 Adjunctive treatment in patients at risk of methotrexate toxicity Enact Pharma PLC 3/02/2003
Cardiotrophin-1 EU/3/06/396 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation Digna Biotech S.L. 28/08/2006
Cardiotrophin-1 EU/3/11/893 Treatment of acute liver failure Digna Biotech S.L. 30/08/2011
Carfilzomib EU/3/08/548 Treatment of multiple myeloma Nexus Oncology Ltd 3/06/2008
Carglumic acid EU/3/08/577 Treatment of propionic acidaemia Orphan Europe SARL 7/11/2008
Carglumic acid EU/3/08/576 Treatment of methylmalonic acidaemia Orphan Europe SARL 7/11/2008
Catumaxomab EU/3/06/414 Treatment of gastric cancer Fresenius Biotech GmbH 3/11/2006
Celecoxib EU/3/01/070 Treatment of Familial Adenomatous Polyposis Pfizer Limited 20/11/2001 Onsenal
EU/1/03/259/...
17/10/2003
Cenersen EU/3/08/587 Treatment of chronic lymphocytic leukaemia EleosInc Limited 3/12/2008
Chimeric antibody to mesothelin EU/3/08/536 Treatment of pancreatic cancer Eisai Europe Limited 17/03/2008
Chimeric IgG monoclonal antibody cG250 EU/3/02/094 Treatment of renal cell carcinoma Wilex AG 19/03/2002
Chimeric locked nucleic acid-deoxynucleoside phosphorothioate-linked oligonucleotide directed against microRNA-451 EU/3/11/940 Treatment of polycythaemia vera Miragen Therapeutics Europe Ltd 11/01/2012
Chimeric monoclonal antibody against claudin-18 splice variant 2 EU/3/10/803 Treatment of gastric cancer GANYMED Pharmaceuticals AG 26/11/2010
Chimeric monoclonal antibody against GD2 EU/3/11/879 Treatment of neuroblastoma United Therapeutics Europe Ltd 21/06/2011
Chimeric monoclonal antibody to shiga-toxin 1 and 2 EU/3/05/301 Treatment of shiga-toxin producing bacterial infection. Albany Regulatory Consulting Ltd 26/08/2005
Chimeric-anti-interleukin-6 monoclonal antibody EU/3/07/508 Treatment of Castleman’s disease Janssen Biologics B.V. 30/11/2007
Chimeric-anti-interleukin-6 monoclonal antibody EU/3/09/642 Treatment of multiple myeloma Janssen Biologics B.V. 12/06/2009
Cholest-4-en-3-one, oxime EU/3/06/397 Treatment of amyotrophic lateral sclerosis Trophos SA 28/08/2006
Cholest-4-en-3-one, oxime EU/3/05/264 Treatment of 5q spinal muscular atrophies Trophos SA 10/03/2005
Cholic acid EU/3/02/127 Treatment of inborn errors in primary bile acid synthesis Laboratoires C.T.R.S 18/12/2002
Cholic acid EU/3/09/683 Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid FGK Representative Service GmbH 28/10/2009
Ciclosporin EU/3/06/360 Treatment of vernal keratoconjunctivitis Novagali Pharma SA 6/04/2006
Ciclosporin EU/3/10/791 Treatment of moderate and severe closed traumatic brain injury NeuroVive Pharmaceutical AB 1/10/2010
Ciclosporin EU/3/07/489 Treatment of Herpes simplex virus stromal keratitis Novagali Pharma SA 29/10/2007
Ciclosporin EU/3/07/455 Prevention of corneal graft rejection Novagali Pharma SA 22/10/2007
Ciclosporin (eye drops, solution) EU/3/09/651 Treatment of atopic keratoconjunctivitis Allergan Pharmaceuticals Ireland 24/07/2009
Ciclosporin (inhalation use) EU/3/05/266 Prevention of graft rejection after lung transplantation Chiron Corporation Limited (trading as Chiron Biopharmaceuticals) 10/03/2005
Ciclosporin (inhalation use) EU/3/04/209 Prevention of graft rejection after lung transplantation PARI Pharma GmbH 29/07/2004
Ciclosporin (inhalation use) EU/3/05/265 Treatment of graft rejection after lung transplantation Chiron Corporation Limited 10/03/2005
Ciclosporin (inhalation use) EU/3/04/210 Treatment of graft rejection after lung transplantation PARI Pharma GmbH 29/07/2004
Cilengitide EU/3/03/184 Treatment of glioma Merck KGaA 14/01/2004
Ciprofloxacin (inhalation use) EU/3/07/469 Treatment of cystic fibrosis Bayer Schering Pharma AG 3/08/2007
Ciprofloxacin (liposomal) EU/3/09/652 Treatment of cystic fibrosis Interface International Consultancy Ltd 24/07/2009
Cisplatin (liposomal) EU/3/07/451 Treatment of pancreatic cancer Regulon AE 8/06/2007
Cladribine (subcutaneous use) EU/3/01/055 Treatment of indolent non-Hodgkin´s lymphoma Lipomed GmbH 18/09/2001 Litak
EU/1/04/275/...
14/04/2004
Clonidine hydrochloride EU/3/11/919 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy BioAlliance Pharma 27/10/2011
Complement factor H EU/3/06/425 Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. 26/01/2007
Cyclic pyranopterin monophosphate EU/3/10/777 Treatment of molybdenum cofactor deficiency type A Orphatec Pharmaceuticals GmbH 20/09/2010
Cyclo{{(E,Z)-(2s,3r,4r)-3-Hydroxy-4-Methyl-2-(Methylamino)Nona-6,8-Dienoyl}-L-2-Aminobutyryl-N-Methyl-Glycyl-N-Methyl-L-Leucyl-L-Valyl-N-Methyl-L-Leucyl-L-Alanyl-D-Alanyl-N-Methyl-L-Leucyl-N-Methyl-L-Leucyl-N-Methyl-L-Valyl} EU/3/07/472 Treatment of chronic non-infectious uveitis Lux Biosciences GmbH 14/09/2007
Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt EU/3/08/610 Treatment of medullary thyroid carcinoma TMC Pharma Services Ltd 6/02/2009
Cysteamine EU/3/11/928 Treatment of cystic fibrosis NovaBiotics Ltd 9/12/2011
Cysteamine bitartrate (gastroresistant) EU/3/10/778 Treatment of cystinosis Raptor Pharmaceuticals Europe BV 20/09/2010
Cysteamine hydrochloride EU/3/08/578 Treatment of cystinosis Orphan Europe SARL 7/11/2008
Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate EU/3/03/149 Treatment of pancreatic cancer in combination with ifosfamide Ziel Biopharma Limited 30/06/2003
Darinaparsin EU/3/11/850 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) ZIOPHARM Oncology Ltd 15/04/2011
Dasatinib EU/3/05/338 Treatment of acute lymphoblastic leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 Sprycel
EU/1/06/363/...
20/11/2006
Dasatinib EU/3/05/339 Treatment of chronic myeloid leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 Sprycel
EU/1/06/363/...
20/11/2006
Daunorubicin (liposomal) EU/3/08/585 Treatment of acute myeloid leukaemia Diatos S. A. 3/12/2008
Davunetide EU/3/10/728 Treatment of progressive supranuclear palsy FGK Representative Service GmbH 23/03/2010
Decitabine EU/3/03/135 Treatment of myelodysplastic syndromes Janssen-Cilag International NV 14/02/2003
Decitabine EU/3/06/370 Treatment of acute myeloid leukaemia Janssen-Cilag International NV 8/06/2006
Deferiprone EU/3/10/832 Treatment of sickle cell disease Apotex Europe B.V. 23/02/2011
Deferoxamine mesilate EU/3/04/231 Treatment of traumatic spinal cord injury SCT Spinal Cord Therapeutics GmbH 20/10/2004
Defibrotide EU/3/04/212 Treatment of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004
Defibrotide EU/3/04/211 Prevention of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004
Denileukin diftitox EU/3/01/075 Treatment of cutaneous T-cell lymphoma Eisai Limited 11/12/2001
Denufosol tetrasodium EU/3/05/342 Treatment of cystic fibrosis Envestia Limited 23/12/2005
Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) EU/3/01/063 Treatment of chronic lymphocytic leukaemia Voisin Consulting S.A.R.L. 20/11/2001
Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) EU/3/01/065 Treatment of multiple myeloma Voisin Consulting S.A.R.L. 20/11/2001
Desipramine hydrochloride EU/3/09/643 Treatment of Rett syndrome Targeon SAS 12/06/2009
Dexamethasone (40 mg tablet) EU/3/10/745 Treatment of multiple myeloma Laboratoires CTRS (Cell Therapies Research & Services) 9/06/2010
Dexamethasone phosphate (iontophoretic solution, ocular use) EU/3/09/636 Treatment of corneal graft rejection
 Interface International Consultancy Ltd 15/05/2009
Dexamethasone sodium phosphate encapsulated in human erythrocytes EU/3/04/230 Treatment of cystic fibrosis Erydel S.p.A. 20/10/2004
Dexrazoxane EU/3/01/059 Treatment of anthracycline extravasations SpePharm Holding B.V. 19/09/2001 Savene
EU/1/06/350/...
28/07/2006
dimethyl sulfoxide EU/3/05/263 Treatment of severe closed traumatic brain injury AOP Orphan Pharmaceuticals AG 3/03/2005
Dinaciclib EU/3/11/901 Treatment of chronic lymphocytic leukaemia Merck Sharp & Dohme Limited 27/09/2011
Dipalmitoylphosphatidylcholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol, sodium salt, synthetic surfactant protein C analogue and synthetic surfactant protein B analogue EU/3/12/982 Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Chiesi Farmaceutici S.P.A. 2/04/2012
Diphenylcyclopropenone EU/3/06/379 Treatment of alopecia totalis Orfagen 29/06/2006
Diphenylcyclopropenone EU/3/06/380 Treatment of alopecia universalis Orfagen 29/06/2006
Donor lymphocyte preparation depleted of functional alloreactive T-cells EU/3/08/561 Prevention of Graft-versus-Host disease Kiadis Pharma Netherlands B.V. 5/09/2008
Doxorubicin hydrochloride (drug eluting beads) EU/3/07/507 Treatment of glioma CellMed AG 29/11/2007
Doxorubicin hydrochloride (in heat-sensitive liposomes) EU/3/10/833 Treatment of hepatocellular carcinoma Biological Consulting Europe Ltd 23/02/2011
Doxorubicin hydrochloride (liposomal) EU/3/06/410 Treatment of soft tissue sarcoma GP-Pharm S.A. 27/10/2006
Doxorubicin polyisohexylcyanoacrylate nanoparticles EU/3/04/229 Treatment of the hepatocellular carcinoma BioAlliance Pharma 21/10/2004
Doxycycline hyclate EU/3/12/961 Treatment of systemic amyloidosis caused by beta-2 microglobulin Giampaolo Merlini 5/03/2012
Doxycycline hyclate EU/3/12/955 Treatment of familial amyloid polyneuropathy Giampaolo Merlini 2/04/2012
Drotrecogin alfa (activated) EU/3/08/565 Treatment of acute respiratory distress syndrome Drugrecure Aps 22/09/2008
Dry extract from birch bark (DER 0.1-0.2:1), extraction solvent n-heptane 95% (V/V) EU/3/10/845 Treatment of epidermolysis bullosa Birken AG 23/02/2011
Duramycin EU/3/02/120 Treatment of cystic fibrosis AOP Orphan Pharmaceuticals AG 13/11/2002
E. Coli heat-shock protein 70 with bovine retinal S-antigen EU/3/05/346 Treatment of autoimmune uveitis Biotech Tools SA 24/01/2006
Ecopipam EU/3/09/717 Treatment of Lesch-Nyhan disease Dr Alain Munoz 3/02/2010
Ecteinascidin 743 EU/3/01/039 Treatment of soft tissue sarcoma PharmaMar S.A. 30/05/2001 Yondelis
EU/1/07/417/...
17/09/2007
Eculizumab EU/3/09/653 Treatment of atypical haemolytic uremic syndrome Alexion Europe SAS 24/07/2009
Eculizumab EU/3/03/166 Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe S.A.S. 17/10/2003 Soliris
EU/1/07/393/...
20/06/2007
Eflornithine EU/3/10/779 Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 20/09/2010
Eflornithine EU/3/11/902 Treatment of neuroblastoma Cancer Prevention Pharma Limited 27/09/2011
Eicosapentaenoic acid EU/3/09/666 Treatment of familial adenomatous polyposis S.L.A. Pharma (UK) Ltd 8/10/2009
Elafin EU/3/07/443 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Proteo Biotech AG 20/03/2007
Entinostat EU/3/10/732 Treatment of Hodgkin's lymphoma Nexus Oncology Ltd. 10/06/2010
Enzastaurin hydrochloride EU/3/05/343 Treatment of glioma Eli Lilly Nederland B.V. 23/12/2005
Enzastaurin hydrochloride EU/3/07/442 Treatment of diffuse large B cell lymphoma Eli Lilly Nederland B.V. 20/03/2007
Eptacog alfa (activated) EU/3/04/246 Treatment of Familial Adenomatous Polyposis TopoTarget Germany AG 30/11/2004
Eptacog alfa (activated) EU/3/05/333 Treatment of diffuse alveolar haemorrhage Pharmaorigin ApS 14/12/2005
Estradiol Hemihydrate and Progesterone EU/3/05/275 Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age Dr Frank Pohlandt 11/04/2005
Ethanol (96 per cent ) (gel for injection) EU/3/04/191 Treatment of congenital venous malformations Orfagen 8/03/2004
Ethanol (96 per cent ) (gel for injection) EU/3/04/190 Treatment of congenital lymphatic malformations Orfagen 8/03/2004
Ethyl Eicosopentaenoate EU/3/00/013 Treatment of Huntington´s disease Amarin Neuroscience Limited 29/12/2000
Etilefrin EU/3/02/122 Treatment of low flow priapism Laboratoires SERB 13/11/2002
Everolimus EU/3/11/894 Treatment of gastric cancer Novartis Europharm Ltd 30/08/2011
Everolimus EU/3/10/764 Treatment of tuberous sclerosis Novartis Europharm Ltd 4/08/2010 Votubia
EU/1/11/710/...
2/09/2011
Ex-vivo expanded autologous human corneal epithelium containing stem cells EU/3/08/579 Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns
 Chiesi Farmaceutici S.P.A. 7/11/2008
Exon 44 specific phosphorothioate oligonucleotide EU/3/08/598 Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 27/02/2009
Exon 45 specific phosphorothioate oligonucleotide EU/3/12/991 Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 26/04/2012
Exon 51 specific phosphorothioate oligonucleotide EU/3/08/599 Treatment of Duchenne muscular dystrophy Glaxo Group Ltd 27/02/2009
Exon 53 specific phosphorothioate oligonucleotide EU/3/12/992 Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 26/04/2012
Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue EU/3/09/667 Treatment of anal fistula Cellerix S.A. 8/10/2009
Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower EU/3/05/302 Treatment of sickle cell disease Xechem UK Ltd 26/08/2005
Ex-vivo cultured adult human mesenchymal stem cells EU/3/07/432 Treatment of Graft-versus-Host disease Genzyme Europe BV 20/02/2007
fampridine EU/3/07/458 Treatment of Guillain-Barré syndrome Dr Ulrich Granzer 10/07/2007
filgrastim EU/3/08/532 Treatment of amyotrophic lateral sclerosis Sygnis Bioscience GmbH & Co. KG 1/04/2008
Filgrastim EU/3/08/580 Treatment of spinal cord injury Sygnis Bioscience GmbH & Co. KG 7/11/2008
Fingolimod EU/3/09/718 Treatment of chronic inflammatory demyelinating polyneuropathy Novartis Europharm Ltd 2/02/2010
Fluocinolone acetonide (prolonged-release intravitreal implant) EU/3/05/261 Treatment of non-infectious uveitis affecting the posterior segment of the eye Bausch & Lomb Ireland 7/03/2005
Forodesine EU/3/10/780 Treatment of chronic lymphocytic leukaemia Mundipharma Research Limited 20/09/2010
Forodesine hydrochloride EU/3/06/428 Treatment of cutaneous T-cell lymphoma Napp Pharmaceuticals Research Limited 29/01/2007
Forodesine hydrochloride EU/3/06/421 Treatment of acute lymphoblastic leukaemia Napp Pharmaceuticals Research Limited 18/12/2006
Fresolimumab EU/3/11/882 Treatment of focal segmental glomerulosclerosis Genzyme Europe BV 5/08/2011
Fumagillin EU/3/01/081 Treatment of diarrhoea associated with intestinal microsporidial infection SANOFI 4/02/2002
G17(9) gastrin-diphtheria toxoid conjugate EU/3/02/130 Treatment of gastric cancer Cato Europe GmbH 28/01/2003
G17(9) gastrin-diphtheria toxoid conjugate EU/3/02/129 Treatment of pancreatic cancer Cato Europe GmbH 24/01/2003
Gadodiamide (liposomal) EU/3/08/583 Treatment of glioma Dr Matthias Luz 3/12/2008
Gallium (68Ga)-pasireotide tetraxetan EU/3/11/920 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours OctreoPharm Sciences GmbH 27/10/2011
Gemtuzumab Ozogamicin EU/3/00/005 Treatment of acute myeloid leukaemia Wyeth Europa Ltd. 18/10/2000
Genetically modified Lactococcus lactis bacteria containing the human trefoil factor 1 gene EU/3/11/903 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy ActoGeniX N.V. 27/09/2011
Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) EU/3/06/405 Treatment of renal cell carcinoma MOLOGEN AG 23/10/2006
Genetically modified human adenovirus encoding human PH20 hyaluronidase EU/3/11/880 Treatment of pancreatic cancer VCN Biosciences S.L. 21/06/2011
Genistein sodium salt dihydrate EU/3/12/980 Treatment of mucopolysaccharidosis type III (Sanfilippo syndrome) Axcentua Pharmaceuticals AB 2/04/2012
Gimatecan EU/3/03/174 Treatment of glioma Sigma Tau Industrie Farmaceutiche Riunite S.p.A 1/12/2003
Givinostat EU/3/09/704 Treatment of systemic-onset juvenile idiopathic arthritis Italfarmaco S.p.A 28/01/2010
Givinostat EU/3/09/719 Treatment of polycythaemia vera Italfarmaco S.p.A 3/02/2010
Glucagon EU/3/12/960 Treatment of congenital hyperinsulinism Biodel UK Limited 5/03/2012
Glufosfamide EU/3/11/851 Treatment of pancreatic cancer Theradex (Europe) Ltd. 15/04/2011
Glutathione EU/3/06/361 Treatment of cystic fibrosis Mukoviszidose e.V. 11/04/2006
Glutathione-pegylated liposomal doxorubicin hydrochloride EU/3/10/781 Treatment of glioma to-BBB Technologies BV 20/09/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/734 Treatment of ornithine carbamoyltransferase deficiency Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/739 Treatment of citrullinaemia type 2 Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/733 Treatment of carbamoyl-phosphate synthase-1 deficiency Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/735 Treatment of citrullinaemia type 1 Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/736 Treatment of argininosuccinic aciduria Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/737 Treatment of hyperargininaemia Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/738 Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Hyperion Therapeutics Limited 10/06/2010
Glycosylation independent lysosomal targeting tagged recombinant human acid alpha glucosidase EU/3/11/921 Treatment of glycogen storage disease type II (Pompe's disease) BioMarin Europe Ltd. 27/10/2011
Guanabenz EU/3/09/625 Treatment of traumatic spinal cord injury Acure Pharma AB 29/04/2009
Gusperimus trihydrochloride EU/3/01/034 Treatment of Wegener’s granulomatosis Nordic Group B.V. 29/03/2001
Halofuginone Hydrobromide EU/3/01/074 Treatment of systemic sclerosis PPD Global Ltd 11/12/2001
Halofuginone Hydrobromide EU/3/12/988 Treatment of Duchenne muscular dystrophy Biological Consulting Europe Ltd 26/04/2012
H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt EU/3/07/521 Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients Vaxon Biotech 18/12/2007
H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 EU/3/05/292 Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Auris Medical Limited 16/06/2005
Heat-killed Mycobacterium vaccae (whole cell) EU/3/10/786 Treatment of tuberculosis Immodulon Therapeutics Ltd 20/09/2010
Heparin sodium EU/3/06/371 Treatment of cystic fibrosis Ockham Biotech Limited 22/05/2006
Heparin sodium EU/3/04/223 Treatment of idiopathic pulmonary fibrosis Prof. Dr Seeger 2/09/2004
Heparin sodium (inhalation use) EU/3/05/337 Treatment of cystic fibrosis Vectura Group plc 23/12/2005
Heparin-activated recombinant human fibroblast growth factor 1 (on a biodegradable device made from alpha-calcium sulphate hemihydrate) EU/3/10/754 Treatment of traumatic spinal cord injury BioArctic Neuroscience AB 27/07/2010
Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 EU/3/06/407 Prevention of necrotizing enterocolitis Dr Michael Moore 31/10/2006
Hepatitis C Immunoglobulin EU/3/05/295 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 8/07/2005
EU/3/03/168 Adjunctive treatment in hematopoietic cell transplantation MolMed SpA 20/10/2003
Herpes simplex virus lacking infected cell protein 34.5 EU/3/03/153 Treatment of glioma Virttu Biologics Limited 9/07/2003
Heterologous human adult liver derived stem cells EU/3/07/506 Treatment of Crigler-Najjar syndrome Promethera Biosciences 29/11/2007
Heterologous human adult liver derived stem cells EU/3/08/530 Treatment of ornithinine transcarbamylase deficiency Promethera Biosciences 4/02/2008
Heterologous human adult liver-derived stem cells EU/3/11/904 Treatment of ornithine transcarbamylase deficiency Fresenius Medical Care Deutschland GmbH 27/09/2011
Heterologous human adult liver-derived stem cells EU/3/12/971 Treatment of carbamoyl-phosphate synthase-1 deficiency Fresenius Medical Care Deutschland GmbH 5/03/2012
Heterologous human adult liver-derived stem cells EU/3/12/983 Treatment of acute liver failure Fresenius Medical Care Deutschland GmbH 26/04/2012
Histamine dihydrochloride EU/3/05/272 Treatment of acute myeloid leukaemia EpiCept GmbH 11/04/2005 Ceplene
EU/1/08/477/...
7/10/2008
HLA class I/II binding tumour associated peptides (ADF-APO-CCN-GUC-K67-MET- MMP-MUC-RGS) EU/3/07/433 Treatment of renal cell carcinoma Immatics Biotechnologies GmbH 15/02/2007
HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor EU/3/04/202 Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients Cellcure A/S 21/06/2004
HLA-B27 derived peptide (amino acid 125-138) EU/3/04/219 Treatment of autoimmune uveitis Dr Gerhild Wildner 2/09/2004
Homoharringtonine EU/3/04/228 Treatment of acute myeloid leukaemia ChemGenex Europe SAS 20/10/2004
Homoharringtonine EU/3/04/224 Treatment of chronic myeloid leukaemia ChemGenex Europe SAS 2/09/2004
Human Alpha1-Proteinase Inhibitor (respiratory use) EU/3/01/044 Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency CSL Behring GmbH 9/07/2001
Human anthrax immunoglobulin EU/3/09/690 Post-exposure prophylaxis of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 9/11/2009
Human anthrax immunoglobulin EU/3/09/691 Treatment of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 5/11/2009
Human anthrax monoclonal antibody EU/3/11/891 Post-exposure prophylaxis of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 5/08/2011
Human anthrax monoclonal antibody EU/3/11/852 Treatment of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 15/04/2011
Human anti-intercellular adhesion molecule1 monoclonal antibody EU/3/08/600 Treatment of multiple myeloma BioInvent International AB 20/01/2009
Human autologous bone-forming cells derived from bone marrow stem cells EU/3/07/490 Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 29/10/2007
Human autologous mesenchymal adult stem cells extracted from adipose tissue EU/3/05/303 Treatment of anal fistula CELLERIX S.A. 26/08/2005
Human coagulation factor X EU/3/07/471 Treatment of hereditary factor X deficiency Bio Products Laboratory 17/09/2007
Human cytomegalovirus immunoglobulin EU/3/06/408 Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Biotest Pharma GmbH 31/10/2006
Human dermal fibroblasts cultured on a bioresorbable polyglactin mesh EU/3/11/873 Treatment of epidermolysis bullosa TMC Pharma Services Ltd 21/06/2011
Human embryonic stem-cell-derived retinal pigment epithelial cells EU/3/11/874 Treatment of Stargardt’s disease TMC Pharma Services Ltd 21/06/2011
Human haptoglobin EU/3/11/936 Treatment of sickle cell disease Bio Products Laboratory Ltd 9/12/2011
Human heterologous liver cells (for infusion) EU/3/10/818 Treatment of citrullinaemia type 1 Cytonet GmbH & Co. KG 17/12/2010
Human heterologous liver cells (for infusion) EU/3/06/362 Treatment of acute liver failure Cytonet GmbH & Co. KG 11/04/2006
Human heterologous liver cells (for infusion) EU/3/10/821 Treatment of carbamoyl-phosphate synthase-1 deficiency Cytonet GmbH & Co. KG 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/819 Treatment of hyperargininaemia Cytonet GmbH & Co. KG 17/12/2010
Human heterologous liver cells (for infusion) EU/3/07/470 Treatment of ornithine-transcarbamylase deficiency Cytonet GmbH & Co. KG 14/09/2007
Human heterologous liver cells (for infusion) EU/3/10/820 Treatment of argininosuccinic aciduria Cytonet GmbH & Co. KG 17/12/2010
Human immunoglobulin EU/3/03/169 Treatment of dermatomyositis Orfagen 20/10/2003
Human immunoglobulin EU/3/03/170 Treatment of polymyositis Orfagen 24/10/2003
Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein EU/3/05/334 Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) Edimer Ltd 14/12/2005
Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) EU/3/06/417 Treatment of renal cell carcinoma Immunservice GmbH 27/10/2006
Human MHC non-restricted cytotoxic T-cell line EU/3/09/696 Treatment of ovarian cancer Abiogen Pharma S.p.A. 30/11/2009
Human monoclonal antibody against CD4 EU/3/04/198 Treatment of cutaneous T-cell lymphoma Genmab A/S 14/04/2004
Human monoclonal antibody against Fas ligand EU/3/12/956 Treatment of pemphigus PinCell s.r.l. 9/02/2012
Human monoclonal antibody against inhibitory killer cell lg-like receptors EU/3/06/392 Treatment of acute myeloid leukaemia Innate Pharma 28/08/2006
Human monoclonal antibody against Pseudomonas aeruginosa IATS-O1 EU/3/09/705 Treatment of pneumonia caused by serotype O1 Pseudomonas aeruginosa Envestia Limited 28/01/2010
Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 EU/3/06/381 Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa Voisin Consulting 29/06/2006
Human monoclonal antibody targeting Staphylococcus aureus alpha-toxin EU/3/12/968 Treatment of pneumonia caused by Staphylococcus aureus Envestia Limited 5/03/2012
Human papilloma virus type 16 E6/E7 synthetic long peptides EU/3/07/520 Treatment of epithelial neoplasia of the vulva positive for human papilloma virus ISA Therapeutics B.V. 20/12/2007
Human plasmin EU/3/10/834 Treatment of acute peripheral arterial occlusion Grifols Deutschland GmbH 23/02/2011
Human plasminogen EU/3/07/461 Treatment of ligneous conjunctivitis Kedrion S.p.A. 3/08/2007
Human platelet antigen-1a immunoglobulin EU/3/11/922 Prevention of fetal and neonatal alloimmune thrombocytopenia due to human platelet antigen-1a incompatibility Prophylix Pharma AS 27/10/2011
Human Staphylococcus aureus immunoglobulin EU/3/05/319 Treatment of Staphylococcus aureus bacteremia Biotest Pharma GmbH 28/10/2005
Human telomerase reverse transcriptase peptide (611-626) EU/3/06/384 Treatment of pancreatic cancer Gemvax A/S 25/07/2006
Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys EU/3/09/677 Treatment of acute lung injury Apeptico Forschung und Entwicklung GmbH 8/10/2009
Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein EU/3/05/290 Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck Viventia Biotech (EU) Limited 20/06/2005
Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 EU/3/09/638 Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation Opsona Therapeutics 15/05/2009
Humanised monoclonal antibody to the folate receptor alpha EU/3/08/535 Treatment of ovarian cancer Eisai Europe Limited 1/04/2008
Humanized Agonistic Anti-CD28 Monoclonal Antibody EU/3/05/276 Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) TeGenero AG 11/04/2005
Hydrocortisone (modified release tablet) EU/3/06/372 Treatment of adrenal insufficiency ViroPharma SPRL 22/05/2006 Plenadren
EU/1/11/715/...
3/11/2011
Hydrocortisone (modified release tablet) EU/3/05/296 Treatment of congenital adrenal hyperplasia Diurnal Limited 27/07/2005
Hydrocortisone (modified release tablet) EU/3/07/441 Treatment of adrenal insufficiency Diurnal Limited 20/03/2007
Hydroxy-propyl-beta-cyclodextrin EU/3/11/895 Treatment of Niemann-Pick disease, type C Susan French 30/08/2011
Hydroxyurea EU/3/03/154 Treatment of sickle cell syndrome Addmedica 9/07/2003 Siklos
EU/1/07/397/...
29/06/2007
Hypothiocyanite / lactoferrin EU/3/09/654 Treatment of cystic fibrosis Alaxia 24/07/2009
Ibuprofen EU/3/01/020 Treatment of patent ductus arteriosus Orphan Europe S.a.r.l. 14/02/2001 Pedea
EU/1/04/284/...
29/07/2004
Icatibant acetate EU/3/03/133 treatment of angioedema Jerini AG 17/02/2003 Firazyr
EU/1/08/461/...
11/07/2008
Idebenone EU/3/07/437 Treatment of Duchenne muscular dystrophy Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2007
Idebenone EU/3/07/434 Treatment of Leber's hereditary optic neuropathy Santhera Pharmaceuticals (Deutschland) GmbH 15/02/2007
Idebenone EU/3/01/062 Treatment of Friedreich’s ataxia Laboratoires Takeda 20/11/2001
Idebenone EU/3/04/189 Treatment of Friedreich’s ataxia Santhera Pharmaceuticals (Deutschland) GmbH 8/03/2004
Iduronate-2-sulfatase EU/3/01/078 Treatment of Mucopolysaccharidosis, type II (Hunter Syndrome) Shire HGT AB 11/12/2001 Elaprase
EU/1/06/365/...
8/01/2007
Iloprost EU/3/00/014 Treatment of primary and of the following forms of secondary pulmonary hypertension: connective tissue disease pulmonary hypertension, drug-induced pulmonary hypertension, portopulmonary hypertension, pulmonary hypertension associated with congenital heart disease, chronic thromboembolic pulmonary hypertension Bayer Schering Pharma AG 29/12/2000 Ventavis
EU/1/03/255/...
16/09/2003
Imexon EU/3/05/341 Treatment of ovarian cancer ICON Clinical Research (UK) Ltd 23/12/2005
Inolimomab EU/3/01/028 Treatment of Graft versus Host Disease EUSA Pharma SAS 5/03/2001
Interferon beta EU/3/07/505 Treatment of acute lung injury Faron Pharmaceuticals Limited 29/11/2007
Interferon gamma EU/3/11/935 Treatment of Friedreich's ataxia Prof. Roberto Testi 9/12/2011
Interferon gamma EU/3/07/491 Treatment of idiopathic pulmonary fibrosis Foundation For Fatal Rare Diseases 29/10/2007
Iodine (123I) Serum Amyloid P EU/3/03/134 Diagnosis of the extent of histologically proven amyloidosis Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. 14/02/2003
Iodine (¹³¹I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody EU/3/02/119 Treatment of glioma Interface International Consultancy Limited 13/11/2002
Iodine (131I) anti-tenascin monoclonal antibody 81C6 EU/3/06/418 Treatment of glioma Biological Consulting Europe Ltd 30/10/2006
Iodine (131I) chimeric IgG monoclonal antibody cG250 EU/3/02/095 Treatment of renal cell carcinoma Wilex AG 19/03/2002
Iodine (131I) chlorotoxin EU/3/07/492 Treatment of glioma Biological Consulting Europe Ltd 22/10/2007
Iodine (131I) iobenguane EU/3/07/525 Treatment of neuroblastoma Molecular Insight Limited 31/01/2008
Iodine (¹³¹I) tositumomab EU/3/03/136 Treatment of follicular lymphoma GlaxoSmithKline Research & Development Limited 14/02/2003
Irinotecan hydrochloride (drug eluting beads) EU/3/07/504 Treatment of glioma CellMed AG 29/11/2007
Isofagomine tartrate EU/3/07/493 Treatment of Gaucher Disease Amicus Therapeutics UK Limited 23/10/2007
Ketoconazole EU/3/12/965 Treatment of Cushing’s syndrome Laboratoire HRA Pharma 23/04/2012
Kifunensine EU/3/11/906 Treatment of beta-sarcoglycanopathy Généthon 27/09/2011
Kifunensine EU/3/11/905 Treatment of alpha-sarcoglycanopathy Généthon 27/09/2011
Kifunensine EU/3/11/907 Treatment of delta-sarcoglycanopathy Généthon 27/09/2011
Kifunensine EU/3/11/908 Treatment of gamma-sarcoglycanopathy Généthon 27/09/2011
l, 1´-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane EU/3/04/227 Treatment to mobilize progenitor cells prior to stem cell transplantation Genzyme Europe B.V. 20/10/2004 Mozobil
EU/1/09/537/...
31/07/2009
Laronidase EU/3/01/022 Treatment of Mucopolysaccharidosis, type I Genzyme Europe B.V. 14/02/2001 Aldurazyme
EU/1/03/253/...
10/06/2003
L-Asparaginase EU/3/04/258 Treatment of acute lymphoblastic leukaemia medac Gesellschaft für klinische Spezialpräparate mbH 26/01/2005
L-asparaginase encapsulated in erythrocytes EU/3/06/409 Treatment of acute lymphoblastic leukaemia Erytech Pharma S.A. 27/10/2006
L-asparaginase encapsulated in erythrocytes EU/3/09/633 Treatment of pancreatic cancer Erytech Pharma SA 15/05/2009
L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-, complex with keyhole limpet haemocyanin EU/3/11/923 Treatment of glioma Orphix Consulting GmbH 27/10/2011
Lenalidomide EU/3/11/924 Treatment of mantle cell lymphoma Celgene Europe Limited 27/10/2011
Lenalidomide EU/3/07/494 Treatment of chronic lymphocytic leukaemia Celgene Europe Limited 19/11/2007
Lenalidomide EU/3/11/868 Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 13/05/2011
Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene EU/3/10/822 Treatment of Fanconi anaemia type A Center for Biomedical Network Research on Rare Diseases (CIBERER) 17/12/2010
Lentiviral vector containing the human ABCA4 gene EU/3/09/720 Treatment of Stargardt´s disease Oxford Biomedica (UK) Ltd 2/02/2010
Lentiviral vector containing the human MYO7A gene EU/3/10/727 Treatment of retinitis pigmentosa in Usher syndrome 1B Oxford Biomedica (UK) Ltd 23/03/2010
Lentiviral vector containing the human Wiskott Aldrich syndrome protein gene EU/3/05/345 Treatment of Wiskott-Aldrich syndrome Généthon 24/01/2006
Lestaurtinib EU/3/06/389 Treatment of acute myeloid leukaemia Cephalon Europe 25/07/2006
Levamisol hydrochloride EU/3/05/324 Treatment of nephrotic syndrome Addmedica 28/10/2005
Levodopa and Carbidopa (Gastroenteral use) EU/3/01/035 Treatment of advanced idiopathic Parkinson´s disease with severe motor fluctuations and not responding to oral treatment Abbott Products GmbH 10/05/2001
Levofloxacin hemihydrate EU/3/08/566 Treatment of cystic fibrosis Mpex London Ltd 23/09/2008
Liarozole EU/3/03/144 Treatment of congenital ichthyoses Stiefel Laboratories (U.K.) Limited 10/06/2003
Linsitinib EU/3/12/977 Treatment of adrenal cortical carcinoma Astellas Pharma Europe B.V. 2/04/2012
Lipopolysaccharide of Ochrobactrum intermedium EU/3/11/941 Prevention of sepsis in at-risk premature infants of less than or equal to 32 weeks of gestational age Diomune S.L. 11/01/2012
Liposomal combination of cytarabine and daunorubicin EU/3/11/942 Treatment of acute myeloid leukaemia Celator (UK) Ltd 11/01/2012
Lisuride hydrogen maleate EU/3/11/869 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Sinoxa Pharma UG 13/05/2011
Lithium citrate tetrahydrate (in reverse-micelle formulation) EU/3/09/706 Treatment of Huntington´s disease Medesis Pharma 28/01/2010
L-Lysine-N-acetyl-L-cysteinate EU/3/01/026 Treatment of cystic fibrosis LABORATOIRES SMB SA 14/02/2001
Lomitapide EU/3/10/823 Treatment of familial chylomicronaemia Aegerion Pharmaceuticals 17/12/2010
Low molecular weight dextran sulfate EU/3/11/883 Treatment for mobilisation of progenitor cells prior to stem cell transplantation TikoMed AB 5/08/2011
Low molecular weight dextran sulfate EU/3/09/669 Prevention of graft rejection during pancreatic islet transplantation TikoMed AB 9/10/2009
L-threo-3,4-dihydroxyphenylserine EU/3/07/466 Treatment of orthostatic hypotension in patients with multiple system atrophy Diamond BioPharm Limited 2/08/2007
L-threo-3,4-dihydroxyphenylserine EU/3/07/465 Treatment of orthostatic hypotension in patients with pure autonomic failure Diamond BioPharm Limited 2/08/2007
Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide EU/3/07/523 Treatment of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 31/01/2008
Macitentan EU/3/11/909 Treatment of pulmonary arterial hypertension Actelion Registration Limited 27/09/2011
Macitentan EU/3/09/707 Treatment of idiopathic pulmonary fibrosis Actelion Registration Limited 28/01/2010
Mannitolum EU/3/05/325 Treatment of cystic fibrosis Pharmaxis Pharmaceuticals Limited 7/11/2005
Maribavir EU/3/07/519 Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk ViroPharma SPRL 18/12/2007
Masitinib mesilate EU/3/09/684 Treatment of pancreatic cancer AB Science 28/10/2009
Maytansinoid-conjugated humanised monoclonal antibody against CD56 EU/3/10/835 Treatment of multiple myeloma ImmunoGen Europe Limited 23/02/2011
Maytansinoid-conjugated humanised monoclonal antibody against CD56 EU/3/10/792 Treatment of small cell lung cancer ImmunoGen Europe Limited 1/10/2010
Maytansinoid-conjugated humanised monoclonal antibody against CD56 EU/3/10/746 Treatment of Merkel cell carcinoma ImmunoGen Europe Limited 9/06/2010
Mecasermin EU/3/05/307 Treatment of primary growth hormone insensitivity syndrome Ipsen Pharma 26/08/2005
Mecasermin EU/3/06/373 Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects Ipsen Pharma 22/05/2006 INCRELEX
EU/1/07/402/...
3/08/2007
Mecasermin rinfabate EU/3/06/399 Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Premacure AB 28/08/2006
Melatonin EU/3/12/978 Treatment of perinatal asphyxia Dr Nicola J Robertson 2/04/2012
Melatonin EU/3/05/274 Non-24-Hour Sleep-Wake Disorder in blind people with no light perception ICON Clinical Research (UK) Limited 11/04/2005
Mepolizumab EU/3/04/213 Treatment of hypereosinophilic syndrome Glaxo Group Limited 29/07/2004
Mercaptopurine (oral liquid) EU/3/07/496 Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 22/10/2007
Mercaptopurine (oral suspension) EU/3/09/628 Treatment of acute lymphoblastic leukaemia Nova Laboratories Limited 30/04/2009 Mercaptopurine Nova Laboratories
EU/1/11/727/...
9/03/2012
Metastable technetium 99 [99mTc] demogastrin 2 EU/3/06/400 Diagnosis of medullary thyroid carcinoma Biomedica Life Sciences SA 28/08/2006
Methotrexate (oral liquid) EU/3/07/495 Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 24/10/2007
Methoxsalen EU/3/06/374 Treatment of Graft-versus-Host disease Johnson & Johnson Medical Ltd 22/05/2006
Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate EU/3/07/518 Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension Bayer Schering Pharma AG 20/12/2007
Methyl O-4-O-[2-[2-[2-[2-[[N-[(1R)-1-[[4-(aminoiminomethyl)phenyl]methyl]-2-oxo-2-(1-piperidinyl)ethyl]-N2-[(4-methoxy-2,3,6-trimethylphenyl)sulfonyl]-L-a-asparaginyl-4-aminobutanoyl-N6-[5-[(3aS,4S,6aR)-hexahydro-2-oxo-1H-thieno[3,4-d]imidazol-4-yl]-1-oxopentyl]-L-lysyl]amino]ethoxy]ethoxy]ethoxy]ethyl]-2,3-di-O-methyl-6-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-ß-D-glucopyranuronosyl-(1->4)-O-2,3,6-tri-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-a-L-idopyranuronosyl-(1->4)-3-O-methyl-a-D-glucopyranoside 2,6-bis(hydrogen sulfate) octasodium salt EU/3/11/884 Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Endotis Pharma 5/08/2011
Methylthioninium EU/3/10/806 Treatment of progressive non-fluent aphasia Prof. Claude Wischik 26/11/2010
Methylthioninium EU/3/10/807 Treatment of frontotemporal dementia with parkinsonism-17 Prof. Claude Wischik 26/11/2010
Methylthioninium EU/3/10/804 Treatment of progressive supranuclear palsy Prof. Claude Wischik 26/11/2010
Methylthioninium EU/3/10/805 Treatment of behavioural variant frontotemporal dementia Prof. Claude Wischik 26/11/2010
Metronidazole EU/3/11/875 Treatment of pouchitis FORMAC Pharmaceuticals NV 21/06/2011
Midostaurin EU/3/10/765 Treatment of mastocytosis Novartis Europharm Ltd 4/08/2010
Midostaurin EU/3/04/214 Treatment of acute myeloid leukaemia Novartis Europharm Ltd 29/07/2004
Mifepristone EU/3/09/614 Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin EXELGYN 27/02/2009
Mifepristone EU/3/11/925 Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin Voisin Consulting SARL 27/10/2011
Miglustat EU/3/06/351 Treatment of Niemann-Pick disease, type C Actelion Registration Ltd 16/02/2006 Zavesca
EU/1/02/238/...
26/01/2009
Milatuzumab EU/3/08/601 Treatment of multiple myeloma Immunomedics GmbH 19/01/2009
Milatuzumab EU/3/08/602 Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 19/01/2009
Miltefosine EU/3/08/567 Treatment of cutaneous T-cell lymphoma ExperGen Drug Development GmbH 22/09/2008
Miltefosine EU/3/02/104 Treatment of visceral leishmaniasis Zentaris GmbH 12/06/2002
Miltefosine EU/3/05/282 Treatment of Acanthamoeba keratitis Orphanidis Pharma Research GmbH 27/05/2005
Mitotane EU/3/02/102 Treatment of adrenal cortical carcinoma Laboratoire HRA Pharma 12/06/2002 Lysodren
EU/1/04/273/...
28/04/2004
Mixture of seven synthetic fragments consisting of p21 RAS peptides EU/3/11/885 Treatment of pancreatic cancer Targovax AS 5/08/2011
Mogamulizumab EU/3/11/943 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) ProStrakan Limited 11/01/2012
Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E EU/3/08/595 Treatment of anaplastic large cell lymphoma Seattle Genetics UK Limited 15/01/2009
Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E EU/3/08/596 Treatment of Hodgkin lymphoma Seattle Genetics UK Limited 15/01/2009
Multilamellar microvesicle comprising phosphatidylcholine, sphingomyelin, phosphatidylethanolamine, phosphatidylserine, phospatidylinositol and cholesterol EU/3/11/896 Treatment of cystic fibrosis Lamellar Biomedical Ltd 30/08/2011
Muramyl tripeptide phosphatidyl ethanolamine EU/3/04/206 Treatment of osteosarcoma IDM Pharma S.A. 21/06/2004 Mepact
EU/1/08/502/...
6/03/2009
Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 EU/3/08/592 Treatment of hairy cell leukaemia MEDIMMUNE Limited 4/12/2008
Murine anti-idiotypic antibody against OC125 antibody against CA125 antigen EU/3/03/155 Treatment of ovarian cancer Menarini Ricerche S.p.A. 9/07/2003
Murine monoclonal antibody against CD26 EU/3/10/808 Treatment of graft-versus-host disease ADIENNE S.r.l. 26/11/2010
Mycophenolate mofetil EU/3/05/298 Treatment of Cushing’s syndrome secondary to ectopic ACTH secretion Laboratoire HRA Pharma 27/07/2005
N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide EU/3/08/556 Treatment of cystic fibrosis Vertex Pharmaceuticals (U.K.) Limited 8/07/2008
N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide EU/3/07/478 Treatment of Hodgkin lymphoma CanReg (Europe) Limited 14/09/2007
N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide EU/3/07/526 Treatment of acute myeloid leukaemia CanReg (Europe) Limited 31/01/2008
N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide EU/3/08/568 Treatment of partial deep dermal and full thickness burn wounds Creative Antibiotics Sweden AB 22/09/2008
N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt EU/3/09/622 Treatment of acute myeloid leukaemia Ambit Europe Limited 23/03/2009
N-(6-(2-aminophenylamino)-6-oxohexyl)-4-methylbenzamide EU/3/10/793 Treatment of Friedreich's ataxia Repligen Europe Limited 1/10/2010
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/888 Treatment of primary myelofibrosis YM BioSciences (UK) Limited 5/08/2011
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/887 Treatment of post-essential thrombocythaemia myelofibrosis YM BioSciences (UK) Limited 5/08/2011
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/886 Treatment of post-polycythaemia vera myelofibrosis YM BioSciences (UK) Limited 5/08/2011
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/04/242 Treatment of mastocytosis OxThera AB 16/11/2004
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/04/251 Treatment of malignant gastro intestinal stromal tumours Dr Geoffrey Allan 21/12/2004
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/05/286 Treatment of multiple myeloma Dr Geoffrey Allan 20/06/2005
N,N'-bis(2-mercaptoethyl)isophthalamide EU/3/11/944 Treatment of mercury toxicity CTI Science Limited 11/01/2012
N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl) amino] isonicotinamide hydrochloride EU/3/10/824 Treatment of acute myeloid leukaemia Merck KGaA 17/12/2010
N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride EU/3/09/685 Treatment of pancreatic cancer Merck KGaA 9/11/2009
N-[4-(3-amino-1H-indazol-4-yl)phenyl]-N´-(2-fluoro-5-methylphenyl) urea EU/3/07/517 Treatment of hepatocellular carcinoma Abbott Laboratories Limited 20/12/2007
N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine and folic acid EU/3/12/958 Diagnosis of positive folate receptor status in ovarian cancer Endocyte Europe B.V. 9/02/2012
N-[6-(cis-2,6-dimethylmorpholin-4-yl)pyridine-3-yl]-2-methyl-4'-(trifluoromethoxy)[1,1'-biphenyl]-3-carboxamide EU/3/09/697 Treatment of naevoid basal cell carcinoma syndrome (Gorlin syndrome) Novartis Europharm Limited 25/11/2009
N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide EU/3/11/897 Treatment of tuberculosis Pfizer Limited 30/08/2011
N-{2-Chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N´-(5-methyl-3-isoxazolyl) urea hydrochloride monohydrate EU/3/10/747 Treatment of renal cell carcinoma Aveo Pharma Ltd 9/06/2010
N2´-Deacetyl-N2´-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody EU/3/08/593 Treatment of multiple myeloma Biotest AG 3/12/2008
N-3[[4(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl) oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) EU/3/04/188 Treatment of moderate and severe traumatic brain injury Xytis Pharmaceuticals Limited 23/02/2004
N-acetylgalactosamine-4-sulfatase EU/3/01/025 Treatment of Mucopolysaccharidosis, type VI (Maroteaux-Lamy Syndrome) BioMarin Europe Ltd 14/02/2001 Naglazyme
EU/1/05/324/...
24/01/2006
N-adamantanyl-N'-geranyl-ethylenediamine EU/3/07/479 Treatment of tuberculosis RLM Consulting 14/09/2007
Nafamostat mesilate EU/3/10/782 Treatment of cystic fibrosis Mucokinetica Ltd 20/09/2010
Nanobody directed towards the human A1 domain of von Willebrand factor EU/3/09/629 Treatment of thrombotic thrombocytopenic purpura Ablynx NV 30/04/2009
Nanoliposomal irinotecan EU/3/11/933 Treatment of pancreatic cancer Merrimack Pharmaceuticals UK Limited 9/12/2011
Nanoparticle albumin-bound paclitaxel EU/3/10/809 Treatment of pancreatic cancer Celgene Europe Limited 26/11/2010
Naptumomab estafenatox EU/3/07/480 Treatment of renal cell carcinoma Active Biotech AB 14/09/2007
N-carbamyl-L-glutamic acid EU/3/00/007 Treatment of N-acetylglutamate synthetase (NAGS) deficiency Orphan Europe S.a.r.l. 18/10/2000 Carbaglu
EU/1/02/246/...
24/01/2003
nelarabine EU/3/05/293 Treatment of acute lymphoblastic leukaemia Glaxo Group Limited 16/06/2005 Atriance
EU/1/07/403/...
22/08/2007
Nemorubicin hydrochloride EU/3/05/300 Treatment of hepatocellular carcinoma Nerviano Medical Sciences Srl 28/07/2005
NGR-human tumour necrosis factor EU/3/08/549 Treatment of malignant mesothelioma MolMed S.p.A. 3/06/2008
NGR-human tumour necrosis factor EU/3/09/686 Treatment of hepatocellular carcinoma MolMed S.p.A. 9/11/2009
NH2-Cys-Ser-Ser-Val-Thr-Ala-Trp-Thr-Thr-Gly-Cys-Gly-CONH2 EU/3/11/910 Treatment of traumatic spinal cord injury PHARMAXON 27/09/2011
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/993 Treatment of neurofibromatosis type 2 Sirius Regulatory Consulting Limited 26/04/2012
Nilotinib EU/3/06/375 Treatment of chronic myeloid leukaemia Novartis Europharm Ltd 22/05/2006 Tasigna
EU/1/07/422/...
19/11/2007
Nilotinib hydrochloride monohydrate EU/3/07/447 Treatment of gastro intestinal stromal tumours Novartis Europharm Ltd 13/04/2007
Nimorazole EU/3/10/842 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Azanta A/S 23/02/2011
Nimorazole maleate EU/3/12/952 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Conventia Medical LLP 9/02/2012
Nimotuzumab EU/3/08/550 Treatment of pancreatic cancer Oncoscience AG 3/06/2008
Nitisinone EU/3/00/012 Treatment of tyrosinaemia type I Swedish Orphan International AB 29/12/2000 Orfadin
EU/1/04/303/...
21/02/2005
Nitisinone EU/3/02/096 Treatment of alkaptonuria Swedish Orphan International AB 13/03/2002
N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate EU/3/06/401 Treatment of familial amyloid polyneuropathy Pfizer Specialty UK Limited 28/08/2006
N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase EU/3/09/615 Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) Dr Ulrich Granzer 27/02/2009
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/811 Treatment of post-polycythaemia vera myelofibrosis Sanofi Aventis 26/11/2010
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/794 Treatment of primary myelofibrosis Sanofi Aventis 1/10/2010
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/810 Treatment of post-essential thrombocythaemia myelofibrosis Sanofi Aventis 26/11/2010
Octenidine dihydrochloride EU/3/10/755 Prevention of late-onset sepsis in premature infants of less than or equal to 32 weeks of gestational age Schülke & Mayr GmbH 27/07/2010
Octocog alpha (liposomal) EU/3/09/655 Treatment of haemophilia A Bayer Schering Pharma AG 24/07/2009
Octreotide chloride (lipid depot solution) EU/3/09/645 Treatment of acromegaly Camurus AB 12/06/2009
Ofatumumab EU/3/08/581 Treatment of chronic lymphocytic leukaemia Glaxo Group Limited 7/11/2008 Arzerra
EU/1/10/625/...
19/04/2010
Olaparib EU/3/07/501 Treatment of ovarian cancer AstraZeneca AB 6/12/2007
Oleylphosphocholine EU/3/12/964 Treatment of leishmaniasis Dafra Pharma International NV 23/04/2012
Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt EU/3/05/327 Treatment of glioma Oligovax 28/10/2005
Ombrabulin EU/3/11/853 Treatment of soft tissue sarcoma Sanofi Aventis 15/04/2011
Omigapil maleate EU/3/08/540 Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). Santhera Pharmaceuticals (Deutschland) GmbH 8/05/2008
Omigapil maleate EU/3/08/544 Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency Santhera Pharmaceuticals (Deutschland) GmbH 8/05/2008
Oregovomab EU/3/02/109 Treatment of ovarian cancer ViRexx International Corp. Limited 30/07/2002
Ornithine phenylacetate EU/3/11/945 Treatment of acute liver failure Dr Ulrich Granzer 11/01/2012
Ovine anti-colchicine polyclonal antibody fragments EU/3/10/825 Treatment of colchicine poisoning Laboratoires SERB 17/12/2010
Oxalobacter formigenes strain HC-1 EU/3/06/354 Treatment of primary hyperoxaluria OxThera AB 17/02/2006
Paclitaxel (aqueous gel) EU/3/10/846 Treatment of oesophagus carcinoma BTG plc 23/02/2011
Paclitaxel (liposomal) EU/3/06/419 Treatment of pancreatic cancer MediGene AG 31/10/2006
Paclitaxel (micellar) EU/3/06/422 Treatment of ovarian cancer Oasmia Pharmaceutical AB 18/12/2006
Palifosfamide EU/3/08/584 Treatment of soft tissue sarcoma Ziopharm Oncology Limited 3/12/2008
Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) EU/3/04/222 Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Eli Lilly Nederland B.V. 2/09/2004
Paquinimod EU/3/10/836 Treatment of systemic sclerosis Active Biotech AB 23/02/2011
Para-aminosalicylic acid EU/3/10/826 Treatment of tuberculosis Lucane Pharma SA 17/12/2010
Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex EU/3/06/367 Treatment of solitary bone cysts Kuros Biosurgery International AG 11/04/2006
pasireotide EU/3/09/670 Treatment of acromegaly Novartis Europharm Ltd 8/10/2009
pasireotide EU/3/09/671 Treatment of Cushing's disease Novartis Europharm Ltd 8/10/2009 Signifor
EU/1/12/753/...
24/04/2012
Pegvisomant EU/3/01/023 Treatment of acromegaly Pfizer Ltd 14/02/2001 Somavert
EU/1/02/240/...
13/11/2002
Pegylated arginine deiminase EU/3/05/289 Treatment of hepatocellular carcinoma Dr Francesco Izzo 20/06/2005
Pegylated B-domain-deleted sequence-modified recombinant human factor VIII EU/3/10/847 Treatment of haemophilia A Bayer Schering Pharma AG 23/02/2011
Pegylated carboxyhaemoglobin EU/3/09/698 Treatment of sickle cell disease Voisin Consulting S.A.R.L. 26/11/2009
Pegylated L-asparaginase EU/3/08/569 Treatment of acute lymphoblastic leukaemia Enzon (UK) Limited 22/09/2008
Pegylated proline-interferon alpha-2b EU/3/11/932 Treatment of polycythaemia vera AOP Orphan Pharmaceuticals AG 9/12/2011
Pegylated recombinant Erwinia chrysanthemi L-asparaginase EU/3/11/889 Treatment of acute lymphoblastic leukaemia EUSA Pharma SAS 5/08/2011
Pegylated recombinant factor VIIa EU/3/08/551 Treatment of haemophilia A Novo Nordisk A/S 4/06/2008
Pegylated recombinant factor VIIa EU/3/08/552 Treatment of haemophilia B Novo Nordisk A/S 3/06/2008
Pegylated recombinant factor VIII EU/3/12/995 Treatment of haemophilia A Novo Nordisk A/S 26/04/2012
Pegylated recombinant human factor IX EU/3/09/640 Treatment of haemophilia B Novo Nordisk A/S 15/05/2009
Pegylated recombinant phenylalanine ammonia lyase EU/3/09/708 Treatment of hyperphenylalaninaemia BioMarin Europe Ltd 28/01/2010
Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) EU/3/05/329 Treatment of the localised scleroderma Digna Biotech S.L. 28/10/2005
Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) EU/3/05/326 Treatment of systemic sclerosis Digna Biotech S.L. 28/10/2005
Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis EU/3/09/689 Treatment of myasthenia gravis CuraVac Europe SPRL 9/11/2009
Peretinoin EU/3/11/890 Treatment of hepatocellular carcinoma Kowa Pharmaceutical Europe Co. Ltd. 5/08/2011
Perifosine EU/3/10/740 Treatment of multiple myeloma Æterna Zentaris GmbH 10/06/2010
Phenylephrine Hydrochloride EU/3/01/069 Treatment of ileal pouch anal anastomosis related faecal incontinence S.L.A. Pharma (UK) Limited 20/11/2001
Picoplatin EU/3/07/502 Treatment of small cell lung cancer Kendle International Ltd 6/12/2007
Pirfenidone EU/3/04/241 Treatment of idiopathic pulmonary fibrosis InterMune UK Limited 16/11/2004 Esbriet
EU/1/11/667/...
28/02/2011
Plerixafor EU/3/11/931 Adjunctive treatment to cytotoxic therapy in acute myeloid leukaemia Genzyme Europe B.V. 9/12/2011
Polihexanide EU/3/07/498 Treatment of Acanthamoeba keratitis S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. 14/11/2007
Pomalidomide EU/3/09/672 Treatment of multiple myeloma Celgene Europe Limited 8/10/2009
Pomalidomide EU/3/10/757 Treatment of primary myelofibrosis Celgene Europe Limited 27/07/2010
Pomalidomide EU/3/12/986 Treatment of systemic sclerosis Celgene Europe Limited 26/04/2012
Pomalidomide EU/3/10/758 Treatment of post-polycythaemia vera myelofibrosis Celgene Europe Limited 27/07/2010
Pomalidomide EU/3/10/759 Treatment of post-essential thrombocythaemia myelofibrosis Celgene Europe Limited 27/07/2010
Porfimer sodium (for use with photodynamic therapy) EU/3/02/086 Treatment of high-grade dysplasia in Barrett’s Esophagus Pinnacle Biologics B.V. 6/03/2002 PhotoBarr
EU/1/04/272/...
25/03/2004
Porfimer sodium (for use with photodynamic therapy) EU/3/04/215 Treatment of cholangiocarcinoma Pinnacle Biologics B.V. 29/07/2004
Pralatrexate EU/3/10/795 Treatment of Hodgkin's lymphoma Allos Therapeutics Limited 1/10/2010
Pralatrexate EU/3/10/741 Treatment of cutaneous T-cell lymphoma Choice Pharma Limited 10/06/2010
Pralatrexate EU/3/08/603 Treatment of non-papillary transitional cell carcinoma of the urinary bladder Allos Therapeutics Limited 19/01/2009
Pralatrexate EU/3/07/444 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Allos Therapeutics Limited 13/04/2007
Prasterone EU/3/03/156 Treatment of adrenal insufficiency Medicom Healthcare BV 28/07/2003
Pravastatin / zoledronic acid EU/3/10/748 Treatment of Hutchinson-Gilford progeria Prenyl BIO SAS 9/06/2010
Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein EU/3/02/101 Treatment of glioma EUDRAC Limited 30/04/2002
Purified bromelain EU/3/02/107 Treatment of partial deep dermal and full thickness burns TEVA Pharma GmbH 30/07/2002
Pyr-His-Trp-Ser-Tyr-D-Lys(doxorubicinylglutarate)-Leu-Arg-Pro-Gly-NH2, acetate salt EU/3/10/766 Treatment of ovarian cancer Æterna Zentaris GmbH 4/08/2010
Pyridoxalated haemoglobin polyoxyethylene EU/3/07/463 Treatment of cardiogenic shock Curacyte AG 2/08/2007
R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H -1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea EU/3/07/452 Treatment of gastric carcinoid Trio Medicines Ltd 14/06/2007
Raloxifene hydrochloride EU/3/10/730 Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 10/06/2010
Ramoplanin EU/3/01/049 Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection Vicuron Pharmaceuticals Italy srl, 9/07/2001
R-baclofen EU/3/11/858 Treatment of fragile X syndrome Lakeside Regulatory Consulting Services Ltd 15/04/2011
Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene EU/3/07/440 Treatment of congenital alpha-1 antitrypsin deficiency TMC Pharma Services Ltd. 20/03/2007
Recombinant antibody construct against human CD30 and CD16A EU/3/09/673 Treatment of Hodgkin lymphoma Affimed Therapeutics AG 9/10/2009
Recombinant antibody derivative against human CD19 and CD3 EU/3/03/176 Treatment of chronic lymphocytic leukaemia Micromet GmbH 1/12/2003
Recombinant antibody derivative against human CD19 and CD3 EU/3/03/175 Treatment of mantle cell lymphoma Micromet GmbH 1/12/2003
Recombinant chimeric monoclonal antibody against CD20 EU/3/09/699 Treatment of chronic lymphocytic leukaemia LFB-Biotechnologies 26/11/2009
Recombinant derivative of C3 transferase EU/3/08/563 Treatment of traumatic spinal cord injury Triskel EU Services 5/09/2008
Recombinant dog gastric lipase EU/3/03/157 Treatment of cystic fibrosis Meristem Therapeutics S.A. 9/07/2003
Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 EU/3/07/453 Treatment of haemophilia B (congenital factor IX deficiency) Biogen Idec Limited 8/06/2007
Recombinant fusion protein consisting of human coagulation factor VIII attached to the Fc domain of human IgG1 EU/3/10/783 Treatment of haemophilia A Biogen Idec Limited 20/09/2010
Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/09/709 Treatment of glioma Apogenix GmbH 28/01/2010
Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/06/411 Prevention of Graft-versus-Host disease Apogenix GmbH 31/10/2006
Recombinant fusion protein consisting of the extracellular portion of human activin receptor IIB linked to the human IgG1 Fc domain EU/3/10/812 Treatment of Duchenne muscular dystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
Recombinant fusion protein linking human coagulation factor IX with human albumin EU/3/09/723 Treatment of haemophilia B CSL Behring GmbH 4/02/2010
Recombinant fusion protein linking human coagulation factor VIIa with human albumin EU/3/11/855 Treatment of haemophilia A CSL Behring GmbH 15/04/2011
Recombinant fusion protein linking human coagulation factor VIIa with human albumin EU/3/11/863 Treatment of haemophilia B CSL Behring GmbH 13/05/2011
Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] EU/3/08/553 Treatment of glioma Gregory Fryer Associates Ltd 3/06/2008
Recombinant glycoprotein gp350 of Epstein-Barr virus EU/3/02/118 Prevention of post transplantation lympho-proliferative disorders Henogen S.A. 22/10/2002
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/248 Treatment of multiple myeloma CellGenix GmbH 21/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/09/656 Treatment of diffuse large B-cell lymphoma CellGenix GmbH 24/07/2009
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/250 Treatment of mantle cell lymphoma CellGenix GmbH 21/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/249 Treatment of follicular lymphoma CellGenix GmbH 23/12/2004
Recombinant homodimer of the human annexin V EU/3/11/946 Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Astellas Pharma Europe B.V. 11/01/2012
Recombinant human acid alpha-glucosidase EU/3/00/018 Treatment of Glycogen Storage Disease type II (Pompe´s disease) Genzyme Europe B.V. 14/02/2001 Myozyme
EU/1/06/333/...
29/03/2006
Recombinant human acid sphingomyelinase EU/3/01/056 Treatment of Niemann-Pick Disease, type B Genzyme Europe B.V. 19/09/2001
Recombinant human ADAMTS-13 EU/3/08/588 Treatment of thrombotic thrombocytopenic purpura Baxter AG 3/12/2008
Recombinant human alpha-Mannosidase EU/3/04/260 Treatment of alpha-Mannosidosis Zymenex A/S 26/01/2005
Recombinant human anti-interferon gamma monoclonal antibody EU/3/10/749 Treatment of haemophagocytic lymphohistiocytosis NovImmune B.V. 9/06/2010
Recombinant human arylsulfatase A EU/3/10/813 Treatment of metachromatic leukodystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
Recombinant human beta-glucuronidase EU/3/12/973 Treatment of mucopolysaccharidosis type VII (Sly syndrome) NDA Regulatory Science Ltd 21/03/2012
Recombinant human bile salt-stimulated lipase EU/3/04/257 Treatment of cystic fibrosis Arexis AB 26/01/2005
Recombinant human C1-inhibitor EU/3/07/435 Prevention of delayed graft function after solid organ transplantation Pharming Group N.V. 20/02/2007
Recombinant human CXCL8 mutant EU/3/08/570 Prevention of delayed graft function after solid organ transplantation ProtAffin Biotechnologie AG 22/09/2008
Recombinant human elafin EU/3/09/710 Treatment of oesophagus carcinoma Proteo Biotech AG 28/01/2010
Recombinant human factor XIII (composed of two A subunits) EU/3/03/179 Treatment of hereditary factor XIII deficiency Novo Nordisk A/S 12/12/2003
Recombinant human galactocerebrosidase EU/3/11/911 Treatment of globoid cell leukodystrophy (Krabbe disease) ACE BioSciences A/S 27/09/2011
Recombinant human heparan N-sulfatase EU/3/08/582 Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) Shire Pharmaceutical Development Limited 7/11/2008
Recombinant human hepatitis C monoclonal antibody against C4 region of E1 EU/3/07/503 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 6/12/2007
Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein EU/3/08/611 Treatment of acute liver failure Alfact Innovation SAS 11/02/2009
Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 EU/3/07/516 Treatment of acute myeloid leukaemia SymbioTec GmbH 20/12/2007
Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 EU/3/10/840 Treatment of acute lymphoblastic leukaemia SymbioTec GmbH 23/02/2011
Recombinant human interleukin-21 EU/3/04/226 Treatment of renal cell carcinoma Quintiles Limited 2/09/2004
Recombinant human lysosomal acid lipase EU/3/10/827 Treatment of lysosomal acid lipase deficiency Synageva BioPharma Ltd. 17/12/2010
Recombinant human methionine proinsulin EU/3/12/985 Treatment of retinitis pigmentosa ProRetina Therapeutics, S.L. 26/04/2012
Recombinant human minibody against complement component C5 EU/3/11/926 Treatment of primary membranoproliferative glomerulonephritis ADIENNE S.r.l. 27/10/2011
Recombinant human minibody against complement component C5 EU/3/08/571 Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system Adienne S.r.l. 22/09/2008
Recombinant Human minibody against complement component C5 fused with RGD-motif EU/3/08/604 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation ADIENNE S.r.l. 20/01/2009
Recombinant human monoclonal antibody against transforming growth factor beta-1, 2 and 3 EU/3/08/533 Treatment of idiopathic pulmonary fibrosis Genzyme Europe BV 1/04/2008
Recombinant human monoclonal antibody to human interleukin (IL)-17A of the IgG1/k class EU/3/09/724 Treatment of chronic non-infectious uveitis Novartis Europharm Ltd 2/02/2010
Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class EU/3/08/605 Treatment of spinal cord injury Novartis Europharm Ltd 19/01/2009
Recombinant human N-acetylgalactosamine-6-sulfatase EU/3/09/657 Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) BioMarin Europe Limited 24/07/2009
Recombinant Human Porphobilinogen Deaminase EU/3/02/103 Treatment of acute intermittent porphyria Zymenex A/S 12/06/2002
Recombinant human proinsulin EU/3/08/612 Treatment of retinitis pigmentosa ProRetina Therapeutics, S.L. 11/02/2009
Recombinant human rod-derived cone viability factor EU/3/07/500 Treatment of retinitis pigmentosa Fovea Pharmaceuticals SA 29/11/2007
Recombinant human serum amyloid P EU/3/09/674 Prevention of scarring post glaucoma filtration surgery Appletree Europe S.à.r.l. 9/10/2009
Recombinant human soluble Fc-gamma receptor Iib EU/3/07/462 Treatment of idiopathic thrombocytopenic purpura SuppreMol GmbH 2/08/2007
Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein EU/3/08/594 Treatment of hypophosphatasia Dr Ulrich Granzer 3/12/2008
Recombinant human vascular endothelial growth factor EU/3/09/711 Treatment of amyotrophic lateral sclerosis NeuroNova AB 29/01/2010
Recombinant human von Willebrand factor EU/3/10/814 Treatment of von Willebrand disease Baxter Innovations GmbH 26/11/2010
Recombinant humanised anti-human interleukin-1 beta monoclonal antibody EU/3/10/796 Treatment of Behçet's disease Les Laboratoires Servier 1/10/2010
Recombinant humanised monoclonal antibody to human Nogo-A protein of the IgG1/kappa class EU/3/10/797 Treatment of amyotrophic lateral sclerosis Glaxo Group Limited 1/10/2010
Recombinant inhibitor of human plasma kallikrein EU/3/02/126 treatment of angioedema Dyax s.a. 18/12/2002
Recombinant kallikrein inhibitor EU/3/09/712 Treatment of Netherton syndrome Dermadis S.A.S. 29/01/2010
Recombinant megakaryopoeisis-stimulating protein EU/3/05/283 Treatment of idiopathic thrombocytopenic purpura Amgen Europe B.V. 27/05/2005 Nplate
EU/1/08/497/...
4/02/2009
Recombinant microbial lipase EU/3/05/331 Treatment of malasbsorption due to exocrine pancreatic enzyme insufficiency Abbott Products GmbH 28/10/2005
Recombinant modified vaccinia Ankara expressing human 5T4 EU/3/06/429 Treatment of renal cell carcinoma Oxford Biomedica (UK) Ltd 26/01/2007
Recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A EU/3/05/318 Prevention of tuberculosis disease in BCG vaccinated individuals Emergent Product Development UK Limited 28/10/2005
Recombinant porcine factor VIII (B domain deleted) EU/3/10/784 Treatment of haemophilia A Inspiration Biopharmaceuticals EU Limited 20/09/2010
Recombinant protein consisting of modified human growth hormone releasing hormone and the translocation and endopeptidase domains of botulinum toxin serotype D EU/3/11/947 Treatment of acromegaly Syntaxin Limited 11/01/2012
Recombinant P-selectin glycoprotein immunoglobulin EU/3/06/376 Prevention of post transplantation graft dysfunction RJM Consultancy Ltd 22/05/2006
Recombinant thymidine phosphorylase encapsulated in autologous erythrocytes EU/3/11/856 Treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) due to thymidine phosphorylase deficiency St George's University of London 15/04/2011
Reparixin EU/3/11/912 Prevention of graft rejection in pancreatic islet transplantation Dompé S.p.A. 27/09/2011
Repertaxin L-lysine salt EU/3/01/058 Prevention of delayed graft function in organ transplant Dompé s.p.a. 19/09/2001
Resminostat EU/3/11/930 Treatment of Hodgkin's lymphoma 4SC AG 9/12/2011
Resminostat EU/3/11/913 Treatment of hepatocellular carcinoma 4SC AG 27/09/2011
Retroviral gamma-c cDNA containing vector EU/3/01/038 Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease GENOPOIETIC S.A.S. 30/05/2001
Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide EU/3/08/542 Treatment of acute myeloid leukaemia Dr Ulrich Granzer 8/05/2008
Rifapentine EU/3/10/750 Treatment of tuberculosis Sanofi Aventis 9/06/2010
Rilonacept EU/3/07/456 Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA) Regeneron UK Limited 10/07/2007 Rilonacept Regeneron
EU/1/09/582/...
23/10/2009
RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´[2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride EU/3/09/725 Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 2/02/2010
RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´[2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride EU/3/08/586 Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 3/12/2008
R-salbutamol sulphate EU/3/07/481 Treatment of cutaneous forms of lupus erythematosus Astion Pharma A/S 14/09/2007
Rubitecan EU/3/03/145 Treatment of pancreatic cancer Eurogen Pharmaceuticals Limited 10/06/2003
Rufinamide EU/3/04/240 Treatment of Lennox-Gastaut syndrome Eisai Limited 20/10/2004 Inovelon
EU/1/06/378/...
16/01/2007
S[+] apomorphine EU/3/12/954 Treatment of amyotrophic lateral sclerosis University of Sheffield 9/02/2012
S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK EU/3/09/634 Treatment of pancreatic cancer MBiotec GmbH 15/05/2009
Salirasib EU/3/11/871 Treatment of pancreatic cancer TMC Pharma Services Ltd 21/06/2011
Sapacitabine EU/3/08/557 Treatment of myelodysplastic syndromes Cyclacel Limited 8/07/2008
Sapacitabine EU/3/08/558 Treatment of acute myeloid leukaemia Cyclacel Limited 10/07/2008
Sarsasapogenin EU/3/08/543 Treatment of amyotrophic lateral sclerosis Phytopharm plc 8/05/2008
Sequence-modified recombinant human factor VIIa EU/3/09/675 Treatment of haemophilia A Bayer Schering Pharma AG 9/10/2009
Sequence-modified recombinant human factor VIIa EU/3/09/676 Treatment of haemophilia B Bayer Schering Pharma AG 8/10/2009
Sialic acid EU/3/12/972 Treatment of hereditary inclusion body myopathy NDA Regulatory Science Ltd 5/03/2012
Sildenafil citrate EU/3/10/815 Treatment of postcardiotomy right ventricular failure Pfizer Limited 26/11/2010
Sildenafil citrate EU/3/03/178 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Pfizer Ltd 12/12/2003 Revatio
EU/1/05/318/...
28/10/2005
Silibinin-C-2',3-dihydrogensuccinate, disodium salt EU/3/10/828 Prevention of recurrent hepatitis C in liver transplant recipients Rottapharm S.p.A 17/12/2010
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/04/217 Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/01/079 Treatment of acute lung injury Pharm Research Associates (UK) Limited 4/02/2002
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/04/216 Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol, sodium salt and palmitic acid EU/3/11/927 Treatment of cystic fibrosis Pharm Research Associates (UK) Limited 27/10/2011
Siplizumab EU/3/06/383 Treatment of T-cell and NK-cell neoplasms MedImmune, LLC 29/06/2006
Sirolimus EU/3/11/898 Treatment of chronic non-infectious uveitis Santen Oy 30/08/2011
Sitaxentan sodium EU/3/04/234 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Encysive (UK) Limited 21/10/2004 Thelin
EU/1/06/353/...
10/08/2006
Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector EU/3/09/630 Treatment of dystrophic epidermolysis bullosa Prof. Alain Hovnanian 30/04/2009
Smilagenin EU/3/11/914 Treatment of amyotrophic lateral sclerosis Phytopharm plc 27/09/2011
S-nitrosoglutathione EU/3/11/870 Treatment of pre-eclampsia Salupont Consulting Ltd 13/05/2011
Sodium butyrate (rectal use) EU/3/05/284 Prevention of radiation proctitis Promefarm srl 27/05/2005
Sodium nitrite EU/3/12/967 Treatment of pulmonary arterial hypertension FGK Representative Service GmbH 5/03/2012
Sodium phenylbutyrate EU/3/12/951 Treatment of carbamoyl-phosphate synthase-1 deficiency Lucane Pharma SA 9/02/2012
Sodium phenylbutyrate EU/3/11/948 Treatment of 5q spinal muscular atrophy GMP-Orphan SAS 11/01/2012
Sodium phenylbutyrate EU/3/12/949 Treatment of citrullinaemia type 1 Lucane Pharma SA 9/02/2012
Sodium phenylbutyrate EU/3/12/950 Treatment of ornithine transcarbamylase deficiency Lucane Pharma SA 9/02/2012
Sodium thiosulfate EU/3/10/848 Treatment of calciphylaxis Dr Franz Köhler Chemie GmbH 23/02/2011
Sodium thiosulfate EU/3/12/979 Treatment of calciphylaxis Aptiv Solutions (UK) Limited 2/04/2012
Soluble yeast beta-1,3/1,6-glucan EU/3/05/294 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Biotec Pharmacon ASA 16/06/2005
Somatropin EU/3/00/001 AIDS wasting Merck Serono Europe Limited 8/08/2000
Sorafenib tosylate EU/3/06/364 Treatment of hepatocellular carcinoma Bayer Schering Pharma AG 11/04/2006 Nexavar
EU/1/06/342/...
29/10/2007
Sorafenib tosylate EU/3/04/207 Treatment of renal cell carcinoma Bayer Schering Pharma AG 29/07/2004 Nexavar
EU/1/06/342/...
19/07/2006
Stiripentol EU/3/01/071 Treatment of severe myoclonic epilepsy in infancy Biocodex 5/12/2001 Diacomit
EU/1/06/367/...
4/01/2007
Suberoylanilide hydroxamic acid EU/3/04/205 Treatment of cutaneous T-cell lymphoma Merck Sharp & Dohme Ltd 21/06/2004
Sulfonated monophosphorylated mannose oligosaccharide EU/3/11/872 Treatment of hepatocellular carcinoma S-cubed Ltd 21/06/2011
Synthetic double-stranded short interfering RNA oligonucleotide directed against proopiomelanocortin EU/3/10/798 Treatment of adrenocorticotropin-dependent Cushing´s syndrome UKR Regulatory Affairs Ltd 1/10/2010
Synthetic double-stranded siRNA oligonucleotide directed against p53 mRNA EU/3/10/751 Prevention of delayed graft function after renal transplantation Verius Limited 9/06/2010
Synthetic double-stranded siRNA oligonucleotide directed against transthyretin mRNA EU/3/11/857 Treatment of familial amyloid polyneuropathy Voisin Consulting SARL 15/04/2011
Talactoferrinum alfa EU/3/07/448 Treatment of renal cell carcinoma Agennix Limited 5/06/2007
Taliglucerase alfa EU/3/10/726 Treatment of Gaucher Disease Protalix B.V 23/03/2010
Tamibarotene EU/3/09/658 Treatment of acute promyelocytic leukaemia Eudax S.R.L. 24/07/2009
Tasimelteon EU/3/10/841 Treatment of non-24-hour sleep-wake disorders in blind people with no light perception Vanda Pharmaceuticals Limited 23/02/2011
Tazarotene EU/3/06/423 Treatment of congenital ichthyoses Orfagen 18/12/2006
Tecovirimat EU/3/10/799 Treatment of cowpox infection SIGA Pharmaceuticals (Europe) Ltd 1/10/2010
Temocillin sodium EU/3/03/183 Treatment of Burkholderia cepacia lung infection in cystic fibrosis Belpharma N.V 14/01/2004
Temsirolimus EU/3/06/420 Treatment of mantle cell lymphoma Pfizer Limited 6/11/2006 Torisel
EU/1/07/424/...
21/08/2009
Temsirolimus EU/3/06/365 Treatment of renal cell carcinoma Pfizer Limited 6/04/2006 Torisel
EU/1/07/424/...
19/11/2007
Terguride EU/3/07/499 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Ergonex Licensing and Regulatory Services AG 29/11/2007
Tesetaxel EU/3/10/829 Treatment of gastric cancer Genta Development Limited 17/12/2010
Tetrahydrobiopterin EU/3/04/199 Treatment of hyperphenylalaninemia Merck Serono Europe Limited 8/06/2004 Kuvan
EU/1/08/481/...
2/12/2008
TGF-beta2 specific phosphorothioate antisense oligodeoxynucleotide EU/3/02/091 Treatment of high-grade glioma Antisense Pharma GmbH 22/03/2002
Thalidomide EU/3/01/067 Treatment of multiple myeloma Celgene Europe Limited 20/11/2001 Thalidomide Celgene
EU/1/08/443/...
16/04/2008
Thiotepa EU/3/06/424 Conditioning treatment prior to haematopoietic progenitor cell transplantation Adienne S.r.l. 29/01/2007 Tepadina
EU/1/10/622/...
15/03/2010
Thymalfasin EU/3/02/110 Treatment of hepatocellular carcinoma SciClone Pharmaceuticals Italy S.r.l 30/07/2002
Tipifarnib EU/3/05/269 Treatment of acute myeloid leukaemia Janssen-Cilag International NV 10/03/2005
Titanium dioxide and bisoctrizole EU/3/05/262 Treatment of UV-A and visible light-induced photosensitivity disorders (chronic actinic dermatitis, cutaneous porphyrias, actinic prurigo and solar urticaria) Orfagen 3/03/2005
Tobramycin (inhalation powder) EU/3/03/140 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Chiron Corporation Ltd 17/03/2003 TOBI Podhaler
EU/1/10/652/...
20/07/2011
Tobramycin (inhalation use) EU/3/09/613 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis PARI Pharma GmbH 27/02/2009
Tobramycin (liposomal) EU/3/06/366 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Axentis Pharma Limited 11/04/2006
Topotecan hydrochloride (liposomal) EU/3/08/562 Treatment of glioma Dr Matthias Luz 5/09/2008
Tosedostat EU/3/09/659 Treatment of acute myeloid leukaemia Chroma Therapeutics Ltd 24/07/2009
Tositumomab EU/3/03/137 Treatment of follicular lymphoma GlaxoSmithKline Research & Development Limited 14/02/2003
Trabectedin EU/3/03/171 Treatment of ovarian cancer Pharmamar S.A. Sociedad Unipersonal 17/10/2003
Trabedersen EU/3/09/660 Treatment of pancreatic cancer Antisense Pharma GmbH 24/07/2009
Tranilast EU/3/10/756 Prevention of scarring post glaucoma filtration surgery Altacor Ltd 27/07/2010
Treosulfan EU/3/04/186 Conditioning treatment prior to haematopoietic progenitor cell transplantation medac Gesellschaft für klinische Spezialpräparate mbH 23/02/2004
Treprostinil diethanolamine EU/3/09/635 Treatment of systemic sclerosis United Therapeutics Europe Ltd 15/05/2009
Treprostinil diethanolamine (oral use) EU/3/05/310 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 26/08/2005
Treprostinil sodium (inhalation use) EU/3/04/197 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 14/04/2004
Tretazicar EU/3/08/529 Treatment of visceral leishmaniasis Morvus Technology Limited 4/02/2008
Trientine dihydrochloride EU/3/03/172 Treatment of Wilson´s disease Univar Limited 24/10/2003
Type I native bovine skin collagen EU/3/08/607 Treatment of systemic sclerosis arGentis Autoimmune Europe Limited 9/02/2009
Vaccinia GM-CSF/TK-deactivated virus EU/3/09/700 Treatment of hepatocellular carcinoma Transgene S.A. 26/11/2009
Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar EU/3/04/201 Prevention of stenosis in synthetic grafts used in haemodialysis Ark Therapeutics Ltd 8/06/2004
Vasoactive Intestinal Peptide EU/3/03/173 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Mondobiotech Laboratories AG 22/12/2003
Velaglucerase alfa EU/3/10/752 Treatment of Gaucher disease Shire Pharmaceuticals Ireland Limited 9/06/2010 VPRIV
EU/1/10/646/...
26/08/2010
Veliparib EU/3/10/830 Treatment of ovarian cancer Abbott Laboratories 17/12/2010
Veltuzumab EU/3/09/713 Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 29/01/2010
vildagliptin EU/3/08/575 Treatment of isovaleric acidaemia Orphan Europe SARL 7/11/2008
Vincaleukoblastin-23-oic acid, O4-deacetyl-2-[(2-mercaptoethoxy)carbonyl]hydrazide, disulfide with N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-L-gamma-glutamyl-L-alpha-aspartyl-L-arginyl-L-alpha-aspartyl-L-alpha-aspartyl-L-cysteine EU/3/12/959 Treatment of ovarian cancer Endocyte Europe B.V. 9/02/2012
Vincristine sulphate liposomes EU/3/08/555 Treatment of acute lymphoblastic leukaemia NDA Regulatory Science Ltd 8/07/2008
Viral vector containing DNA encoding the human SMN protein EU/3/11/876 Treatment of 5q spinal muscular atrophy University of Sheffield 21/06/2011
Vorinostat EU/3/10/785 Treatment of malignant mesothelioma Merck Sharp & Dohme Limited 20/09/2010
Vorinostat EU/3/11/854 Treatment of multiple myeloma Merck Sharp & Dohme Limited 15/04/2011
Vosaroxin EU/3/12/990 Treatment of acute myeloid leukaemia Sunesis Europe Ltd 26/04/2012
Yttrium (90Y) antiferritin polyclonal antibodies EU/3/03/162 Treatment of Hodgkin lymphoma Monoclonal Antibodies Therapeutics (MAT) 2/10/2003
Yttrium (90Y) edotreotide EU/3/08/589 Treatment of gastro-entero-pancreatic neuroendocrine tumours Molecular Insight Limited 4/12/2008
Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 EU/3/08/608 Treatment of pancreatic cancer Immunomedics GmbH 6/02/2009
Zanolimumab EU/3/07/438 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Genmab A/S 20/03/2007
Ziconotide (intraspinal use) EU/3/01/048 Treatment of chronic pain requiring intraspinal analgesia Eisai Limited 9/07/2001 Prialt
EU/1/04/302/...
21/02/2005
Zinc acetate dihydrate EU/3/01/050 Treatment of Wilson´s disease Orphan Europe S.a.r.l. 31/07/2001 Wilzin
EU/1/04/286/...
13/10/2004
Zosuquidar trihydrochloride EU/3/06/355 Treatment of acute myeloid leukaemia Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP 17/02/2006