Navigation path

Pharmaceuticals - Community Register


Register of designated Orphan Medicinal Products (alphabetical)

Product EU Designation Designated Orphan Indication Sponsor Designation date Tradename
EU Centralised Nr
Implemented on
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/767 Treatment of post-essential thrombocythaemia myelofibrosis CTI Life Sciences Ltd 25/08/2010
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/768 Treatment of primary myelofibrosis CTI Life Sciences Ltd 25/08/2010
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/769 Treatment of post-polycythaemia vera myelofibrosis CTI Life Sciences Ltd 25/08/2010
11-(4-Dimethylamino-3-hydroxy-6-methyl-tetrahydro-pyran-2-yloxy)-2-ethyl-3,4,10-trihydroxy-3,5,6,8,10,12,14-heptamethyl-1-oxa-6-aza-cyclopentadecane-13,15-dione EU/3/14/1239 Treatment of cystic fibrosis Synovo GmbH 19/02/2014
1-(2,2-difluoro-1,3-benzodioxol-5-yl)-N-{1-[(2R)-2,3-dihydroxypropyl]-6-fluoro-2-(1-hydroxy-2-methylpropan-2-yl)-1H-indol-5-yl}cyclopropanecarboxamide EU/3/14/1281 Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 4/07/2014
1-(2,2-difluoro-2H-1,3-benzodioxol-5-yl)-N-{1-[(2R)-2,3-dihydroxypropyl]-6-fluoro-2-(1-hydroxy-2-methylpropan-2-yl)-1H-indol-5-yl}cyclopropane-1-carboxamide and ivacaftor EU/3/17/1828 Treatment of cystic fibrosis Vertex Pharmaceuticals (Ireland) Limited 27/02/2017 Symkevi
1,2:5,6-Dianhydrogalactitol EU/3/12/1093 Treatment of glioma IDIS Ltd 24/01/2013
1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine EU/3/05/332 Treatment of acute myeloid leukaemia Vion (UK) Limited, ℅ i3 Research 14/12/2005
1-[(2-Chloro-4-methoxyphenoxy)methyl]-4-[(2,6-dichlorophenoxy)methyl]benzene EU/3/12/1021 Prevention of poliomyelitis in patients with immunodeficiencies deemed at risk ViroDefense Ltd 17/07/2012
1-(2-hydroxyethyl)-8-{[5-(4-methylpiperazin-1-yl)-2-(trifluoromethoxy) phenyl]amino}-4,5-dihydro-1H-pyrazolo[4,3-h]quinazoline-3-carboxamide fumarate salt EU/3/18/2057 Treatment of acute myeloid leukaemia Pharm Research Associates (UK) Limited 24/08/2018
1-(2-isopropoxyethyl)-2-thioxo-1,2,3,5-tetrahydro-pyrrolo[3,2-d]pyrimidin-4-one EU/3/14/1404 Treatment of multiple system atrophy AstraZeneca AB 16/12/2014
1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride EU/3/07/459 Treatment of narcolepsy Bioprojet Pharma 10/07/2007 Wakix
1-(3-{4-[3,4-difluoro-2-(trifluoromethyl)phenyl]piperidine-1-carbonyl}-1H,4H,5H,6H,7H-pyrazolo[3,4-c]pyridin-6-yl)ethan-1-one EU/3/18/2014 Treatment of Stargardt's disease IQVIA RDS Ireland Limited 25/05/2018
1-(3-methylbutanoyl)-L-aspartyl-L-threonyl-L-histidyl-L-phenylalanyl-L-prolyl-(L-cystinyl-L-isoleucyl-[(N6-(S)-4-carboxy-4-palmitamidobutanoyl)-L-lysinyl]-L-phenylalanyl-L-glutamyl-L-prolyl-L-arginyl-L-serinyl-L-lysinyl-L-glycinyl-L-cystinyl)-L-lysinamide, disulfide, acetate EU/3/18/2058 Treatment of beta-thalassaemia intermedia and major IQVIA RDS Ireland Limited 24/08/2018
1,3-Propanedisulfonic acid, disodium salt EU/3/01/051 Treatment of Systemic Secondary Amyloidosis C.T. Phinco S.à.r.l. 31/07/2001
1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4 d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one EU/3/12/984 Treatment of chronic lymphocytic leukaemia Janssen-Cilag International NV 26/04/2012 IMBRUVICA
1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one EU/3/13/1115 Treatment of mantle cell lymphoma Janssen-Cilag International NV 12/03/2013 IMBRUVICA
1-[[[4-(4-fluoro-2-methyl-1H-indol-5-yloxy)-6-methoxyquinolin-7-yl]oxy]methyl]cyclopropanamine-dihydrochloride EU/3/18/1972 Treatment of soft tissue sarcoma CATS Consultants GmbH 22/02/2018
1-[4-bromo-5-[1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl]-2-fluorophenyl]-3-phenylurea EU/3/17/1936 Treatment of gastrointestinal stromal tumours Pharma Gateway AB 8/11/2017
1,4-diamino-2,3-dicyano-1,4-bis[2-aminophenylthio]butadiene EU/3/17/1935 Treatment of non-traumatic subarachnoid haemorrhage Edvince AB 8/11/2017
1-(4-(N-glycylamido)phenyl)-3-trifluoromethyl-5-(phenanthren-2-yl)-pyrazole-hydrochloride EU/3/15/1475 Treatment of cryptococcosis Arno Therapeutics UK, Limited 24/04/2015
1-(4-(N-glycylamido)phenyl)-3-trifluoromethyl-5-(phenanthren-2-yl)-pyrazole-hydrochloride EU/3/15/1476 Treatment of tularaemia Arno Therapeutics UK, Limited 24/04/2015
16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide EU/3/10/789 Treatment of medulloblastoma Biogenera SpA 1/10/2010
16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide EU/3/12/1016 Treatment of neuroblastoma Biogenera SpA 4/07/2012
16-base single-stranded peptide nucleic acid oligonucleotide linked to a 7 aminoacid peptide EU/3/16/1690 Treatment of soft tissue sarcoma Biogenera SpA 14/07/2016
16-base single-stranded PNA oligonucleotide linked to a 7-aminoacid peptide EU/3/09/692 Treatment of neuroblastoma Biogenera SpA 25/11/2009
1-(6-benzothiazolylsulfonyl)-5-chloro-1H-indole-2-butanoic acid EU/3/14/1361 Treatment of systemic sclerosis Inventiva 19/11/2014
1-(6-benzothiazolylsulfonyl)-5-chloro-1H-indole-2-butanoic acid EU/3/14/1362 Treatment of idiopathic pulmonary fibrosis Inventiva 19/11/2014
177Lu-tetraxetan-tetulomab EU/3/14/1271 Treatment of follicular lymphoma Nordic Nanovector AS 4/06/2014
(-)-17-(cyclopropylmethyl)-3,14 ß-dihydroxy-4,5 α-epoxy-6ß-[N-methyl-trans-3-(3-furyl) acrylamido] morphinan hydrochloride EU/3/02/115 Treatment of uremic pruritus Toray International Europe GmbH 11/09/2002
17α,21-dihydroxy-16α-methyl-pregna-1,4,9(11)-triene-3,20-dione EU/3/14/1309 Treatment of Duchenne muscular dystrophy Pharma Gateway AB 22/08/2014
1-deoxygalactonojirimycin hydrochloride EU/3/06/368 Treatment of Fabry disease Amicus Therapeutics UK Ltd 22/05/2006 Galafold
(1E,6E)-1,7-bis(3,4-dimethoxyphenyl)-4-cyclobutylmethyl-1,6-heptadiene-3,5-dione EU/3/16/1639 Treatment of X-linked spinal and bulbar muscular atrophy (Kennedy's disease) IQVIA RDS Ireland Limited 28/04/2016
(1R, 2R)-Octanoic acid [2-(2’,3’-dihydro-benzo [1,4] dioxin-6’-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt EU/3/07/514 Treatment of Gaucher Disease Genzyme Europe B.V. 4/12/2007 Cerdelga
(1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol EU/3/05/314 Treatment of tuberculosis Janssen-Cilag International NV 26/08/2005 Sirturo
(1R,3R,4R,5S)-3-O-[2-O-benzoyl-3-O-(sodium(2S)-3-cyclohexyl-propanoate-2-yl)-β-D-galactopyranosyl]-4-O-(α-L-fucopyranosyl)-5-orothylamido-cyclohexane-1-carboxylic acid ethyl-2-amidyl-ethyloxy-2-acetyl-(8-amino-1,3,6-naphthalene-tris sodium sulfonate) amide EU/3/13/1184 Treatment of sickle cell disease Pfizer Europe MA EEIG 5/08/2013
(1'R,6'R)-3-(benzylamine)-6-hydroxy-3'-methyl-4-pentyl-6'-(prop-1-en-2-yl)-[1,1'-bi(cyclohexane)]-2',3,6-triene-2,5-dione EU/3/17/1933 Treatment of systemic sclerosis Emerald Health Pharmaceuticals España, S.L. 8/11/2017
(1S,3S)-3-amino-4-(difluoromethylene) cyclopentanecarboxylic acid hydrochloride EU/3/12/953 Treatment of West syndrome Catalent Pharma Solutions Limited 9/02/2012
(1S,4R,5R,7S)-3,4-dibenzyl-2-oxo-6,8-dioxa-3-azabyciclo[3.2.1]octane-7-carboxylic acid-L-lysine EU/3/14/1400 Treatment of neurotrophic keratitis Orphan Europe S.A.R.L. 16/12/2014
20-hydroxyecdysone EU/3/18/2030 Treatment of Duchenne muscular dystrophy Biophytis 27/06/2018
20-pentaerythritol poly (oxy-1,2-ethanediyl)-carboxymethyl-glycinate-7-ethyl-10-hydroxycamptothecine 10-[1,4'-bipiperidine]-1'-carboxylate EU/3/11/900 Treatment of ovarian cancer Nektar Therapeutics UK Ltd 27/09/2011
2-(1,5-dimethyl-3-phenyl-1H-pyrrol-2-yl)-N-{4-[4-(5-fluoro-pyrimidin-2-yl)piperazin-1-yl]-phenyl}-2-oxo-acetamide EU/3/16/1713 Treatment of scedosporiosis F2G Ltd 29/08/2016
2-(1,5-dimethyl-3-phenyl-1H-pyrrol-2-yl)-N-{4-[4-(5-fluoro-pyrimidin-2-yl)piperazin-1-yl]-phenyl}-2-oxo-acetamide EU/3/16/1738 Treatment of invasive aspergillosis F2G Ltd 14/10/2016
2,2'-{2-[(1R)-1-({[(2,5-dichlorobenzoyl)amino]acetyl}amino)-3-methylbutyl]-5-oxo-1,3,2-dioxaborolane-4,4-diyl}diacetic acid EU/3/11/899 Treatment of multiple myeloma Takeda Pharma A/S 27/09/2011 Ninlaro
225Ac-lintuzumab EU/3/17/1871 Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 22/05/2017
2-(2-chlorobenzylidene)hydrazinecarboximidamide acetate EU/3/15/1598 Treatment of Charcot-Marie-Tooth disease Inflectis Bioscience 14/12/2015
2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione EU/3/10/802 Treatment of idiopathic pulmonary fibrosis Genkyotex S.A. 26/11/2010
2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione EU/3/15/1559 Treatment of systemic sclerosis Genkyotex S.A. 9/10/2015
2,2-dimethylbutyric acid, sodium salt EU/3/09/617 Treatment of beta-thalassaemia intermedia and major   Isabelle Ramirez 27/02/2009
2,2-dimethylbutyric acid, sodium salt EU/3/09/621 Treatment of sickle cell disease Isabelle Ramirez 18/03/2009
2-((2-ethyl-6-(4-(2-(3-hydroxyazetidin-1-yl)-2-oxoethyl)-piperazin-1-yl)-8-methylimidazo[1,2-alpha]pyridin-3-yl)-(methyl)amino)-4-(4-fluorophenyl)-thiazole-5-carbonitrile EU/3/16/1712 Treatment of idiopathic pulmonary fibrosis Galapagos NV 29/08/2016
2-(2-methyl-5-nitro-1H-imidazol-1-yl)ethylsulfamide EU/3/14/1324 Treatment of small cell lung cancer DualTpharma B.V. 22/08/2014
2-(2-phenylvinyl)-4-[4-methylpiperazin-1-yl)]-6-(5-methyl-2H-pyrazol-3-yl-amino)-pyrimidine L(+) tartrate salt EU/3/15/1544 Treatment of hepatocellular carcinoma Dr Ulrich Granzer 10/08/2015
2-[(2S)-2-methyl-1,4-dioxa-8-azaspiro[4.5]dec-8-yl]-8-nitro-6-trifluoromethyl-4H-1,3-benzothiazin-4-one EU/3/18/2029 Treatment of tuberculosis Klinikum der Universität München 27/06/2018
2-((3-((4-((3-aminopropyl)amino)butyl)amino)propyl)amino)-N-((5S,5aS,8aR,9R)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5,5a,6,8,8a,9-hexahydrofuro[3',4':6,7]naphtho[2,3-d][1,3]dioxol-5-yl)acetamide, tetrahydrochloride EU/3/15/1517 Treatment of acute myeloid leukaemia Pierre Fabre Médicament 28/07/2015
2',3',5'-tri-O-acetyluridine EU/3/09/637 Treatment of 5-fluorouracil overdose Wellstat Therapeutics EU Limited 15/05/2009
2-[4-Methoxy-3-(2-m-tolyl-ethoxy)-benzoylamino]-indan-2-carboxylic acid EU/3/13/1108 Treatment of systemic sclerosis Sanofi-Aventis groupe 12/03/2013
26 base synthetic single-stranded fully phosphorothioated 2'-O-methyl-RNA and DNA mixmer oligonucleotide-based compound EU/3/17/1829 Treatment of Dravet syndrome Eirgen Pharma Limited 27/02/2017
2-(7-ethoxy-4-(3-fluorophenyl)-1-oxophthalazin-2(1H)-yl)-N-methyl-N-(2-methylbenzo[d]oxazol-6-yl)acetamide EU/3/15/1498 Treatment of cystic fibrosis Clinical Network Services (UK) Ltd 21/05/2015
2-Allyl-1-[6-(1-hydroxy-1-methylethyl)pyridin-2-yl]-6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-1,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin-3-one EU/3/12/989 Treatment of ovarian cancer AstraZeneca UK Limited 26/04/2012
2-chloro-N6-(3-iodobenzyl)adenosine-5'-N-methyluronamide EU/3/15/1565 Treatment of hepatocellular carcinoma PBS Regulatory Consulting Group Limited 9/10/2015
[2-Cyano-3-cyclopropyl-3-hydroxy-N-(3-methyl-4-trifluoromethylphenyl)prop-2-enamide] EU/3/12/1050 Treatment of traumatic spinal cord injury Algiax Pharmaceuticals GmbH 10/10/2012
2-ethylbutyl (2S)-2-{[(S)-{[(2R,3S,4R,5R)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-5-cyano-3,4-dihydroxytetrahydrofuran-2-yl]methoxy}(phenoxy)phosphoryl]amino}propanoate EU/3/16/1615 Treatment of Ebola virus disease Gilead Sciences Ireland UC 17/02/2016
2-hydroxy-6-((2-(1-isopropyl-1H-pyrazol-5-yl)pyridin-3-yl)methoxy)benzaldehyde EU/3/16/1769 Treatment of sickle cell disease SynteractHCR Deutschland GmbH 18/11/2016
2-hydroxymethyl-2-methoxymethyl-1-azabicyclo[2,2,2]octan-3-one EU/3/14/1386 Treatment of ovarian cancer Aprea Therapeutics AB 16/12/2014
2-hydroxyoleic acid EU/3/11/916 Treatment of glioma Lipopharma Therapeutics SL 27/10/2011
2-hydroxypropyl-β-cyclodextrin EU/3/13/1124 Treatment of Niemann-Pick disease, type C Mallinckrodt Pharmaceuticals Ireland Limited 26/04/2013
2-iminobiotin EU/3/09/701 Treatment of perinatal asphyxia Neurophyxia B.V. 28/01/2010
2-isopropyl-3H-naphtho[1,2-d]imidazole-4,5-dione EU/3/17/1947 Treatment of mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes NeuroVive Pharmaceutical AB 12/12/2017
2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol EU/3/04/195 Treatment of anaplastic thyroid cancer Diamond BioPharm Limited 14/04/2004
2-methoxymethyl-2-hydroxymethyl-1-azabicyclo[2,2,2]octan-3-one EU/3/10/742 Treatment of acute myeloid leukaemia Aprea Therapeutics AB 10/06/2010
2-methyl-1-[(4-[6-(trifluoromethyl)pyridin-2-yl]-6-{[2-(trifluoromethyl)pyridin-4-yl]amino}-1,3,5-triazin-2-yl)amino]propan-2-ol methanesulfonate EU/3/16/1640 Treatment of acute myeloid leukaemia Celgene Europe B.V. 28/04/2016
2-[N-(2-hydroxyethyl)]-N-(4-methoxybenzenesulfonyl)]amino-N-(4-chlorocinnamyl)-N-methylbenzylamine EU/3/17/1915 Treatment of Charcot-Marie-Tooth disease Repositioning SAS 16/10/2017
2'-O-(2-methoxyethyl)-modified antisense oligonucleotide targeting exon 13 in the USH2A gene EU/3/18/1973 Treatment of retinitis pigmentosa ProQR Therapeutics IV BV 22/02/2018
2'-O-(2-methoxyethyl)phosphorothioate antisense oligonucleotide targeting the growth hormone receptor EU/3/16/1671 Treatment of acromegaly IQVIA RDS Ireland Limited 27/06/2016
2'-O-methyl phosphorothioate RNA oligonucleotide, 5'-m5CUGm5CUGm5CUGm5CUGm5CUGm5CUGm5CUG-3' EU/3/15/1432 Treatment of Huntington's disease BioMarin International Limited 18/02/2015
(-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate EU/3/08/560 Treatment of moderate and severe closed traumatic brain injury KeyNeurotek Pharmaceuticals AG 5/09/2008
(2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl) amino)methyl)tetrahydrofuran-3,4-diol EU/3/13/1230 Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 16/01/2014
(2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl) amino)methyl)tetrahydrofuran-3,4-diol EU/3/13/1231 Treatment of acute lymphoblastic leukaemia Voisin Consulting S.A.R.L. 16/01/2014
(2R,3S)-2-(4-cyclopentylaminophenyl)-1-(2-fluoro-6-methylbenzoyl)piperidine-3-carboxylic acid(4-methyl-3-trifluoromethylphenyl)amide EU/3/14/1372 Treatment of microscopic polyangiitis ChemoCentryx Limited 19/11/2014
(2R,3S)-2-(4-cyclopentylaminophenyl)-1-(2-fluoro-6-methylbenzoyl)piperidine-3-carboxylic acid(4-methyl-3-trifluoromethylphenyl)amide EU/3/14/1373 Treatment of granulomatosis with polyangiitis ChemoCentryx Limited 19/11/2014
2S, 4R ketoconazole EU/3/12/1012 Treatment of Cushing’s syndrome Cortendo AB 4/07/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1028 Treatment of progressive familial intrahepatic cholestasis Albireo AB 17/07/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1040 Treatment of Alagille syndrome Albireo AB 9/08/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1041 Treatment of primary biliary cirrhosis Albireo AB 9/08/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro-1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/18/2103 Treatment of biliary atresia Albireo AB 14/12/2018
(2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide EU/3/05/315 Treatment of progressive myoclonic epilepsies UCB Pharma S.A. 26/08/2005
(2S,4R)-1-(2-(3-acetyl-5-(2-methylpyrimidine-5-yl)-1H-indazol-1-yl)acetyl)-N-(6-bromopyridine-2-yl)-4-fluoropyrrolidine-2-carboxamide EU/3/17/1946 Treatment of paroxysmal nocturnal haemoglobinuria FGK Representative Service GmbH 12/12/2017
(2S,4R)-1-(2-(3-acetyl-5-(2-methylpyrimidine-5-yl)-1H-indazol-1-yl)acetyl)-N-(6-bromopyridine-2-yl)-4-fluoropyrrolidine-2-carboxamide EU/3/18/1989 Treatment of C3 glomerulopathy FGK Representative Service GmbH 21/03/2018
2ʹ-O-(2-methoxyethyl) antisense oligonucleotide targeting microtubule-associated protein tau pre-mRNA EU/3/18/2041 Treatment of behavioural variant frontotemporal dementia Ionis USA Limited 31/07/2018
3-{[2,3,5,6-tetrafluoro-3'-(trifluoromethoxy)biphenyl-4-yl]carbamoyl}thiophene-2-carboxylic acid EU/3/15/1507 Treatment of non-infectious uveitis Panoptes Pharma Ges.m.b.H 19/06/2015
3-(3-(3,5-dimethyl-1H-pyrazol-4-yl)propoxy)-4-fluorobenzoic acid EU/3/18/2081 Treatment of ATTR amyloidosis Pharma Gateway AB 19/11/2018
3-[4-(1H-imidazol-1-ylmethyl)phenyl]-5-(2-methylpropyl)thiophene-2-[(N-butyloxylcarbamate)-sulphonamide] sodium salt EU/3/16/1692 Treatment of idiopathic pulmonary fibrosis Vicore Pharma AB 14/07/2016
3-(4'aminoisoindoline-1'-one)-1-piperidine-2,6-dione EU/3/04/192 Treatment of myelodysplastic syndromes Celgene Europe B.V. 8/03/2004 Revlimid
3,4-diaminopyridine phosphate EU/3/02/124 Treatment of Lambert-Eaton myasthenic syndrome BioMarin International Limited 18/12/2002 Firdapse
(3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid EU/3/05/278 Treatment of Duchenne muscular dystrophy PTC Therapeutics International Limited 27/05/2005 Translarna
3-(5-amino-2-methyl-4-oxoquinazolin-3(4H)-yl)piperidine-2,6-dione hydrochloride EU/3/16/1672 Treatment of diffuse large B-cell lymphoma Celgene Europe B.V. 27/06/2016
3,5-diiodothyropropionic acid EU/3/13/1193 Treatment of Allan-Herndon-Dudley syndrome CATS Consultants GmbH 7/10/2013
3-Chloro-4-fluorophenyl-[4-fluoro-4-{[(5-methylpyrimidin-2-ylmethyl) amino]methyl}piperidin-1-yl]methanone EU/3/14/1242 Treatment of Rett syndrome Neurolixis SAS 19/02/2014
3-methoxy-pregnenolone EU/3/07/511 Treatment of spinal cord injury MAPREG SAS 4/12/2007
3-pentylbenzeneacetic acid sodium salt EU/3/15/1550 Treatment of idiopathic pulmonary fibrosis ProMetic Pharma SMT Limited 9/10/2015
3-pentylbenzeneacetic acid sodium salt EU/3/16/1810 Treatment of Alström syndrome ProMetic Pharma SMT Limited 12/01/2017
(3R,3aS,9R,9aS,9bS)-3-((dimethylamino)methyl)-9-hydroxy-6,9-dimethyl-3,3a,4,5,7,8,9,9a-octahydroazuleno[4,5-b]furan-2(9bH)-one fumarate EU/3/18/2055 Treatment of glioma IQVIA RDS Ireland Limited 24/08/2018
(3'R,4'S,5'R)-N-[(3R,6S)-6-carbamoyltetrahydro-2H-pyran-3-yl]-6''-chloro-4'-(2-chloro-3-fluoropyridin-4-yl)-4,4-dimethyl-2''-oxo-1'',2''-dihydrodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indole]-5'-carboxamide mono(4-methylbenzenesulfonate) monohydrate EU/3/17/1847 Treatment of soft tissue sarcoma Daiichi Sankyo Europe GmbH 20/03/2017
(3S)-(+)-(5-chloro-2-methoxyphenyl)-1,3-dihydro-3-fluoro-6-(trifluoromethyl)-2H-indol-2-one EU/3/14/1334 Treatment of fragile X syndrome Centre National de la Recherche Scientifique (CNRS) 15/10/2014
(3S)-1-azabicyclo[2.2.2]oct-3-yl{2-[2-(4-fluorophenyl)-1,3-thiazol-4-yl]propan-2-yl}carbamate EU/3/14/1310 Treatment of Fabry disease Genzyme Europe B.V. 22/08/2014
(3S)-1-azabicyclo[2.2.2]oct-3-yl{2-[2-(4-fluorophenyl)-1,3-thiazol-4-yl]propan-2-yl}carbamate EU/3/14/1374 Treatment of Gaucher disease Genzyme Europe B.V. 19/11/2014
(3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt EU/3/10/760 Treatment of ovarian cancer TESARO Bio Netherlands B.V. 4/08/2010 Zejula
4-[123I]iodo-L-phenylalanine EU/3/06/386 Diagnosis of glioma Therapeia GmbH & Co. KG 25/07/2006
4-[131I]iodo-L-phenylalanine EU/3/06/363 Treatment of glioma Telix Pharmaceuticals Holdings Germany GmbH 11/04/2006
4-[[(1S,4S)-5-[[4-[4-(oxazol-2-yl)phenoxy]phenyl]methyl]-2,5-diazabicyclo[2.2.1]hept-2-yl]methyl]benzoic acid EU/3/14/1363 Treatment of cystic fibrosis IQVIA RDS Ireland Limited 19/11/2014
4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate EU/3/13/1109 Treatment of hepatocellular carcinoma Eli Lilly Nederland B.V. 13/03/2013
4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate EU/3/13/1120 Treatment of glioma Eli Lilly Nederland B.V. 26/04/2013
4’-[(2-butyl-4-oxo-1,3-diazaspiro[4.4]non-1-en-3-yl)methyl]-N-(4,5-dimethyl-3-isoxazolyl)-2’-(ethoxymethyl)-[1,1’-biphenyl]-2-sulfonamide EU/3/15/1574 Treatment of focal segmental glomerulosclerosis Retrophin Europe Limited 11/11/2015
4-{[(2R,3S,4R,5S)-4-(4-chloro-2-fluoro-phenyl)-3-(3-chloro-2-fluoro-phenyl)-4-cyano-5-(2,2-dimethyl-propyl)-pyrrolidine-2-carbonyl]-amino}-3-methoxy-benzoic acid EU/3/14/1328 Treatment of acute myeloid leukaemia Roche Registration GmbH 22/08/2014
(4-{(2S,4S)-4-ethoxy-1-[(5-methoxy-7-methyl-1H-indol-4-yl)methyl]piperidin-2-yl}benzoic acid-hydrogen chloride(1/1)) EU/3/18/2104 Treatment of C3 glomerulopathy Novartis Europharm Limited 14/12/2018
4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HCl EU/3/05/288 Treatment of Huntington's disease Teva GmbH 20/06/2005
4-(4-Methoxy-phenylamino)-6-methylcarbamyl-quinoline-3-carboxylic acid EU/3/14/1279 Prevention of scarring post glaucoma filtration surgery Clanotech AB 4/06/2014
4,6,4’–trimethylangelicin EU/3/13/1137 Treatment of cystic fibrosis Rare Partners srl Impresa Sociale 19/06/2013
4,7,10,13,16,19-docosahexaenoic acid EU/3/06/412 Treatment of retinitis pigmentosa Natac Pharma S.L. 3/11/2006
4-amino-1-[(1S,4R,5S)-2-fluoro-4,5-dihydroxy-3-(hydroxymethyl)cyclopent-2-en-1-yl]pyrimidin-2-one EU/3/17/1937 Treatment of pancreatic cancer IQVIA RDS Ireland Limited 8/11/2017
4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-β-D-arabinofuranosyl]-2(1H)-pyrimidinone EU/3/07/477 Treatment of hepatocellular carcinoma Interface International Consultancy Limited 14/09/2007
4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline EU/3/06/356 Treatment of renal cell carcinoma Prodimed S.A. 16/02/2006
4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride EU/3/06/390 Treatment of moderate and severe traumatic brain injury vasopharm GmbH 28/08/2006
[4-aminobutanoic acid-glycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-L-aspartyl](cyclo 1-Dgamma17) EU/3/15/1592 Treatment of pseudohypoaldosteronism type 1B Apeptico Forschung und Entwicklung GmbH 14/12/2015
4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol EU/3/07/487 Treatment of chronic lymphocytic leukaemia BlackSwan Pharma GmbH 14/11/2007
4-hydroxy-2,2,6,6-tetramethylpiperidine-N-oxyl EU/3/17/1948 Treatment of familial cerebral cavernous malformations Premier Research Group Limited 12/12/2017
4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one EU/3/05/299 Treatment of pancreatic cancer ICON Clinical Research (U.K.) Limited 27/07/2005
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1214 Treatment of Alagille syndrome Shire Pharmaceuticals Ireland Limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1215 Treatment of primary biliary cirrhosis Shire Pharmaceuticals Ireland Limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1216 Treatment of progressive familial intrahepatic cholestasis Shire Pharmaceuticals Ireland Limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1217 Treatment of primary sclerosing cholangitis Shire Pharmaceuticals Ireland Limited 18/12/2013
505 amino acid protein, corresponding to amino acids 2-506 of the wild type human histidyl-tRNA synthetase EU/3/15/1448 Treatment of facioscapulohumeral muscular dystrophy Voisin Consulting S.A.R.L. 12/02/2015
505 amino acid protein, corresponding to amino acids 2-506 of the wild-type human histidyl-tRNA synthetase EU/3/17/1831 Treatment of limb-girdle muscular dystrophy Voisin Consulting S.A.R.L. 27/02/2017
5,10,15,20-tetrakis(2,6-difluoro-3-N-methylsulfamoylphenyl)bacteriochlorin EU/3/15/1470 Treatment of biliary tract cancer Luzitin S.A 19/03/2015
[5,10,15,20-tetrakis(4-carboxyphenyl)-21H,23H-porphine]manganese(III) chloride EU/3/16/1809 Treatment of Cockayne syndrome Institut Pasteur 12/01/2017
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride EU/3/11/892 Treatment of 5q spinal muscular atrophy Repligen Europe Limited 30/08/2011
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride EU/3/13/1136 Treatment of 5q spinal muscular atrophy Sirius Regulatory Consulting Limited 7/06/2013
5-{(1R,2R)-2-[(cyclopropylmethyl)amino]cyclopropyl}-N-(tetrahydro-2H-pyran-4-yl)thiophene-3-carboxamide monohydrochloride EU/3/18/2082 Treatment of Kabuki syndrome Takeda Pharma A/S 19/11/2018
5-[4-[2-(5-(1-hydroxyethyl)-2-pyridinyl)ethoxy]benzyl]-2,4-thiazolidinedione hydrochloride EU/3/16/1770 Treatment of adrenoleukodystrophy Minoryx Therapeutics S.L. 18/11/2016
5-(4,6-dimorpholino-1,3,5-triazin-2-yl)-4-(trifluoromethyl)pyridin-2-amine EU/3/17/1830 Treatment of diffuse large B-cell lymphoma Voisin Consulting S.A.R.L. 27/02/2017
5,5'-(4-(trifluromethyl)benzylazanediyl)bis(methylene)diquinolin-8-ol EU/3/14/1408 Treatment of glioma Prof. Olivier Blin 16/12/2014
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine hydrochloride EU/3/15/1457 Treatment of tenosynovial giant cell tumour, localised and diffuse type Daiichi Sankyo Europe GmbH 19/03/2015
5,6,7,8-Tetrahydrobiopterin EU/3/03/163 Treatment of hyperphenylalaninemia Orphanetics Pharma Entwicklungs GmbH 2/10/2003
5,7-dichloro-2-dimethylaminomethyl-8-hydroxyquinoline hydrochloride EU/3/15/1497 Treatment of Huntington’s disease Prana Biotechnology UK Limited 21/05/2015
5'-ASCSASTSCSASGSTSCSTSGSASUSASASGSCSTSA-3' EU/3/15/1451 Treatment of Alport syndrome CTI Clinical Trial and Consulting Services Europe GmbH 19/03/2015
5-amino-1-(2-methyl-1H-benzo[d]imidazol-5-yl)-1H-pyrazol-4-yl 1H-indol-2-yl ketone mono[(S)-2-hydroxysuccinate] EU/3/17/1916 Treatment of biliary tract cancer Voisin Consulting S.A.R.L. 16/10/2017
[5-amino-1-(4-fluoro-phenyl)-1H-pyrazol-4-yl]-[3-(2,3-dihydroxy-propoxy)-phenyl]-methanone EU/3/14/1323 Treatment of pancreatic cancer Synovo GmbH 22/08/2014
5-aminolevulinic acid EU/3/16/1811 Treatment of glioma Centre Hospitalier Universitaire de Lille 12/01/2017
5-bromo-N-(prop-2-yn-1-yl)-2-(1H-1,2,4-triazol-1-yl)pyrimidine-4,6-diamine EU/3/14/1392 Treatment of Huntington’s disease Palobiofarma S.L. 16/12/2014
5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole EU/3/08/591 Treatment of Duchenne muscular dystrophy Summit (Oxford) Limited 4/12/2008
5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt EU/3/03/182 Treatment of aneurysmal subarachnoid haemorrhage Idorsia Pharmaceuticals Deutschland GmbH 12/12/2003
5'-O-(trans-9'-octadecenoyl)-1-β-D-arabinofuranosyl cytosine EU/3/07/476 Treatment of acute myleoid leukaemia Aqualis ASA 14/09/2007
(5R,5aR,8aR,9S)-9-[[4,6-O-[(R)-Ethylidene]-beta-D-glucopyranosyl]-oxy]-5-(4-({[(2,2-dimethyl-1,3-dioxolan-4-yl)methoxy]carbonyl}oxy)-3,5-dimethoxyphenyl)-5,8,8a,9-tetrahydroisobenzofuro[5,6-f][1,3]benzodioxol-6(5aH)-one EU/3/14/1270 Treatment of biliary tract cancer Mundipharma Corporation Limited 4/06/2014
(5S,8S,10aR)-N-benzhydryl-5-((S)-2-(methylamino)propanamido)-3-(3-methylbutanoyl)-6-oxodecahydropyrrolo[1,2-a][1,5]diazocine-8-carboxamide EU/3/15/1576 Treatment of ovarian cancer ASPHALION, SL 11/11/2015
6-{[(1R,2S)-2-aminocyclohexyl]amino}-7-fluoro-4-(1-methyl-1H-pyrazol-4-yl)-1,2-dihydro-3H-pyrrolo[3,4-c]pyridin-3-one monocitrate EU/3/18/1974 Treatment of acute myeloid leukaemia Takeda Pharma A/S 22/02/2018
6-(2-hydroxy-2-methylpropoxy)-4-(6-(6-((6-methoxypyridin-3-yl)methyl)-3,6-diazabicyclo[3.1.1]heptan-3-yl)pyridin-3-yl)pyrazolo[1,5-a]pyridine-3-carbonitrile EU/3/18/2071 Treatment of medullary thyroid carcinoma Loxo Oncology Limited 26/10/2018
6,8-bis(benzylthio)octanoic acid EU/3/18/2105 Treatment of pancreatic cancer IQVIA RDS Ireland Limited 14/12/2018
6,8-bis(benzylthio)octanoic acid EU/3/18/2123 Treatment of acute myeloid leukaemia IQVIA RDS Ireland Limited 14/12/2018
68Ga-2,2'-(7-(4-((S)-1-((4S,7S,10S,13R,16S,19R)-4-((R)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-ylcarbamoyl)-10-(4-aminobutyl)-16-(4-((S)-2,6-dioxohexahydropyrimidine-4-carboxamido)benzyl)-7-((R)-1-hydroxyethyl)-6,9,12,15,18-pentaoxo-13-(4-ureidobenzyl)-1,2-dithia-5,8,11,14,17-pentaazacycloicosan-19-ylamino)-3-(4-chlorophenyl)-1-oxopropan-2-ylamino)-1-carboxy-4-oxobutyl)-1,4,7-triazonane-1,4-diyl)diacetic acid EU/3/14/1246 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Ipsen Pharma 19/02/2014
68Ga-DOTA-pABzA-DIG-dPhe-Gln-Trp-Ala-Val-Gly-His-NHCH[(CH2-CH(CH3)2]2 EU/3/16/1794 Diagnosis of gastrointestinal stromal tumours Advanced Accelerator Applications 12/12/2016
6alpha-ethyl-chenodeoxycholic acid EU/3/10/753 Treatment of primary biliary cirrhosis Intercept Pharma Ltd 27/07/2010 OCALIVA
(6aR, 10aR)-3-(1',1'-dimethylheptyl)-delta-8-tetrahydro-cannabinol-9-carboxylic acid EU/3/16/1808 Treatment of systemic sclerosis TMC Pharma Services Ltd 12/01/2017
(6aR,10aR)-3-(1',1'-dimethylheptyl)-delta-8-tetrahydrocannabinol-9-carboxylic acid EU/3/16/1736 Treatment of cystic fibrosis TMC Pharma Services Ltd 14/10/2016
(6aR,10aR)-3-(1,1-dimethylheptyl)-delta8-tetrahydro-cannabinol-9-carboxylic acid EU/3/18/2070 Treatment of dermatomyositis Accelsiors CRO and Consultancy Services Ltd 26/10/2018
(6aS)-1,10-dimethoxy-6-methyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinoline-2,9-diol EU/3/13/1226 Treatment of dystrophic myotonia Valentia BioPharma S.L 16/01/2014
6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide EU/3/09/681 Treatment of Huntington's disease AOP Orphan Pharmaceuticals AG 28/10/2009
6-ethoxy-7-methoxy-2-(2-methylsulfanylphenyl)-3,1-benzoxazin-4-one EU/3/15/1454 Treatment of Netherton syndrome Sixera Pharma AB 19/03/2015
6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2(3H)-one EU/3/12/970 Treatment of amyotrophic lateral sclerosis Pharma Gateway AB 5/03/2012
6-fluoro-9-methyl-9H-pyrido[3,4-b]-indole EU/3/18/2106 Treatment of sudden sensorineural hearing loss AudioCure Pharma GmbH 14/12/2018
(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride monohydrate EU/3/09/616 Treatment of amyotrophic lateral sclerosis Knopp Neurosciences Sub Ltd 27/02/2009
6'-(R)-methyl-5-O-(5-amino-5,6-dideoxy-alpha-L-talofuranosyl)-paromamine sulfate EU/3/18/2072 Treatment of cystic fibrosis FGK Representative Service GmbH 26/10/2018
6'-(R)-methyl-5-O-(5-amino-5,6-dideoxy-α-L-talofuranosyl)-paromamine sulfate EU/3/16/1714 Treatment of mucopolysaccharidosis type I IQVIA RDS Ireland Limited 29/08/2016
6-thioguanine (oral liquid) EU/3/09/694 Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 26/11/2009
7-beta-hydroxycholesteryl-3-beta-oleate EU/3/10/816 Treatment of glioma Intsel Chimos SA 17/12/2010
9-cis-Retinyl acetate EU/3/11/861 Treatment of Leber's congenital amaurosis QLT Ophthalmics (UK), Ltd 13/05/2011
9-cis-Retinyl acetate EU/3/11/865 Treatment of retinitis pigmentosa QLT Ophthalmics (UK), Ltd 13/05/2011
A combination of H-Lys-Lys-Gly-Pro-Arg-Cys(SH)-Leu-Thr-Arg-Tyr-Tyr-Ser-Ser-Phe-Val-Asn-Met-Glu-Gly-Lys-Lys-OH and H-Lys-Lys-Gly-Asp-Asn-Ile-Met-Val-Thr-Phe-Arg-Asn-Gln-Ala-Ser-Arg-Pro-Tyr-Gly-Lys-Lys-OH EU/3/14/1360 Treatment of haemophilia A Apitope International NV 19/11/2014
A highly purified formulation of Staphylococcus aureus protein A EU/3/15/1562 Treatment of immune thrombocytopenia IQVIA RDS Ireland Limited 9/10/2015
A lentiviral vector pseudotyped by the Indiana serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins EU/3/14/1417 Treatment of adult T-cell leukaemia/lymphoma THERAVECTYS 15/01/2015
A lentiviral vector pseudotyped by the New-Jersey serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins EU/3/14/1418 Treatment of adult T-cell leukaemia/lymphoma THERAVECTYS 15/01/2015
A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein EU/3/05/317 Treatment of graft-versus-host disease Xenikos B.V. 26/08/2005
A non-covalent trimer of tumour necrosis factor fused to an antibody specific to the extra-domain B of fibronectin in single-chain variable fragment format EU/3/16/1739 Treatment of soft tissue sarcoma Philogen S.p.A. 14/10/2016
AASSGVSTPGSAGHDIITEQPRS EU/3/15/1492 Treatment of Huntington’s disease Centre National de la Recherche Scientifique (CNRS) 21/05/2015
Acadesine EU/3/05/280 Treatment of B-cell chronic lymphocytic leukemia (B-CLL) Advancell - Advanced In Vitro Cell Technologies S.A. 27/05/2005
Acadesine EU/3/11/881 Treatment of multiple myeloma Advancell - Advanced In Vitro Cell Technologies S.A. 5/08/2011
Acalabrutinib EU/3/16/1624 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Acerta Pharma, BV 21/03/2016
Acalabrutinib EU/3/16/1625 Treatment of mantle cell lymphoma Acerta Pharma, BV 21/03/2016
Acalabrutinib EU/3/16/1626 Treatment of lymphoplasmacytic lymphoma Acerta Pharma, BV 21/03/2016
Acamprosate calcium EU/3/14/1337 Treatment of fragile X syndrome 1st Regulatory Ltd 15/10/2014
Acebutolol hydrochloride EU/3/16/1742 Treatment of Smith-Magenis syndrome Therapicon Srl 14/10/2016
Acetylcysteine EU/3/18/2107 Treatment of pseudomyxoma peritonei MUCPharm Pty Ltd 14/12/2018
Acetylleucine EU/3/17/1848 Treatment of Niemann-Pick disease IntraBio Ltd 20/03/2017
Acetylleucine EU/3/17/1949 Treatment of GM2 gangliosidosis IntraBio Ltd 12/12/2017
Acetylleucine EU/3/18/2059 Treatment of spinocerebellar ataxia IntraBio Ltd 24/08/2018
Acetylleucine EU/3/18/2124 Treatment of ataxia telangiectasia IntraBio Ltd 11/01/2019
Acetylsalicylic acid EU/3/04/208 Treatment of polycythemia vera Bayer HealthCare AG 29/07/2004
Adeno-associated viral vector containing a modified U7-snRNA gene EU/3/05/297 Treatment of Duchenne muscular dystrophy Généthon 27/07/2005
Adeno-associated viral vector containing modified U1 snRNA EU/3/09/663 Treatment of Duchenne muscular dystrophy uniQure Biopharma B.V. 8/10/2009
Adeno-associated viral vector containing porphobilinogen deaminase gene EU/3/09/632 Treatment of acute intermittent porphyria uniQure Biopharma B.V. 29/04/2009
Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene EU/3/11/917 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Institut Pasteur 27/10/2011
Adeno-associated viral vector containing the human ARSB gene EU/3/11/864 Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Fondazione Telethon 13/05/2011
Adeno-associated viral vector containing the human factor IX gene EU/3/11/938 Treatment of haemophilia B uniQure Biopharma B.V. 11/01/2012
Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene EU/3/11/860 Treatment of Leber's hereditary optic neuropathy GenSight- Biologics 13/05/2011
Adeno-associated viral vector expressing human 21-hydroxylase EU/3/18/2108 Treatment of congenital adrenal hyperplasia Pharma Gateway AB 14/12/2018
Adeno-associated viral vector expressing lipoprotein lipase EU/3/04/194 Treatment of lipoprotein lipase deficiency uniQure Biopharma B.V. 8/03/2004 Glybera
Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene EU/3/12/974 Treatment of primary hyperoxaluria type 1 uniQure Biopharma B.V. 21/03/2012
Adeno-associated viral vector serotype 2/2 containing a gene encoding the channelrhodopsin-2 protein EU/3/16/1740 Treatment of retinitis pigmentosa Allergan Pharmaceuticals International Limited 14/10/2016
Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human alpha L-iduronidase gene EU/3/17/1955 Treatment of mucopolysaccharidosis type I Sangamo Therapeutics UK LTD 17/01/2018
Adeno-associated viral vector serotype 2/6 encoding zinc-finger nucleases and the human iduronate 2-sulfatase gene EU/3/17/1956 Treatment of mucopolysaccharidosis type II (Hunter’s syndrome) Sangamo Therapeutics UK LTD 17/01/2018
Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1 EU/3/14/1278 Treatment of choroideremia Spark Therapeutics Ireland Ltd 4/06/2014
Adeno-associated viral vector serotype 2 containing the human REP1 gene EU/3/14/1290 Treatment of choroideremia NightstaRx Ltd. 4/07/2014
Adeno-associated viral vector serotype 2.7m8 containing the ChrimsonR-tdTomato gene EU/3/16/1693 Treatment of retinitis pigmentosa GenSight- Biologics 14/07/2016
Adeno-associated viral vector serotype 5 containing a B-domain deleted variant of human coagulation factor VIII gene EU/3/16/1622 Treatment of haemophilia A BioMarin International Limited 21/03/2016
Adeno-associated viral vector serotype 5 containing the human CHM gene EU/3/15/1482 Treatment of choroideremia Inserm-Transfert SA 24/04/2015
Adeno-associated viral vector serotype 5 containing the human RLBP1 gene EU/3/16/1741 Treatment of retinitis pigmentosa HORAMA SA 14/10/2016
Adeno-associated viral vector serotype 5 encoding a microRNA targeted to human huntingtin gene EU/3/17/1957 Treatment of Huntington's disease uniQure Biopharma B.V. 17/01/2018
Adeno-associated viral vector serotype 8 containing a functional copy of the codon-optimised F8 cDNA encoding the B-domain deleted human coagulation factor VIII EU/3/18/2015 Treatment of haemophilia A Baxalta Innovations GmbH 25/05/2018
Adeno-associated viral vector serotype 8 containing the human acid alpha-glucosidase gene EU/3/18/2007 Treatment of glycogen storage disease type II (Pompe's disease) Dr Philippe Moullier 16/04/2018
Adeno-associated viral vector serotype 8 containing the human alpha-galactosidase A gene EU/3/17/1849 Treatment of Fabry disease Freeline Therapeutics Ltd 20/03/2017
Adeno-associated viral vector serotype 8 containing the human CNGA3 gene under the control of a cone arrestin promoter EU/3/16/1795 Treatment of achromatopsia caused by mutations in the CNGA3 gene Universitätsklinikum Tübingen (UKT) 12/12/2016
Adeno-associated viral vector serotype 8 containing the human factor VII gene EU/3/14/1430 Treatment of congenital factor VII deficiency Professor Edward G. Tuddenham 15/01/2015
Adeno-associated viral vector serotype 8 containing the human glucose-6-phosphatase gene EU/3/16/1771 Treatment of glycogen storage disease type Ia Pharma Gateway AB 18/11/2016
Adeno-associated viral vector serotype 8 containing the human GUCY2D gene EU/3/14/1256 Treatment of Leber's congenital amaurosis Fondazione Telethon 26/03/2014
Adeno-associated viral vector serotype 8 containing the human MD1 gene EU/3/14/1381 Treatment of Duchenne muscular dystrophy Généthon 19/11/2014
Adeno-associated viral vector serotype 8 containing the human MTM1 gene EU/3/15/1539 Treatment of X-linked myotubular myopathy Audentes Therapeutics UK Limited 10/08/2015
Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene EU/3/14/1321 Treatment of Crigler-Najjar syndrome Fondazione Telethon 22/08/2014
Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene EU/3/14/1338 Treatment of Crigler-Najjar syndrome Généthon 15/10/2014
Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene EU/3/16/1772 Treatment of Crigler-Najjar syndrome Audentes Therapeutics UK Limited 18/11/2016
Adeno-associated viral vector serotype 8 encoding engineered rhodopsin DNA-binding repressor and human rhodopsin expression cassettes EU/3/16/1796 Treatment of retinitis pigmentosa Fondazione Telethon 12/12/2016
Adeno-associated viral vector serotype 8 encoding human ornithine transcarbamylase EU/3/16/1623 Treatment of ornithine transcarbamylase deficiency Pharma Gateway AB 21/03/2016
Adeno-associated viral vector serotype 8 encoding the human ATP7B gene under the control of the human alpha-1 antitrypsin promoter EU/3/15/1573 Treatment of Wilson's disease Aligen Therapeutics S.L. 11/11/2015
Adeno-associated viral vector serotype 9 containing the human cardiac calsequestrin gene EU/3/14/1296 Treatment of catecholaminergic polymorphic ventricular tachycardia Audentes Therapeutics UK Limited 29/07/2014
Adeno-associated viral vector serotype 9 containing the human CLN1 gene EU/3/18/2016 Treatment of neuronal ceroid lipofuscinosis Abeona Therapeutics Europe SL 25/05/2018
Adeno-associated viral vector serotype 9 containing the human HGSNAT gene EU/3/15/1491 Treatment of mucopolysaccharidosis IIIC (Sanfilippo C syndrome) Cochamo Systems Ltd 21/05/2015
Adeno-associated viral vector serotype 9 containing the human iduronate-2-sulfatase gene EU/3/15/1540 Treatment of mucopolysaccharidosis type II (Hunter's syndrome) Esteve Pharmaceuticals, S.A. 10/08/2015
Adeno-associated viral vector serotype 9 containing the human mini-dystrophin gene EU/3/16/1716 Treatment of Duchenne muscular dystrophy Pfizer Europe MA EEIG 29/08/2016
Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene EU/3/12/1095 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Esteve Pharmaceuticals, S.A. 24/01/2013
Adeno-associated viral vector serotype 9 containing the human SMN gene EU/3/15/1509 Treatment of spinal muscular atrophy Avexis Netherlands B.V. 19/06/2015
Adeno-associated viral vector serotype 9 containing the human sulfamidase gene EU/3/11/877 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Esteve Pharmaceuticals, S.A. 21/06/2011
Adeno-associated viral vector serotype 9 encoding miRNA against human superoxide dismutase 1 EU/3/18/2008 Treatment of amyotrophic lateral sclerosis Stolmár & Partner Patentanwälte PartG mbB 16/04/2018
Adeno-associated viral vector serotype Anc80 containing the truncated human ATP7B gene under the control of the human alpha-1 antitrypsin promoter EU/3/17/1898 Treatment of Wilson's disease Vivet Therapeutics SAS 23/08/2017
Adeno-associated viral vector serotype hu68 containing the human SMN1 gene EU/3/18/2060 Treatment of spinal muscular atrophy Biogen Idec Limited 24/08/2018
Adeno-associated viral vector serotype LK03 encoding human ornithine transcarbamylase EU/3/17/1850 Treatment of ornithine transcarbamylase deficiency Dr Julien Baruteau 20/03/2017
Adeno-associated viral vector serotype rh.10 carrying the human N-sulfoglucosamine sulfohydrolase cDNA EU/3/14/1389 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) LYSOGENE 16/12/2014
Adeno-associated viral vector serotype rh10 containing the human factor IX gene EU/3/15/1599 Treatment of haemophilia B Pharma Gateway AB 14/12/2015
Adeno-associated viral vector serotype rh.10 expressing beta-galactosidase EU/3/17/1851 Treatment of GM1 gangliosidosis LYSOGENE 20/03/2017
Adeno-associated virus serotype HSC15 expressing human phenylalanine hydroxylase EU/3/18/2109 Treatment of phenylalanine hydroxylase deficiency Yes Pharmaceutical Development Services GmbH 14/12/2018
Adenoviral vector containing human p53 gene EU/3/06/404 Treatment of Li Fraumeni Syndrome Gendux Molecular Limited 23/10/2006
Adenoviral vector of serotype 5 modified to contain a chimeric sequence consisting of a minimal urokinase-type plasminogen activator receptor promoter preceded by three Notch-responsive elements, and coated with oligopeptide end-modified poly (beta-amino) esters EU/3/17/1917 Treatment of pancreatic cancer Sagetis Biotech, S.L. 16/10/2017
Adenoviral vector serotype 5 containing the vascular endothelial growth factor D isoform (preprocessed short form) from a CMV promoter EU/3/14/1415 Treatment of placental insufficiency Magnus Invention Management Ltd 15/01/2015
Adenovirus associated viral vector serotype 2/8 containing the human CNGA3 gene EU/3/18/2042 Treatment of achromatopsia MeiraGTx UK II Limited 31/07/2018
Adenovirus associated viral vector serotype 2 containing the human RPE65 gene EU/3/12/981 Treatment of inherited retinal dystrophies (initially named treatment of Leber’s congenital amaurosis) Spark Therapeutics Ireland Limited 2/04/2012 Luxturna
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/484 Treatment of Leber's congenital amaurosis HORAMA SA 22/10/2007
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/486 Treatment of retinitis pigmentosa HORAMA SA 14/11/2007
Adenovirus associated viral vector serotype 5 containing the human pde6β gene EU/3/13/1142 Treatment of retinitis pigmentosa HORAMA SA 19/06/2013
Adenovirus associated viral vector serotype 5 containing the human RPE65 gene EU/3/15/1577 Treatment of Leber’s congenital amaurosis MeiraGTx UK II Limited 11/11/2015
Adenovirus associated viral vector serotype 5 containing the human RPGR gene EU/3/16/1715 Treatment of retinitis pigmentosa MeiraGTx UK II Limited 29/08/2016
Adenovirus associated viral vector serotype 8 containing the human AIPL1 gene EU/3/17/1950 Treatment of Leber’s congenital amaurosis MeiraGTx UK II Limited 12/12/2017
Adenovirus associated viral vector serotype 8 containing the human CNGB3 gene EU/3/15/1578 Treatment of achromatopsia caused by mutations in the CNGB3 MeiraGTx UK II Limited 11/11/2015
Adenovirus serotype 5 containing partial E1A deletion and an integrin-binding domain EU/3/14/1396 Treatment of glioma Alan Boyd Consultants Ltd 16/12/2014
Adenovirus-associated vector containing human Fas-c gene EU/3/12/1002 Treatment of glioma Envigo Pharma Consulting Ltd 6/06/2012
Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs EU/3/10/772 Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) LYSOGENE 20/09/2010
Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene EU/3/15/1518 Treatment of inherited retinal dystrophies (initially named treatment of retinitis pigmentosa) Spark Therapeutics Ireland Limited 28/07/2015 Luxturna
Adenovirus-associated viral vector serotype 8 containing the human RPGR gene EU/3/18/1975 Treatment of retinitis pigmentosa Nightstar Therapeutics plc 22/02/2018
Adenovirus-mediated Herpes simplex Virus-thymidine kinase gene EU/3/01/083 Treatment of high-grade glioma with subsequent use of ganciclovir sodium Gliotherapy Limited 6/02/2002
Adenovirus-specific T-cells derived from allogeneic donor leukocytes, expanded ex vivo EU/3/13/1227 Treatment of adenovirus infection in allogeneic haematopoietic stem-cell transplant recipients Cell Medica Ltd 16/01/2014
Adrenomedullin EU/3/10/744 Treatment of acute lung injury mondoBIOTECH Laboratories AG 9/06/2010
Adult human bone-marrow-derived, ex-vivo-expanded, pooled allogeneic mesenchymal stromal cells EU/3/15/1499 Treatment of thromboangiitis obliterans (Buerger's disease) Regulatory Resources Group Ltd 21/05/2015
Afamelanotide EU/3/09/648 Treatment of solar urticaria Clinuvel UK Limited 24/07/2009
Afamelanotide EU/3/14/1285 Treatment of familial benign chronic pemphigus (Hailey-Hailey disease) Clinuvel UK Limited 4/07/2014
Afatinib EU/3/18/2110 Treatment of Fanconi anaemia Consorcio Centro de Investigación Biomédica en Red M.P. 14/12/2018
Agammaglobulinaemia tyrosine kinase EU/3/17/1951 Treatment of pemphigus Clinical Network Services (UK) Ltd 12/12/2017
Aganirsen EU/3/14/1275 Treatment of central retinal vein occlusion Gene Signal SAS 10/06/2014
Alginate oligosaccharide (G-block) fragment EU/3/07/475 Treatment of cystic fibrosis AlgiPharma AS 14/09/2007
Alicaforsen EU/3/09/641 Treatment of pouchitis Atlantic Pharmaceuticals (Holdings) Ltd 15/05/2009
Allantoin EU/3/13/1232 Treatment of epidermolysis bullosa Amicus Therapeutics UK Ltd 16/01/2014
Allogeneic ABCB5-positive limbal stem cells EU/3/18/2111 Treatment of limbal stem cell deficiency Rheacell GmbH & Co. KG 14/12/2018
Allogeneic adipose-derived adult mesenchymal stem cells contained in a fibrin-based bioengineered dermis EU/3/14/1407 Treatment of epidermolysis bullosa Biodan Yelah S.L. 16/12/2014
Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma EU/3/13/1211 Treatment of glioma ERC Belgium 18/12/2013
Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media EU/3/13/1129 Treatment of graft-versus-host disease Cell2B Advanced Therapeutics, SA 7/06/2013
Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media EU/3/14/1388 Prevention of graft-versus-host disease Cell2B Advanced Therapeutics, SA 16/12/2014
Allogeneic bone marrow derived mesenchymal stromal cells, ex-vivo expanded EU/3/18/2044 Treatment of graft-versus-host disease medac Gesellschaft für klinische Spezialpräparate mbH 31/07/2018
Allogeneic bone-marrow derived ex-vivo expanded multipotent adult progenitor cells EU/3/13/1233 Prevention of graft-versus-host disease ReGenesys BVBA 16/01/2014
Allogeneic CD34+ cells expanded ex vivo with an aryl hydrocarbon receptor antagonist EU/3/14/1382 Treatment of acute lymphoblastic leukaemia Novartis Europharm Limited 16/12/2014
Allogeneic CD4+ and CD25+ T lymphocytes ex vivo incubated with GP120 EU/3/18/1976 Treatment in haematopoietic stem cell transplantation Universitätsmedizin der Johannes Gutenberg-Universität Mainz 22/02/2018
Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus EU/3/15/1438 Treatment of adenovirus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 19/03/2015
Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus EU/3/15/1439 Treatment of cytomegalovirus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 12/02/2015
Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus EU/3/15/1440 Treatment of Epstein-Barr virus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 19/03/2015
Allogeneic cytomegalovirus-specific cytotoxic T lymphocytes EU/3/16/1773 Treatment of cytomegalovirus infection in patients with impaired cell-mediated immunity Atara Biotherapeutics Ireland Limited 18/11/2016
Allogeneic donor-derived ex-vivo expanded T lymphocytes transduced with a retroviral vector containing inducible caspase 9 and truncated CD19 EU/3/16/1674 Treatment in haematopoietic stem cell transplantation Bellicum Pharma Limited 27/06/2016
Allogeneic Epstein-Barr virus specific cytotoxic T lymphocytes EU/3/16/1627 Treatment of post-transplant lymphoproliferative disorder Atara Biotherapeutics Ireland Limited 21/03/2016
Allogeneic ex vivo-generated natural killer cells from CD34+ umbilical cord blood progenitor cells EU/3/14/1395 Treatment of acute myeloid leukaemia IPD-Therapeutics BV 16/12/2014
Allogeneic ex-vivo-expanded human umbilical cord blood-derived mesenchymal stem cells EU/3/15/1503 Prevention of bronchopulmonary dysplasia PSR Group B.V. 19/06/2015
Allogeneic ex-vivo-expanded umbilical cord blood-derived hematopoietic CD34+ progenitor cells and allogeneic non-expanded umbilical cord blood-derived hematopoietic mature myeloid and lymphoid cells EU/3/17/1852 Treatment in haematopoietic stem cell transplantation Voisin Consulting S.A.R.L. 20/03/2017
Allogeneic faecal microbiota, pooled EU/3/18/2083 Treatment of graft-versus-host disease MaaT PHARMA 19/11/2018
Allogeneic fetal human retinal progenitor cells expanded ex vivo EU/3/16/1620 Treatment of retinitis pigmentosa Voisin Consulting S.A.R.L. 17/02/2016
Allogeneic human adult stem cells, isolated from skeletal muscle and expanded ex vivo EU/3/15/1519 Treatment of Duchenne muscular dystrophy Karl Rouger 28/07/2015
Allogeneic human dendritic cells derived from a CD34+ progenitor cell line EU/3/12/969 Treatment of acute myeloid leukaemia DCPrime BV 22/05/2012
Allogeneic human dermal fibroblasts EU/3/10/774 Treatment of epidermolysis bullosa Intercytex Ltd 20/09/2010
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells EU/3/12/1088 Treatment of 5q spinal muscular atrophy California Stem Cell (UK) Ltd 24/01/2013
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells EU/3/13/1155 Treatment of amyotrophic lateral sclerosis California Stem Cell (UK) Ltd 17/07/2013
Allogeneic peripheral blood mononuclear cells incubated ex vivo with 16, 16-dimethyl prostaglandin E2 and dexamethasone EU/3/16/1774 Treatment in haematopoietic stem cell transplantation Fate Therapeutics Ltd 18/11/2016
Allogeneic peripheral blood mononuclear cells induced to an early apoptotic state EU/3/14/1426 Prevention of graft-versus-host disease Richardson Associates Regulatory Affairs Ltd 15/01/2015
Allogeneic T cells encoding an exogenous TK gene EU/3/10/773 Treatment of acute myeloid leukaemia LTKFarma 20/09/2010
Allogeneic T cells encoding an exogenous TK gene EU/3/11/878 Treatment of acute lymphoblastic leukaemia LTKFarma 21/06/2011
Allogeneic umbilical cord blood CD34+ cells cultured ex vivo with Notch ligand Delta1 EU/3/17/1958 Treatment in haematopoietic stem cell transplantation Voisin Consulting S.A.R.L. 17/01/2018
Allopurinol sodium EU/3/12/1076 Treatment of perinatal asphyxia Pharmathen S.A. 6/12/2012
Allopurinol sodium EU/3/15/1493 Treatment of perinatal asphyxia ACE Pharmaceuticals BV 21/05/2015
Alpha-1 antitrypsin (inhalation use) EU/3/04/243 Treatment of cystic fibrosis Triskel EU Services Ltd 16/11/2004
Alpha-1 antitrypsin (inhalation use) EU/3/04/244 Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Kamada BioPharma Limited 16/11/2004
Alpha-1 proteinase inhibitor (for inhalation use) EU/3/12/1045 Treatment of cystic fibrosis Grifols Deutschland GmbH 10/10/2012
Alpha-1 proteinase inhibitor (inhalation use) EU/3/07/474 Treatment of cystic fibrosis CSL Behring GmbH 14/09/2007
Alpha-1 proteinase inhibitor (inhalation use) EU/3/08/546 Treatment of congenital alpha-1 antitrypsin deficiency Grifols Deutschland GmbH 3/06/2008
Alpha-tocopherol EU/3/16/1775 Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
Alpha-tocopherol and ascorbic acid EU/3/17/1832 Treatment of fragile X syndrome Advanced Medical Projects 27/02/2017
Alpha-tocotrienol quinone EU/3/11/937 Treatment of Leigh syndrome Edison Orphan Pharma BV 9/12/2011
Alvocidib EU/3/07/485 Treatment of chronic lymphocytic leukaemia Chiltern Clinical Research International GmbH 23/10/2007
Alvocidib EU/3/15/1437 Treatment of acute myeloid leukaemia Chiltern Clinical Research International GmbH 12/02/2015
Amatuximab EU/3/13/1222 Treatment of malignant mesothelioma Eisai GmbH 16/01/2014
Ambroxol hydrochloride EU/3/18/2017 Treatment of amyotrophic lateral sclerosis Spedding Research Solutions SAS 25/05/2018
Amikacin sulfate EU/3/14/1259 Treatment of nontuberculous mycobacterial lung disease Insmed Limited 8/04/2014
Amikacin sulfate EU/3/14/1397 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis PlumeStars s.r.l. 16/12/2014
Amikacin sulfate (liposomal) EU/3/06/387 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Insmed Limited 25/07/2006
Ammonium tetrathiomolybdate EU/3/08/539 Treatment of Wilson's disease JJGConsultancy Ltd 1/04/2008
Amphotericin B (for inhalation use) EU/3/06/391 Prevention of pulmonary fungal infection in patients deemed at risk Novartis Europharm Limited 28/08/2006
Anetumab ravtansine EU/3/18/2084 Treatment of ovarian cancer Bayer AG 19/11/2018
Anti epidermal growth factor receptor antibody h-R3 EU/3/04/220 Treatment of glioma Oncoscience GmbH 2/09/2004
Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody EU/3/04/193 Treatment of ovarian cancer Neovii Biotech GmbH 8/03/2004
Anti-GD2 monoclonal antibody 3F8 humanised EU/3/18/2094 Treatment of neuroblastoma Y-mAbs Therapeutics A/S 19/11/2018
Anti-H5N1 equine immunoglobulin F(ab')2 fragments EU/3/15/1512 Treatment of avian influenza Fab'entech 28/07/2015
Antisense NF-Kß p65 Oligonucleotide EU/3/02/106 Treatment of active ulcerative colitis InDex Pharmaceuticals AB 30/07/2002
Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' EU/3/06/416 Treatment of acute myeloid leukaemia EleosInc Limited 3/11/2006
Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA EU/3/16/1641 Treatment of Leber’s congenital amaurosis ProQR Therapeutics IV BV 28/04/2016
Antisense oligonucleotide directed against TGF-beta2 mRNA EU/3/15/1506 Prevention of scarring post glaucoma filtration surgery Isarna Therapeutics GmbH 19/06/2015
Antisense oligonucleotide targeted to the SMN2 gene EU/3/12/976 Treatment of 5q spinal muscular atrophy Biogen Netherlands B.V. 2/04/2012 Spinraza
Antisense oligonucleotide targeting exon 13 in the USH2A gene EU/3/17/1899 Treatment of retinitis pigmentosa ProQR Therapeutics IV BV 23/08/2017
Antisense oligonucleotide targeting exon 73 in the COL7A1 gene EU/3/17/1938 Treatment of epidermolysis bullosa ProQR Therapeutics VII BV 8/11/2017
Antisense oligonucleotide targeting the F508delta mutation of CFTR EU/3/13/1195 Treatment of cystic fibrosis ProQR Therapeutics III BV 7/10/2013
Antisense oligonucleotide targeting the USH2A gene EU/3/17/1853 Treatment of retinitis pigmentosa ProQR Therapeutics IV BV 20/03/2017
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/160 Treatment of retinopathy of prematurity Gene Signal SAS 2/10/2003
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/161 Treatment of neovascular glaucoma Gene Signal SAS 2/10/2003
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/07/445 Prevention of corneal graft rejection Gene Signal SAS 17/04/2007
Antroquinonol EU/3/16/1812 Treatment of pancreatic cancer Biological Consulting Europe Ltd 12/01/2017
Aplidine EU/3/04/245 Treatment of multiple myeloma Pharma Mar S.A. 16/11/2004
Apomorphine hydrochloride EU/3/11/862 Treatment of moderate and severe traumatic brain injury Dr Elkan Raphael Gamzu 13/05/2011
Apomorphine hydrochloride (inhalation use) EU/3/06/349 Treatment of off-periods in Parkinson’s disease not responding to oral treatment Vectura Group plc 16/02/2006
Apraglutide EU/3/18/2102 Treatment of short bowel syndrome IQVIA RDS Ireland Limited 19/11/2018
Argon EU/3/18/2031 Treatment of perinatal asphyxia Air Liquide Santé (International) 27/06/2018
Arimoclomol EU/3/06/406 Treatment of amyotrophic lateral sclerosis Orphazyme ApS 26/10/2006
Arimoclomol citrate EU/3/14/1376 Treatment of Niemann-Pick disease, type C Orphazyme ApS 19/11/2014
Arimoclomol citrate EU/3/16/1659 Treatment of inclusion body myositis Orphazyme ApS 30/05/2016
Arsenic trioxide EU/3/16/1610 Treatment of acute myeloid leukaemia Orsenix Holdings BV 17/02/2016
Arsenic trioxide EU/3/16/1797 Treatment of graft-versus-host disease Medsenic 12/12/2016
artesunate EU/3/07/430 Treatment of malaria ACE Pharmaceuticals BV 20/02/2007
artesunate EU/3/07/510 Treatment of malaria Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 6/12/2007
Artesunate EU/3/12/1079 Treatment of malaria Dafra Pharma International NV 6/12/2012
Artesunate EU/3/15/1521 Treatment of malaria Dr Ulrich Granzer 28/07/2015
ascorbic acid EU/3/08/531 Treatment of Charcot-Marie-Tooth disease type 1A Murigenetics SAS 1/04/2008
Ascorbic acid EU/3/16/1776 Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
Asp-Arg-Val-Tyr-Ile-His-Pro EU/3/14/1241 Treatment of Duchenne muscular dystrophy Envigo Pharma Consulting Ltd 19/02/2014
Asp-Arg-Val-Tyr-Ile-His-Pro EU/3/17/1879 Treatment of epidermolysis bullosa Envigo Pharma Consulting Ltd 20/06/2017
Asunercept EU/3/17/1900 Treatment of myelodysplastic syndromes Apogenix AG 23/08/2017
Ataluren EU/3/12/1010 Treatment of Becker muscular dystrophy PTC Therapeutics International Limited 4/07/2012
Ataluren EU/3/15/1561 Treatment of aniridia PTC Therapeutics International Limited 9/10/2015
Autologous adipose tissue-derived mesenchymal stem cells EU/3/17/1854 Treatment of thromboangiitis obliterans (Buerger's disease) SPC GmbH 20/03/2017
Autologous adipose tissue-derived stromal vascular fraction cells EU/3/15/1464 Treatment of systemic sclerosis Assistance Publique Hôpitaux de Marseille 19/03/2015
Autologous adult bone marrow-derived non-expanded CD133+ haematopoietic stem cells EU/3/17/1862 Treatment of Asherman's syndrome Igenomix, S.L. 20/04/2017
Autologous bone marrow-derived mesenchymal stromal cells secreting neurotrophic factors EU/3/13/1148 Treatment of amyotrophic lateral sclerosis Brainstorm Cell Therapeutics UK Ltd 17/07/2013
Autologous bone marrow-derived mononuclear cell fraction EU/3/10/775 Treatment of thromboangiitis obliterans (Buerger's disease) t2cure GmbH 20/09/2010
Autologous CD34+ cells transduced with a lentiviral vector containing the human ADA gene EU/3/13/1134 Treatment of adenosine deaminase-deficient-severe combined immunodeficiency Orchard Therapeutics Ltd 7/06/2013
Autologous CD34+ cells transduced with a lentiviral vector containing the human RAG1 gene EU/3/14/1257 Treatment of recombination-activating gene 1 deficient severe combined immunodeficiency Prof. F.J.T.Staal 26/03/2014
Autologous CD34+ cells transduced with a lentiviral vector containing the human SGSH gene EU/3/14/1280 Treatment of mucopolysaccharidosis IIIA (Sanfilippo A syndrome) Orchard Therapeutics Ltd 10/06/2014
Autologous CD34+ cells transduced with a lentiviral vector containing the human Wiskott-Aldrich syndrome gene EU/3/13/1196 Treatment of Wiskott-Aldrich-syndrome Généthon 7/10/2013
Autologous CD34+ cells transduced with lentiviral vector encoding the human beta globin gene EU/3/16/1660 Treatment of beta thalassaemia intermedia and major Orchard Therapeutics Ltd 30/05/2016
Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA EU/3/07/446 Treatment of metachromatic leukodystrophy Orchard Therapeutics Ltd 13/04/2007
Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene EU/3/12/998 Treatment of Wiskott-Aldrich syndrome Orchard Therapeutics Ltd 6/06/2012
Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene EU/3/05/313 Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency Orchard Therapeutics (Netherlands) B.V. 26/08/2005 Strimvelis
Autologous CD34+ haematopoietic stem and progenitor cells genetically modified with the lentiviral vector IDUA LV, encoding for the alpha-L-iduronidase cDNA EU/3/18/2073 Treatment of mucopolysaccharidosis type I Fondazione Telethon 26/10/2018
Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human beta A-T87Q-globin gene EU/3/14/1263 Treatment of sickle cell disease bluebird bio (Germany) GmbH 29/04/2014
Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human betaA-T87Q-globin gene EU/3/12/1091 Treatment of beta-thalassaemia intermedia and major bluebird bio (Germany) GmbH 24/01/2013
Autologous CD4+ and CD8+ T cells expressing a CD19-specific chimeric antigen receptor EU/3/17/1890 Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 17/07/2017
Autologous CD4+ and CD8+ T cells expressing a CD19-specific chimeric antigen receptor EU/3/18/2018 Treatment of follicular lymphoma Celgene Europe Limited 25/05/2018
Autologous CD4+ and CD8+ T-cells transduced with lentiviral vector containing an affinity-enhanced T-cell receptor targeting the New York esophageal antigen-1 EU/3/16/1694 Treatment of soft tissue sarcoma GlaxoSmithKline Trading Services Limited 14/07/2016
Autologous collagen type II-specific regulatory T cells EU/3/14/1405 Treatment of non-infectious uveitis TxCell 16/12/2014
Autologous dendritic cells incubated ex vivo with zebularine and factor VIII EU/3/16/1813 Treatment of haemophilia A Idogen AB 12/01/2017
Autologous dendritic cells pulsed with allogeneic tumour cell lysate EU/3/13/1229 Treatment of malignant mesothelioma Amphera BV 16/01/2014
Autologous dendritic cells pulsed with autologous tumour cell lysate EU/3/07/431 Treatment of glioma Northwest Biotherapeutics GmbH 15/02/2007
Autologous dendritic cells pulsed with killed ovarian cancer cells and matured by TLR3 ligand ex vivo EU/3/18/2009 Treatment of ovarian cancer SOTIO a.s 16/04/2018
Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose EU/3/10/776 Treatment of ovarian cancer Prima Biomed GmbH 20/09/2010
Autologous dendritic cells pulsed with RNA from glioma stem cells EU/3/14/1273 Treatment of glioma Epitarget AS 4/06/2014
Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha) EU/3/14/1247 Treatment of glioma Diamond BioPharm Limited 19/02/2014
Autologous dermal fibroblasts genetically modified ex vivo with a lentiviral vector containing the human COL7A1 gene EU/3/16/1642 Treatment of epidermolysis bullosa Intrexon Actobiotics N.V. 28/04/2016
Autologous Epstein-Barr virus specific T-cells derived from peripheral blood mononuclear cells, expanded ex vivo EU/3/16/1695 Treatment of extranodal NK/T-cell lymphoma, nasal type Cell Medica Ltd 14/07/2016
Autologous Epstein-Barr virus specific T-cells derived from peripheral blood mononuclear cells, expanded ex vivo EU/3/16/1696 Treatment of post-transplant lymphoproliferative disorder Cell Medica Ltd 14/07/2016
Autologous ex-vivo-expanded leucocytes treated with 5-aza-2’-deoxycytidine EU/3/13/1197 Treatment of glioma CytoVac A/S 13/11/2013
Autologous ex-vivo-expanded peripheral polyclonal lymphocytes enriched in activated natural killer cells EU/3/17/1918 Treatment of multiple myeloma CellProtect Nordic Pharmaceuticals AB 16/10/2017
Autologous glioma tumour cells treated with antisense molecule directed against the insulin-like growth factor type 1 receptor EU/3/18/2061 Treatment of glioma Pharma Gateway AB 24/08/2018
Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene EU/3/12/957 Treatment of X-linked chronic granulomatous disease Généthon 9/02/2012
Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene EU/3/09/623 Treatment of beta-thalassaemia intermedia and major   EGT San Rocco Italia SRL 29/04/2009
Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA EU/3/12/1003 Treatment of adrenoleukodystrophy bluebird bio (Germany) GmbH 6/06/2012
Autologous human adipose perivascular stromal cells genetically modified to secrete soluble tumour necrosis factor-related apoptosis-inducing ligand EU/3/18/2085 Treatment of pancreatic cancer Rigenerand S.r.l. 19/11/2018
Autologous human peripheral blood Vdelta1+ T lymphocytes activated in vitro by cytokine and monoclonal antibody treatment EU/3/15/1566 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Lymphact - Lymphocyte Activation Technologies S.A. 9/10/2015
Autologous mesenchymal stromal cells on a decellularised tracheal scaffold from a cadaveric donor EU/3/16/1717 Treatment of tracheal stenosis Videregen Ltd 29/08/2016
Autologous mononuclear cells derived from human cord blood EU/3/16/1743 Treatment of neonatal encephalopathy BrainRepair UG (haftungsbeschränkt) 14/10/2016
Autologous mononuclear cells derived from human cord blood EU/3/16/1744 Treatment of periventricular leukomalacia BrainRepair UG (haftungsbeschränkt) 14/10/2016
Autologous regulatory T cells with an immunophenotype of CD4+CD25hiFoxP3+ EU/3/13/1171 Prevention of graft rejection following solid organ transplantation iReg Medical AB 7/10/2013
Autologous renal cell tumor vaccine EU/3/02/116 Treatment of renal cell carcinoma Liponova GmbH 21/10/2002
Autologous stromal vascular cell fraction from adipose tissue EU/3/16/1643 Treatment of systemic sclerosis Cytori Ltd 28/04/2016
Autologous T cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19 EU/3/14/1266 Treatment of B-lymphoblastic leukaemia/lymphoma Novartis Europharm Limited 29/04/2014 Kymriah
Autologous T cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19 EU/3/16/1745 Treatment of diffuse large B-cell lymphoma Novartis Europharm Limited 14/10/2016 Kymriah
Autologous T cells transduced with lentiviral vector encoding an anti-SLAMF7 CD28/CD3-zeta chimeric antigen receptor EU/3/17/1833 Treatment of plasma cell myeloma Dr Michael Hudecek 27/02/2017
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3 zeta chimeric antigen receptor EU/3/14/1393 Treatment of diffuse large B cell lymphoma Kite Pharma EU B.V. 16/12/2014 Yescarta
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1552 Treatment of mantle cell lymphoma Kite Pharma EU B.V. 9/10/2015
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1553 Treatment of primary mediastinal large B-cell lymphoma Kite Pharma EU B.V. 9/10/2015 Yescarta
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1571 Treatment of acute lymphoblastic leukaemia Kite Pharma EU B.V. 11/11/2015
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1572 Treatment of chronic lymphocytic leukaemia/small lymphocytic lymphoma Kite Pharma EU B.V. 11/11/2015
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1579 Treatment of follicular lymphoma Kite Pharma EU B.V. 11/11/2015
Autologous T lymphocyte-enriched population of cells transduced with a lentiviral vector encoding a chimeric antigen receptor targeting human B cell maturation antigen with 4-1BB and CD3-zeta intracellular signalling domains EU/3/17/1863 Treatment of multiple myeloma Celgene Europe B.V. 20/04/2017
Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex EU/3/05/270 Treatment of renal cell carcinoma Antigenics Therapeutics Limited 11/04/2005
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin EU/3/06/394 Treatment of follicular lymphoma Biovest Europe Limited 28/08/2006
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin EU/3/10/831 Treatment of mantle cell lymphoma Biovest Europe Limited 23/02/2011
Autologous tumour-derived gp96 heat shock protein-peptide complex EU/3/09/624 Treatment of glioma Antigenics Therapeutics Limited 29/04/2009
Avacopan EU/3/17/1880 Treatment of C3 glomerulopathy ChemoCentryx Limited 20/06/2017
Avapritinib EU/3/18/2074 Treatment of mastocytosis PhaRA bvba 26/10/2018
Avelumab EU/3/16/1798 Treatment of gastric cancer Merck Europe B.V. 12/12/2016
Avian polyclonal IgY antibody against Pseudomonas aeruginosa EU/3/08/564 Treatment of cystic fibrosis Immunsystem I.M.S. AB 23/09/2008
Aviptadil EU/3/06/395 Treatment of acute lung injury mondoBIOTECH Laboratories Anstalt 28/08/2006
Aviptadil EU/3/07/473 Treatment of sarcoidosis mondoBIOTECH Laboratories Anstalt 14/09/2007
Aztreonam lysinate (inhalation use) EU/3/04/204 Treatment of gram negative bacteria lung infections in cystic fibrosis Gilead Sciences Ireland UC 21/06/2004 Cayston
Bacillus subtilis oxalate decarboxylase EU/3/17/1891 Treatment of primary hyperoxaluria Allena Pharmaceuticals Ireland Limited 17/07/2017
Bacterial lipase EU/3/05/323 Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Nordmark Arzneimittel GmbH u. Co. KG 7/11/2005
Bardoxolone methyl EU/3/18/2019 Treatment of Alport syndrome Reata UK Limited 25/05/2018
Bazedoxifene acetate EU/3/14/1367 Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 19/11/2014
Beclomethasone 17, 21-dipropionate (oral use) EU/3/02/093 Treatment of intestinal graft-versus-host disease Soligenix UK Ltd 13/03/2002
Belinostat EU/3/12/1055 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Onxeo DK, Filial af Onxeo S.A., Frankrig 10/10/2012
Belinostat EU/3/13/1151 Treatment of malignant thymoma Onxeo DK, Filial af Onxeo S.A., Frankrig 17/07/2013
Benserazide hydrochloride EU/3/14/1402 Treatment of beta-thalassaemia intermedia and major Isabelle Ramirez 16/12/2014
Benserazide hydrochloride EU/3/18/2125 Treatment of sickle cell disease Isabelle Ramirez 11/01/2019
Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] EU/3/09/715 Treatment of acute lymphoblastic leukaemia Incyte Biosciences Distribution B.V. 2/02/2010 Iclusig
Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] EU/3/09/716 Treatment of chronic myeloid leukaemia Incyte Biosciences Distribution B.V. 2/02/2010 Iclusig
Benzoic acid, sodium salt EU/3/02/111 Treatment of non-ketotic hyperglycinaemia Lucane Pharma SA 11/09/2002
Beraprost sodium (modified release tablet) EU/3/08/554 Treatment of pulmonary arterial hypertension IDEA Innovative Drug European Associates Limited 10/07/2008
Bertilimumab EU/3/18/2062 Treatment of bullous pemphigoid IQVIA RDS Ireland Limited 24/08/2018
Beta-artemether / lumefantrine (powder for oral suspension) EU/3/09/702 Treatment of malaria Dafra Pharma International NV 28/01/2010
Bevacizumab EU/3/14/1390 Treatment of hereditary haemorrhagic telangiectasia Dr Sophie Dupuis-Girod 16/12/2014
Bifunctional fusion protein composed of two extracellular domains of transforming growth factor beta receptor II fused with a human immunoglobulin G1 monoclonal antibody against programmed death ligand 1 EU/3/18/2112 Treatment of biliary tract cancer Merck Europe B.V. 14/12/2018
Bilayer engineered collagen hydrogel-based skin graft composed of autologous keratinocytes and fibroblasts EU/3/15/1596 Treatment of partial deep dermal and full thickness burns Voisin Consulting S.A.R.L. 14/12/2015
Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix EU/3/06/369 Treatment of epidermolysis bullosa Biodan Yelah S.L. 22/05/2006
Bimosiamose disodium EU/3/05/285 Treatment of acute lung injury Revotar Biopharmaceuticals AG 27/05/2005
Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium EU/3/04/232 Treatment of glioma Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 20/10/2004
Blinatumomab EU/3/09/650 Treatment of acute lymphoblastic leukaemia Amgen Europe B.V. 24/07/2009 Blincyto
Bovine bile extract EU/3/05/287 Treatment of pancreatic cancer Dr Ulrich Granzer 20/06/2005
Branaplam EU/3/18/2010 Treatment of spinal muscular atrophy Novartis Europharm Limited 16/04/2018
Brentuximab vedotin EU/3/11/939 Treatment of cutaneous T-cell lymphoma Takeda Pharma A/S 11/01/2012 ADCETRIS
Brincidofovir EU/3/16/1644 Prevention of cytomegalovirus disease Chimerix UK Ltd 28/04/2016
Brincidofovir EU/3/16/1697 Treatment of adenovirus infection in immunocompromised patients Chimerix UK Ltd 14/07/2016
Brincidofovir EU/3/16/1777 Treatment of smallpox Chimerix UK Ltd 18/11/2016
Brivudine EU/3/09/703 Treatment of pancreatic cancer RESprotect GmbH 28/01/2010
Bromelain EU/3/18/2113 Treatment of pseudomyxoma peritonei MUCPharm Pty Ltd 14/12/2018
Budesonide EU/3/13/1181 Treatment of eosinophilic oesophagitis Dr Falk Pharma GmbH 5/08/2013 Jorveza
Budesonide EU/3/16/1778 Treatment of primary IgA nephropathy Calliditas Therapeutics AB 18/11/2016
Budesonide (oral use) EU/3/06/413 Treatment of Graft-versus-Host disease Dr Falk Pharma GmbH 3/11/2006
Burosumab EU/3/18/2011 Treatment of phosphaturic mesenchymal tumour Ultragenyx Germany GmbH 16/04/2018
C1 esterase inhibitor (human) EU/3/18/2114 Treatment in solid organ transplantation Shire Pharmaceuticals Ireland Limited 14/12/2018
C1-esterase-inhibitor human EU/3/17/1939 Treatment in solid organ transplantation CSL Behring GmbH 8/11/2017
Cabiralizumab EU/3/16/1799 Treatment of tenosynovial giant cell tumour, localised and diffuse type TMC Pharma Services Ltd 12/12/2016
Caffeine citrate EU/3/03/132 Treatment of primary apnoea of premature newborns Chiesi Farmaceutici S.p.A. 17/02/2003 Peyona
Caffeine citrate EU/3/14/1261 Prevention of bronchopulmonary dysplasia Viridian Pharma Ltd 11/04/2014
Cannabidiol EU/3/14/1339 Treatment of Dravet syndrome GW Research Ltd 15/10/2014
Cannabidiol EU/3/15/1520 Treatment of perinatal asphyxia GW Pharma Ltd 28/07/2015
Cannabidiol EU/3/16/1645 Prevention of graft-versus-host disease Salzman Group Ltd 28/04/2016
Cannabidiol EU/3/16/1718 Treatment of graft-versus-host disease Salzman Group Ltd 29/08/2016
Cannabidiol EU/3/17/1855 Treatment of Lennox-Gastaut syndrome GW Research Ltd 20/03/2017
Cannabidiol EU/3/17/1920 Treatment of West syndrome GW Research Ltd 16/10/2017
Cannabidiol EU/3/17/1959 Treatment of tuberous sclerosis GW Research Ltd 17/01/2018
Cannabidivarin EU/3/17/1921 Treatment of Rett syndrome GW Research Ltd 16/10/2017
Cannabidivarin EU/3/18/1977 Treatment of fragile X syndrome GW Research Ltd 22/02/2018
Carbamazepine EU/3/16/1746 Treatment of metaphyseal chondrodysplasia, Schmid type University of Newcastle upon Tyne 14/10/2016
Carbetocin EU/3/12/975 Treatment of Prader-Willi syndrome Voisin Consulting S.A.R.L. 21/03/2012
Carboxy pyrrolidine hexanoyl pyrrolidine carboxylate EU/3/14/1292 Treatment of AL amyloidosis GlaxoSmithKline Trading Services Limited 30/07/2014
Carboxypeptidase G2 EU/3/02/128 Adjunctive treatment in patients at risk of methotrexate toxicity BTG Management Services Limited 3/02/2003
Cardiotrophin-1 EU/3/06/396 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation Digna Biotech S.L. 28/08/2006
Cardiotrophin-1 EU/3/11/893 Treatment of acute liver failure Digna Biotech S.L. 30/08/2011
Carfilzomib EU/3/08/548 Treatment of multiple myeloma Amgen Europe B.V. 3/06/2008 Kyprolis
Carglumic acid EU/3/08/575 Treatment of isovaleric acidaemia Orphan Europe S.A.R.L. 7/11/2008 Carbaglu
Carglumic acid EU/3/08/576 Treatment of methylmalonic acidaemia Orphan Europe S.A.R.L. 7/11/2008 Carbaglu
Carglumic acid EU/3/08/577 Treatment of propionic acidaemia Orphan Europe S.A.R.L. 7/11/2008 Carbaglu
Carmustine EU/3/18/2032 Treatment in haematopoietic stem cell transplantation ADIENNE S.r.l.S.U. 27/06/2018
Catumaxomab EU/3/06/414 Treatment of gastric cancer Neovii Biotech GmbH 3/11/2006
CD33-directed antibody-drug conjugate consisting of an antibody conjugated to a DNA cross-linking pyrrolobenzodiazepine dimer drug EU/3/15/1545 Treatment of acute myeloid leukaemia Seagen Ireland Limited 10/08/2015
CD34+ haematopoietic stem and progenitor cells with CD3+ T-cells EU/3/18/2063 Treatment in solid organ transplantation IQVIA RDS Ireland Limited 24/08/2018
Cediranib EU/3/14/1303 Treatment of ovarian cancer AstraZeneca AB 29/07/2014
Ceftriaxone EU/3/14/1425 Treatment of spinocerebellar ataxia Ospedale San Raffaele s.r.l. 15/01/2015
Cenersen EU/3/08/587 Treatment of chronic lymphocytic leukaemia EleosInc Limited 3/12/2008
Chemically modified human recombinant sulfamidase EU/3/16/1747 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Swedish Orphan Biovitrum AB (publ) 14/10/2016
Chenodeoxycholic acid EU/3/14/1406 Treatment of inborn errors of primary bile acid synthesis sigma-tau Arzeimittel GmbH 16/12/2014 Chenodeoxycholic acid Leadiant
Chimeric 2'-O-(2-methoxyethyl) modified oligonucleotide targeted to huntingtin RNA EU/3/15/1453 Treatment of Huntington’s disease Roche Registration GmbH 19/03/2015
Chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2 EU/3/14/1422 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) BioMarin Europe Ltd 15/01/2015
Chimeric group B adenovirus (11p/3) with deletions in the E3 and E4 regions EU/3/15/1434 Treatment of ovarian cancer PsiOxus Therapeutics Ltd 12/02/2015
Chimeric IgG monoclonal antibody cG250 EU/3/02/094 Treatment of renal cell carcinoma Heidelberg Pharma AG 19/03/2002
Chimeric locked nucleic acid deoxynucleoside phosphorothioate-linked oligonucleotide inhibitor directed against microRNA-155-5p EU/3/17/1872 Treatment of cutaneous T-cell lymphoma Miragen Therapeutics Europe Ltd 22/05/2017
Chimeric monoclonal antibody against claudin 6 EU/3/12/1092 Treatment of ovarian cancer Astellas Pharma Europe B.V. 24/01/2013
Chimeric monoclonal antibody against claudin-18 splice variant 2 EU/3/10/803 Treatment of gastric cancer Astellas Pharma Europe B.V. 26/11/2010
Chimeric monoclonal antibody against claudin-18 splice variant 2 EU/3/13/1177 Treatment of pancreatic cancer Astellas Pharma Europe B.V. 5/08/2013
Chimeric monoclonal antibody against GD2 EU/3/12/1062 Treatment of neuroblastoma EUSA Pharma (Netherlands) B.V. 8/11/2012 Qarziba
Chimeric monoclonal antibody to O-acetyl-GD2 antigen EU/3/14/1416 Treatment of neuroblastoma OGD2 Pharma 15/01/2015
Chimeric monoclonal antibody to shiga-toxin 1 and 2 EU/3/05/301 Treatment of shiga-toxin producing bacterial infection. Albany Regulatory Consulting Limited 26/08/2005
Chimeric-anti-interleukin-6 monoclonal antibody EU/3/07/508 Treatment of Castleman’s disease Janssen-Cilag International NV 30/11/2007 Sylvant
Chlormethine EU/3/12/963 Treatment of cutaneous T-cell lymphoma Helsinn Birex Pharmaceuticals Ltd 22/05/2012 Ledaga
Chloroquine EU/3/14/1377 Treatment of glioma DualTpharma B.V. 19/11/2014
Cholest-4-en-3-one, oxime EU/3/05/264 Treatment of 5q spinal muscular atrophy Roche Registration GmbH 10/03/2005
Cholic acid EU/3/02/127 Treatment of inborn errors in primary bile acid synthesis Laboratoires CTRS 18/12/2002 Orphacol
Cholic acid EU/3/09/683 Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid Retrophin Europe Limited 28/10/2009 Kolbam
Choline tetrathiomolybdate EU/3/12/1089 Treatment of Wilson's disease Wilson Therapeutics AB 24/01/2013
Ciclopirox EU/3/17/1960 Treatment of congenital erythropoietic porphyria Atlas Molecular Pharma S.L. 17/01/2018
Ciclosporin EU/3/06/360 Treatment of vernal keratoconjunctivitis Santen Oy 6/04/2006 Verkazia
Ciclosporin EU/3/07/455 Prevention of corneal graft rejection SANTEN S.A.S. 22/10/2007
Ciclosporin EU/3/07/489 Treatment of Herpes simplex virus stromal keratitis SANTEN S.A.S. 29/10/2007
Ciclosporin EU/3/10/791 Treatment of moderate and severe closed traumatic brain injury NeuroVive Pharmaceutical AB 1/10/2010
Ciclosporin (eye drops, solution) EU/3/09/651 Treatment of atopic keratoconjunctivitis Allergan Pharmaceuticals Ireland 24/07/2009
Ciclosporin (inhalation use) EU/3/04/210 Treatment of bronchiolitis obliterans syndrome Breath Therapeutics GmbH 29/07/2004
Ciclosporin (inhalation use) EU/3/04/209 Prevention of graft rejection after lung transplantation Breath Therapeutics GmbH 29/07/2004
Ciprofloxacin (liposomal) EU/3/09/652 Treatment of cystic fibrosis Aradigm Limited 24/07/2009
Cisplatin EU/3/16/1719 Treatment of malignant mesothelioma PlumeStars s.r.l. 29/08/2016
Cisplatin (liposomal) EU/3/07/451 Treatment of pancreatic cancer Regulon AE 8/06/2007
Citric acid monohydrate EU/3/16/1675 Treatment of acute liver failure CATS Consultants GmbH 27/06/2016
Cladribine EU/3/13/1182 Treatment of mastocytosis Lipomed GmbH 5/08/2013
Clonidine hydrochloride EU/3/11/919 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Monopar Therapeutics SARL 27/10/2011
Codon-optimised human ornithine transcarbamylase mRNA complexed with lipid-based nanoparticles EU/3/18/2033 Treatment of ornithine transcarbamylase deficiency Real Regulatory Limited 27/06/2018
Combination of 4-hydroxyandrostenedione, Serenoa serrulata fruit extract and alpha lipoic acid EU/3/16/1646 Treatment of multiple symmetric lipomatosis Dr Regenold GmbH 28/04/2016
Combination of carboplatin and sodium valproate EU/3/18/2043 Treatment of glioma Dr Ulrich Granzer 31/07/2018
Combretastatin A1 diphosphate EU/3/15/1587 Treatment of acute myeloid leukaemia Diamond BioPharm Limited 14/12/2015
Concizumab EU/3/17/1940 Treatment of haemophilia B Novo Nordisk A/S 8/11/2017
Copanlisib EU/3/18/2064 Treatment of marginal zone lymphoma Bayer AG 24/08/2018
Copper meso-5,15-bis[3-[(1,2-dicarba-closo-dodecaboranyl)methoxy]phenyl]-meso-10,20-dinitroporphyrin EU/3/13/1138 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy MorEx Development Partners LLP 27/06/2013
Crenolanib besylate EU/3/16/1748 Treatment of acute myeloid leukemia Arog Pharmaceuticals Europe Ltd 14/10/2016
Crenolanib besylate EU/3/16/1749 Treatment of soft tissue sarcoma Arog Pharmaceuticals Europe Ltd 14/10/2016
Cultured allogeneic corneal limbal stem cells EU/3/14/1340 Treatment of limbal stem cell deficiency NHS National Services Scotland Trading as Scottish National Blood Transfusion Service 15/10/2014
Cyclic pyranopterin monophosphate EU/3/10/777 Treatment of molybdenum cofactor deficiency type A Alexion Europe SAS 20/09/2010
Cyclocreatine EU/3/16/1676 Treatment of creatine deficiency syndromes Pharma Gateway AB 27/06/2016
Cyclo-Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys EU/3/13/1102 Treatment of high altitude pulmonary oedema Apeptico Forschung und Entwicklung GmbH 8/02/2013
Cyclo(-gamma-aminobutyryl-L-phenylalanyl-L-tryptophanyl-D-tryptophanyl-L-lysyl-L-threonyl-L phenylalanyl-N-3-carboxypropyl)-glycine amide, acetate salt EU/3/12/1075 Treatment of acromegaly Cortendo AB 6/12/2012
Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl] acetate salt EU/3/13/1114 Treatment of congenital alpha-1 antitrypsin deficiency Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2013
Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl]acetate EU/3/18/2086 Treatment of cystic fibrosis Santhera Pharmaceuticals (Deutschland) GmbH 19/11/2018
Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl]acetate salt EU/3/17/1834 Treatment of primary ciliary dyskinesia Santhera Pharmaceuticals (Deutschland) GmbH 27/02/2017
Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt EU/3/08/610 Treatment of medullary thyroid carcinoma Ipsen Pharma 6/02/2009 Cometriq
Cysteamine EU/3/11/928 Treatment of cystic fibrosis NovaBiotics Ltd 9/12/2011
Cysteamine EU/3/14/1240 Treatment of cystic fibrosis Istituto Europeo per la Ricerca sulla Fibrosi Cistica - ONLUS 19/02/2014
Cysteamine bitartrate EU/3/14/1252 Treatment of pancreatic cancer Chiesi Farmaceutici S.p.A. 26/03/2014
Cysteamine bitartrate EU/3/14/1306 Treatment of Huntington’s disease Chiesi Farmaceutici S.p.A. 29/07/2014
Cysteamine bitartrate (gastroresistant) EU/3/10/778 Treatment of cystinosis Chiesi Farmaceutici S.p.A. 20/09/2010 Procysbi
Cysteamine hydrochloride EU/3/08/578 Treatment of cystinosis Orphan Europe S.A.R.L. 7/11/2008 Cystadrops
Cysteamine hydrochloride EU/3/14/1341 Treatment of cystinosis Lucane Pharma SA 15/10/2014
Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate EU/3/03/149 Treatment of pancreatic cancer in combination with ifosfamide Pharmacyte Biotech Europe Limited 30/06/2003
Dantrolene sodium EU/3/14/1379 Treatment of malignant hyperthermia Eagle Laboratories Limited 19/11/2014
Dantrolene sodium EU/3/16/1800 Treatment of Wolfram syndrome Alan Boyd Consultants Ltd 12/12/2016
Daratumumab EU/3/13/1153 Treatment of plasma cell myeloma Janssen-Cilag International NV 17/07/2013 Darzalex
Daratumumab EU/3/18/2020 Treatment of AL amyloidosis Janssen-Cilag International NV 25/05/2018
Darinaparsin EU/3/11/850 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) IDEA Innovative Drug European Associates Limited 15/04/2011
Daunorubicin (liposomal) EU/3/08/585 Treatment of acute myeloid leukaemia Diatos S. A. 3/12/2008
Decitabine EU/3/03/135 Treatment of myelodysplastic syndromes Janssen-Cilag International NV 14/02/2003
Decitabine EU/3/06/370 Treatment of acute myeloid leukaemia Janssen-Cilag International NV 8/06/2006 Dacogen
Decitabine and tetrahydrouridine EU/3/17/1881 Treatment of sickle cell disease Ulrich Muehlner 20/06/2017
Deferiprone EU/3/10/832 Treatment of sickle cell disease Apotex Europe B.V. 23/02/2011
Deferiprone EU/3/18/2034 Treatment of neurodegeneration with brain iron accumulation Apotex Europe B.V. 27/06/2018
Defibrotide EU/3/04/211 Prevention of hepatic veno-occlusive disease Gentium S.r.I. 29/07/2004
Defibrotide EU/3/04/212 Treatment of hepatic veno-occlusive disease Gentium S.r.I. 29/07/2004 Defitelio
Defibrotide EU/3/13/1201 Prevention of graft-versus-host disease Gentium S.r.I. 13/11/2013
Delta-9-tetrahydrocannabinol and cannabidiol from extracts of the Cannabis sativa L. plant EU/3/16/1621 Treatment of glioma GW Research Ltd 17/02/2016
Denileukin diftitox EU/3/01/075 Treatment of cutaneous T-cell lymphoma Eisai GmbH 11/12/2001
Dexamethasone sodium phosphate encapsulated in human autologous erythrocytes EU/3/13/1158 Treatment of ataxia telangiectasia Erydel S.p.A. 17/07/2013
Dexamethasone sodium phosphate encapsulated in human erythrocytes EU/3/04/230 Treatment of cystic fibrosis Erydel S.p.A. 20/10/2004
Diacerein EU/3/14/1236 Treatment of epidermolysis bullosa Medpace Finland OY 19/02/2014
Diaspirin cross-linked haemoglobin EU/3/14/1378 Treatment of hepatocellular carcinoma New B Innovation (UK) Limited 19/11/2014
Diaspirin cross-linked haemoglobin EU/3/16/1628 Treatment of oesophageal cancer New B Innovation (UK) Limited 21/03/2016
Diazoxide choline EU/3/17/1941 Treatment of Prader-Willi syndrome Soleno Therapeutics UK Ltd 8/11/2017
Diclofenamide EU/3/16/1616 Treatment of periodic paralysis Prof. Michael Hanna 17/02/2016
Diclofenamide EU/3/16/1677 Treatment of periodic paralysis Sun Pharmaceutical Industries Europe BV 27/06/2016
Dimethyl fumarate EU/3/16/1698 Treatment of bullous pemphigoid Immungenetics AG 14/07/2016
Dimethyl fumarate EU/3/18/1990 Treatment of Friedreich's ataxia PharmaBio Consulting 21/03/2018
dimethyl sulfoxide EU/3/05/263 Treatment of severe closed traumatic brain injury AOP Orphan Pharmaceuticals AG 3/03/2005
Dinaciclib EU/3/11/901 Treatment of chronic lymphocytic leukaemia Merck Sharp & Dohme B.V. 27/09/2011
Dipalmitoylphosphatidylcholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol, sodium salt, synthetic surfactant protein C analogue and synthetic surfactant protein B analogue EU/3/12/982 Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Chiesi Farmaceutici S.p.A. 2/04/2012
DNA plasmid encoding a recombinant fusion protein consisting of the extracellular domain of human TNFα p55 receptor linked to the human IgG1 Fc domain EU/3/16/1619 Treatment of non-infectious uveitis Eyevensys SAS 17/02/2016
Docosahexaenoic acid ethyl ester EU/3/18/1991 Treatment of sickle cell disease TurnKey PharmaConsulting Ireland Limited 21/03/2018
Donor lymphocyte preparation depleted of functional alloreactive T-cells EU/3/08/561 Prevention of Graft-versus-Host disease Kiadis Pharma Netherlands B.V. 5/09/2008
Donor T lymphocytes depleted ex vivo of host alloreactive T cells using photodynamic treatment EU/3/14/1356 Treatment of acute myeloid leukaemia Kiadis Pharma Netherlands B.V. 19/11/2014
Donor T lymphocytes depleted ex vivo of host alloreactive T cells using photodynamic treatment EU/3/16/1678 Treatment in haematopoietic stem cell transplantation Kiadis Pharma Netherlands B.V. 27/06/2016
Doxorubicin EU/3/15/1513 Treatment of hepatoblastoma Double Bond Pharmaceutical AB 28/07/2015
Doxorubicin hydrochloride in a lipid-based pegylated nanoparticle modified with a 31-aminoacid peptide targeting nucleolin EU/3/16/1814 Treatment of malignant mesothelioma TREAT U, S.A. 12/01/2017
Doxorubicin hydrochloride (in heat-sensitive liposomes) EU/3/10/833 Treatment of hepatocellular carcinoma FGK Representative Service GmbH 23/02/2011
Doxorubicin hydrochloride (liposomal) EU/3/06/410 Treatment of soft tissue sarcoma GP-Pharm S.A. 27/10/2006
Doxorubicin polyisohexylcyanoacrylate nanoparticles EU/3/04/229 Treatment of the hepatocellular carcinoma Onxeo 21/10/2004
Doxorubicin(6-maleimidocaproyl)hydrazone EU/3/14/1258 Treatment of soft tissue sarcoma Pharma Gateway AB 26/03/2014
Doxycycline hyclate EU/3/12/955 Treatment of familial amyloid polyneuropathy Giampaolo Merlini 2/04/2012
Doxycycline hyclate EU/3/12/961 Treatment of systemic amyloidosis caused by beta-2 microglobulin Giampaolo Merlini 5/03/2012
Drotrecogin alfa (activated) EU/3/08/565 Treatment of acute respiratory distress syndrome Savara ApS 22/09/2008
Dry extract from birch bark (DER 0.1-0.2:1), extraction solvent n-heptane 95% (V/V) EU/3/10/845 Treatment of epidermolysis bullosa Birken AG 23/02/2011
Duramycin EU/3/02/120 Treatment of cystic fibrosis AOP Orphan Pharmaceuticals AG 13/11/2002
E. Coli heat-shock protein 70 with bovine retinal S-antigen EU/3/05/346 Treatment of autoimmune uveitis Biotech Tools SA 24/01/2006
((E)-1-(4'-chlorophenyl)-3-(4-hydroxy-3-metoxyphenyl)prop-2-en-1-one) EU/3/14/1384 Treatment of WHIM syndrome Centre National de la Recherche Scientifique (CNRS) 16/12/2014
(E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/279 Treatment of cutaneous T-cell lymphoma Celgene Europe B.V. 27/05/2005
(E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/328 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Celgene Europe B.V. 28/10/2005
(E)-2,4,6-trimethoxystyryl-3-carboxymethylamino-4-methoxybenzyl-sulfone sodium salt EU/3/12/987 Treatment of myelodysplastic syndromes Onconova Europe GmbH 26/04/2012
(E)-(6-((N-methyl-((3-methylbenzofuran-2-yl)methyl)amino)-3-oxoprop-1-en-1-yl)-2-oxo-3,4-dihydro-1,8-naphthyridin-1(2H)-yl)methyl phosphate, bis ethanolamine salt EU/3/16/1737 Treatment of osteomyelitis Voisin Consulting S.A.R.L. 14/10/2016
Ecopipam EU/3/09/717 Treatment of Lesch-Nyhan disease Dr Alain Munoz 3/02/2010
Ecothiopate iodide EU/3/15/1474 Treatment of Stargardt's disease Dorian Regulatory Affairs BV 24/04/2015
Eculizumab EU/3/03/166 Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe SAS 17/10/2003 Soliris
Eculizumab EU/3/09/653 Treatment of atypical haemolytic uremic syndrome Alexion Europe SAS 24/07/2009 Soliris
Eculizumab EU/3/13/1185 Treatment of neuromyelitis optica Alexion Europe SAS 5/08/2013
Eculizumab EU/3/14/1304 Treatment of myasthenia gravis Alexion Europe SAS 29/07/2014 Soliris
Edaravone EU/3/14/1399 Treatment of amyotrophic lateral sclerosis Treeway B.V. 16/12/2014
Edaravone EU/3/15/1510 Treatment of amyotrophic lateral sclerosis Mitsubishi Tanabe Pharma Europe Ltd 19/06/2015
Efgartigimod alfa EU/3/18/1992 Treatment of myasthenia gravis argenx BVBA 21/03/2018
Eflornithine EU/3/10/779 Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 20/09/2010
Eflornithine EU/3/11/902 Treatment of neuroblastoma Cancer Prevention Pharma Limited 27/09/2011
Eflornithine EU/3/16/1679 Treatment of glioma Orbus Therapeutics Limited 27/06/2016
Eflornithine in combination with sulindac EU/3/12/1086 Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 24/01/2013
Efpegsomatropin EU/3/18/2035 Treatment of growth hormone deficiency Hanmi Europe Limited 27/06/2018
Eicosapentaenoic acid EU/3/09/666 Treatment of familial adenomatous polyposis S.L.A. Pharma (UK) Limited 8/10/2009
Elafin EU/3/07/443 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Proteo Biotech AG 20/03/2007
Emeramide EU/3/17/1864 Prevention of mercury toxicity NBMI Science Limited 20/04/2017
Emtricitabine EU/3/14/1420 Treatment of Aicardi-Goutières syndrome Dr Yanick Crow 15/01/2015
Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor EU/3/12/1072 Treatment of macular telangiectasia type 2 Le4D Limited 8/11/2012
Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor EU/3/12/1098 Treatment of retinitis pigmentosa Enpharma Ltd 24/01/2013
Enoxacin EU/3/15/1459 Treatment of amyotrophic lateral sclerosis Dr Regenold GmbH 19/03/2015
Entinostat EU/3/10/732 Treatment of Hodgkin's lymphoma Syndax Limited 10/06/2010
Entolimod EU/3/15/1607 Treatment of acute radiation syndrome TMC Pharma Services Ltd 11/01/2016
Entospletinib EU/3/17/1922 Treatment of acute myeloid leukaemia Gilead Sciences Ireland UC 16/10/2017
Enzastaurin hydrochloride EU/3/05/343 Treatment of glioma Isabelle Ramirez 23/12/2005
Enzastaurin hydrochloride EU/3/07/442 Treatment of diffuse large B cell lymphoma Isabelle Ramirez 20/03/2007
Eptacog alfa (activated) EU/3/05/333 Treatment of diffuse alveolar haemorrhage Savara ApS 14/12/2005
Equine immunoglobulin F(ab')2 fragments targeting Shiga toxin EU/3/18/2021 Prevention of haemolytic uraemic syndrome Chemo Research S.L. 25/05/2018
Erdosteine EU/3/12/1067 Treatment of mercury toxicity Rafifarm SRL 8/11/2012
Erdosteine EU/3/12/1084 Treatment of lead toxicity Rafifarm SRL 6/12/2012
Estetrol EU/3/17/1865 Treatment of neonatal encephalopathy Mithra Pharmaceuticals S.A. 28/04/2017
Estradiol Hemihydrate and Progesterone EU/3/05/275 Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age Dr Frank Pohlandt 11/04/2005
Etamsylate EU/3/18/2087 Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 19/11/2018
Ethyl Eicosopentaenoate EU/3/00/013 Treatment of Huntington's disease Amarin Neuroscience Limited 29/12/2000
Etilefrin EU/3/02/122 Treatment of low flow priapism Laboratoires SERB 13/11/2002
Everolimus EU/3/10/764 Treatment of tuberous sclerosis Novartis Europharm Limited 4/08/2010 Votubia
Ex vivo fused normal allogeneic human myoblast with another normal allogeneic human myoblast EU/3/18/2088 Treatment of Duchenne muscular dystrophy Dystrogen Therapeutics S.A. 19/11/2018
Ex vivo fused normal allogeneic human myoblast with autologous human myoblast derived from Duchenne muscular dystrophy affected donor EU/3/18/2089 Treatment of Duchenne muscular dystrophy Dystrogen Therapeutics S.A. 19/11/2018
Exenatide EU/3/16/1629 Treatment of idiopathic intracranial hypertension Alan Boyd Consultants Ltd 21/03/2016
Exendin (9-39) EU/3/16/1750 Treatment of noninsulinoma pancreatogenous hypoglycaemia syndrome Eiger Biopharmaceuticals Europe Limited 14/10/2016
Exisulind EU/3/14/1387 Treatment of familial cerebral cavernous malformations Firc Institute of Molecular Oncology (IFOM) 16/12/2014
Exon 44 specific phosphorothioate oligonucleotide EU/3/08/598 Treatment of Duchenne muscular dystrophy BioMarin International Limited 27/02/2009
Exon 45 specific phosphorothioate oligonucleotide EU/3/12/991 Treatment of Duchenne muscular dystrophy BioMarin International Limited 26/04/2012
Exon 51 specific phosphorothioate oligonucleotide EU/3/08/599 Treatment of Duchenne muscular dystrophy BioMarin International Limited 27/02/2009
Exon 52 specific phosphorothioate oligonucleotide EU/3/12/1077 Treatment of Duchenne muscular dystrophy BioMarin International Limited 6/12/2012
Exon 53 specific phosphorothioate oligonucleotide EU/3/12/992 Treatment of Duchenne muscular dystrophy BioMarin International Limited 26/04/2012
Exon 55 specific phosphorothioate oligonucleotide EU/3/12/1078 Treatment of Duchenne muscular dystrophy BioMarin International Limited 6/12/2012
Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue EU/3/09/667 Treatment of anal fistula Takeda Pharma A/S 8/10/2009 Alofisel
Expanded human allogeneic neural retinal progenitor cells extracted from neural retina EU/3/13/1140 Treatment of retinitis pigmentosa ReNeuron Ltd 19/06/2013
Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower EU/3/05/302 Treatment of sickle cell disease Xechem UK Ltd 26/08/2005
Ex-vivo cultured adult human mesenchymal stem cells EU/3/07/432 Treatment of Graft-versus-Host disease Voisin Consulting S.A.R.L. 20/02/2007
Ex-vivo expanded autologous human corneal epithelium containing stem cells EU/3/08/579 Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns Chiesi Farmaceutici S.p.A. 7/11/2008 Holoclar
Ex-vivo expanded autologous human corneal epithelium containing stem cells EU/3/13/1168 Treatment of limbal stem cell deficiency University of Newcastle upon Tyne 17/07/2013
Ex-vivo fused autologous human bone marrow-derived mesenchymal stem cell with allogenic human myoblast EU/3/18/2045 Treatment of Duchenne muscular dystrophy Dystrogen Therapeutics S.A. 31/07/2018
Ex-vivo-cultured human mesenchymal stromal cells EU/3/14/1253 Prevention of graft rejection following solid organ transplantation iCell Science AB 26/03/2014
Ex-vivo-expanded autologous fibroblasts transduced with lentiviral vector containing the COL7A1 gene EU/3/16/1611 Treatment of epidermolysis bullosa Dr Waseem Qasim 17/02/2016
Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a COL17A1-encoding retroviral vector EU/3/15/1467 Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a COL7A1-encoding retroviral vector EU/3/15/1466 Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a LAMB3-encoding retroviral vector EU/3/15/1465 Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
Ex-vivo-expanded autologous keratinocytes transduced with retroviral vector containing the COL7A1 gene EU/3/17/1835 Treatment of epidermolysis bullosa Abeona Therapeutics Europe SL 27/02/2017
Fc- and CDR-modified humanised monoclonal antibody against C5 EU/3/16/1661 Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe SAS 30/05/2016
Fenfluramine hydrochloride EU/3/13/1219 Treatment of Dravet syndrome Zogenix GmbH 18/12/2013
Fenfluramine hydrochloride EU/3/17/1836 Treatment of Lennox-Gastaut syndrome Zogenix GmbH 27/02/2017
Fenretinide EU/3/16/1630 Treatment of cutaneous T-cell lymphoma Clinipace GmbH 21/03/2016
Fenretinide EU/3/16/1751 Treatment of peripheral T-cell lymphoma Clinipace GmbH 14/10/2016
Fibrinogen-coated albumin spheres EU/3/15/1442 Treatment of Ebola virus disease Fibreu Limited 12/02/2015
Fibrinogen-coated albumin spheres EU/3/15/1535 Treatment of acute radiation syndrome Fibreu Limited 10/08/2015
Fidanacogene elaparvovec EU/3/18/2090 Treatment of haemophilia B Pfizer Europe MA EEIG 19/11/2018
filgrastim EU/3/08/532 Treatment of amyotrophic lateral sclerosis NeuroVision Pharma GmbH 1/04/2008
Filgrastim EU/3/08/580 Treatment of spinal cord injury NeuroVision Pharma GmbH 7/11/2008
Fimaporfin EU/3/16/1720 Treatment of cholangiocarcinoma PCI Biotech AS 29/08/2016
Fixed-dose combination of fosfomycin disodium and tobramycin EU/3/15/1538 Treatment of cystic fibrosis CURx Pharma (UK) Limited 10/08/2015
Fixed-dose combination of (R-S) baclofen, naltrexone hydrochloride and D-sorbitol EU/3/14/1260 Treatment of Charcot-Marie-Tooth disease type 1A Pharnext SA 26/03/2014
Florilglutamic acid (18F) EU/3/16/1631 Diagnosis of glioma Piramal Imaging GmbH 21/03/2016
Florilglutamic acid (18F) EU/3/16/1632 Diagnosis of hepatocellular carcinoma Piramal Imaging GmbH 21/03/2016
Fluciclovine (18F) EU/3/15/1472 Diagnosis of glioma Blue Earth Diagnostics Ltd 24/04/2015
Flucytosine EU/3/18/1978 Treatment of glioma Richardson Associates Regulatory Affairs Ltd 22/02/2018
Fluocinolone acetonide (prolonged-release intravitreal implant) EU/3/05/261 Treatment of non-infectious uveitis affecting the posterior segment of the eye Bausch & Lomb Ireland 7/03/2005
Fluticasone propionate EU/3/16/1815 Treatment of eosinophilic oesophagitis Adare Pharmaceuticals srl 12/01/2017
Forodesine EU/3/10/780 Treatment of chronic lymphocytic leukaemia Mundipharma Research Limited 20/09/2010
Forodesine hydrochloride EU/3/06/421 Treatment of acute lymphoblastic leukaemia Napp Pharmaceuticals Research Limited 18/12/2006
Forodesine hydrochloride EU/3/06/428 Treatment of cutaneous T-cell lymphoma Napp Pharmaceuticals Research Limited 29/01/2007
Fosbretabulin tromethamine EU/3/13/1154 Treatment of ovarian cancer Diamond BioPharm Limited 17/07/2013
Fosbretabulin tromethamine EU/3/16/1633 Treatment of gastro-entero-pancreatic neuroendocrine tumours Diamond BioPharm Limited 21/03/2016
Fusion proteins composed by a genetically modified cholera toxin subunit A1, peptides from the acetylcholine receptor alpha chain and a dimer of the D fragment from Staphylococcus aureus protein A EU/3/15/1489 Treatment of myasthenia gravis Toleranzia AB 21/05/2015
G17(9) gastrin-diphtheria toxoid conjugate EU/3/02/129 Treatment of pancreatic cancer Cato Europe GmbH 24/01/2003
G17(9) gastrin-diphtheria toxoid conjugate EU/3/02/130 Treatment of gastric cancer Cato Europe GmbH 28/01/2003
Gadodiamide (liposomal) EU/3/08/583 Treatment of glioma Dr Matthias Luz 3/12/2008
Gallium (68Ga)-edotreotide EU/3/15/1450 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 19/03/2015 SomaKit TOC
Gallium (68Ga)-pasireotide tetraxetan EU/3/11/920 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours OctreoPharm Sciences GmbH 27/10/2011
Gallium [Ga-68]-N-[(4,7,10-tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-Lcysteinyl-L-threonine-cyclic(2-7)disulfide EU/3/14/1237 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 19/02/2014
Gefitinib EU/3/18/2075 Treatment of Fanconi anaemia Consorcio Centro de Investigación Biomédica en Red M.P. 26/10/2018
Gemfibrozil EU/3/18/1993 Treatment of neuronal ceroid lipofuscinosis IQVIA RDS Ireland Limited 21/03/2018
Gemtuzumab Ozogamicin EU/3/00/005 Treatment of acute myeloid leukaemia Pfizer Europe MA EEIG 18/10/2000 Mylotarg
Genetically modified adeno-associated viral vector serotype 9 expressing shRNA as well as a codon-optimized shRNA-insensitive wildtype PABPN1 EU/3/16/1816 Treatment of oculopharyngeal muscular dystrophy Clinipace GmbH 12/01/2017
Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) EU/3/06/405 Treatment of renal cell carcinoma MOLOGEN AG 23/10/2006
Genetically modified human adenovirus encoding human PH20 hyaluronidase EU/3/11/880 Treatment of pancreatic cancer VCN Biosciences S.L. 21/06/2011
Genetically modified Lactococcus lactis bacteria containing the human trefoil factor 1 gene EU/3/11/903 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Intrexon Actobiotics N.V. 27/09/2011
Genetically modified replication-incompetent herpes simplex virus-1 expressing collagen VII EU/3/18/2012 Treatment of epidermolysis bullosa IDEA Innovative Drug European Associates Limited 16/04/2018
Genetically modified serotype 5/3 adenovirus coding for granulocyte macrophage colony-stimulating factor EU/3/14/1265 Treatment of ovarian cancer Targovax Oy 29/04/2014
Genetically modified serotype 5/3 adenovirus coding for granulocyte macrophage colony-stimulating factor EU/3/14/1398 Treatment of malignant mesothelioma Targovax Oy 16/12/2014
Genetically modified serotype 5/3 adenovirus coding for granulocyte-macrophage colony-stimulating factor EU/3/13/1145 Treatment of soft tissue sarcoma Targovax Oy 19/06/2013
Genistein sodium salt dihydrate EU/3/12/980 Treatment of mucopolysaccharidosis type III (Sanfilippo syndrome) Axcentua Pharmaceuticals AB 2/04/2012
Gilteritinib EU/3/17/1961 Treatment of acute myeloid leukaemia Astellas Pharma Europe B.V. 17/01/2018
Gimatecan EU/3/03/174 Treatment of glioma Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 1/12/2003
Givinostat EU/3/09/719 Treatment of polycythaemia vera Italfarmaco S.p.A. 3/02/2010
Givinostat EU/3/12/1009 Treatment of Duchenne muscular dystrophy Italfarmaco S.p.A. 4/07/2012
Givinostat EU/3/18/2046 Treatment of Becker muscular dystrophy Italfarmaco S.p.A. 31/07/2018
Glasdegib maleate EU/3/17/1923 Treatment of acute myeloid leukaemia Pfizer Europe MA EEIG 16/10/2017
Glibenclamide EU/3/15/1589 Treatment of neonatal diabetes AMMTeK 15/01/2016 AMGLIDIA
Glucagon EU/3/12/960 Treatment of congenital hyperinsulinism Biodel UK Limited 5/03/2012
Glucagon EU/3/14/1342 Treatment of congenital hyperinsulinism S-cubed Ltd 15/10/2014
Glucagon EU/3/18/2091 Treatment of noninsulinoma pancreatogenous hypoglycaemia syndrome Pharma Gateway AB 19/11/2018
Glucagon analogue linked to a human immunoglobulin Fc fragment EU/3/18/2022 Treatment of congenital hyperinsulinism Hanmi Europe Limited 25/05/2018
Glucopyranosyl lipid A EU/3/17/1924 Treatment of follicular lymphoma Immune Design Ltd 16/10/2017
Glucopyranosyl lipid A stable emulsion and recombinant New York esophageal squamous cell carcinoma-1 protein EU/3/16/1634 Treatment of soft tissue sarcoma Immune Design Ltd 21/03/2016
Glufosfamide EU/3/11/851 Treatment of pancreatic cancer Theradex (Europe) Ltd 15/04/2011
[gly2] Recombinant human glucagon-like peptide EU/3/01/077 Treatment of Short Bowel Syndrome Shire Pharmaceuticals Ireland Limited 11/12/2001 Revestive
Glyceryl tri-(4-phenylbutyrate) EU/3/10/733 Treatment of carbamoyl-phosphate synthase-1 deficiency Horizon Pharma Ireland Limited 10/06/2010 Ravicti
Glyceryl tri-(4-phenylbutyrate) EU/3/10/734 Treatment of ornithine carbamoyltransferase deficiency Horizon Pharma Ireland Limited 10/06/2010 Ravicti
Glyceryl tri-(4-phenylbutyrate) EU/3/10/735 Treatment of citrullinaemia type 1 Horizon Pharma Ireland Limited 10/06/2010 Ravicti
Glyceryl tri-(4-phenylbutyrate) EU/3/10/736 Treatment of argininosuccinic aciduria Horizon Pharma Ireland Limited 10/06/2010 Ravicti
Glyceryl tri-(4-phenylbutyrate) EU/3/10/737 Treatment of hyperargininaemia Horizon Pharma Ireland Limited 10/06/2010 Ravicti
Glyceryl tri-(4-phenylbutyrate) EU/3/10/738 Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Horizon Pharma Ireland Limited 10/06/2010 Ravicti
Glyceryl tri-(4-phenylbutyrate) EU/3/10/739 Treatment of citrullinaemia type 2 Horizon Pharma Ireland Limited 10/06/2010
Glycine, L-alanine, L-arginine, L-aspartic acid, L-cysteine, L-cystine, L-glutamic acid, L-histidine, L-lysine monohydrate, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine, taurine EU/3/18/2076 Treatment of maple syrup urine disease Orphan Europe S.A.R.L. 26/10/2018
Glycosylation independent lysosomal targeting tagged recombinant human acid alpha glucosidase EU/3/11/921 Treatment of glycogen storage disease type II (Pompe's disease) BioMarin Europe Ltd 27/10/2011
Glycyl-L-2-methylprolyl-L-glutamic acid EU/3/15/1529 Treatment of fragile X syndrome QRC Consultants Ltd 28/07/2015
Glycyl-L-2-methylprolyl-L-glutamic acid EU/3/15/1534 Treatment of Rett syndrome QRC Consultants Ltd 10/08/2015
Granulocyte macrophage colony stimulating factor EU/3/13/1147 Treatment of pulmonary alveolar proteinosis Savara ApS 17/07/2013
Guanabenz EU/3/09/625 Treatment of traumatic spinal cord injury Acure Pharma AB 29/04/2009
Gusperimus trihydrochloride EU/3/01/034 Treatment of Wegener’s granulomatosis Nordic Group B.V. 29/03/2001
Haematopoietic stem cells modified with a lentiviral vector containing the CD18 gene EU/3/16/1753 Treatment of leukocyte adhesion deficiency type I Consorcio Centro de Investigación Biomédica en Red M.P. 14/10/2016
Halofuginone Hydrobromide EU/3/01/074 Treatment of systemic sclerosis PPD Global Ltd 11/12/2001
Halofuginone Hydrobromide EU/3/12/988 Treatment of Duchenne muscular dystrophy Biological Consulting Europe Ltd 26/04/2012
H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt EU/3/07/521 Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients Vaxon Biotech 18/12/2007
H-Arg-Pro-Lys-Pro-Gln-Gln-Phe-2Thi-Gly-Leu-Met(O2)-NH2-DOTA-213-bismuth EU/3/18/2092 Treatment of glioma Dr Regenold GmbH 19/11/2018
H-Arg-Pro-Lys-Pro-Gln-Gln-Phe-2Thi-Gly-Leu-Met(O2)-NH2-DOTA-225-actinium EU/3/18/2023 Treatment of glioma Dr Regenold GmbH 25/05/2018
H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 EU/3/05/292 Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Auris Medical Limited 16/06/2005
Heat-killed Mycobacterium obuense (whole cell) EU/3/14/1385 Treatment of pancreatic cancer Immodulon Therapeutics Ltd 16/12/2014
Heat-killed Mycobacterium vaccae (whole cell) EU/3/10/786 Treatment of tuberculosis Immodulon Therapeutics Ltd 20/09/2010
Heparin sodium EU/3/06/371 Treatment of cystic fibrosis Ockham Biotech Limited 22/05/2006
Heparin-activated recombinant human fibroblast growth factor 1 (on a biodegradable device made from alpha-calcium sulphate hemihydrate) EU/3/10/754 Treatment of traumatic spinal cord injury Bioarctic AB 27/07/2010
Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 EU/3/06/407 Prevention of necrotizing enterocolitis Dr Michael Moore 31/10/2006
Hepatitis C Immunoglobulin EU/3/05/295 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 8/07/2005
Herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes EU/3/03/168 Adjunctive treatment in hematopoietic cell transplantation MolMed S.p.A. 20/10/2003 Zalmoxis
Herpes simplex type 1 virus containing cellular B-myb gene as tumour-specific promoter EU/3/14/1412 Treatment of pancreatic cancer Karcinolys S.A.S 15/01/2015
Herpes simplex virus lacking infected cell protein 34.5 EU/3/03/153 Treatment of glioma Virttu Biologics Limited 9/07/2003
Heterologous human adult liver derived stem cells EU/3/07/506 Treatment of Crigler-Najjar syndrome Promethera Biosciences 29/11/2007
Heterologous human adult liver derived stem cells EU/3/08/530 Treatment of ornithinine transcarbamylase deficiency Promethera Biosciences 4/02/2008
Heterologous human adult liver-derived progenitor cells EU/3/13/1161 Treatment of carbamoyl-phosphate synthase-1 deficiency Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1162 Treatment of citrullinaemia type 1 Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1163 Treatment of argininosuccinic aciduria Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1164 Treatment of hyperargininaemia Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1165 Treatment of N-acetylglutamate synthetase (NAGS) deficiency Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1166 Treatment of citrullinaemia type 2 Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1167 Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived stem cells EU/3/11/904 Treatment of ornithine transcarbamylase deficiency Fresenius Medical Care Deutschland GmbH 27/09/2011
Heterologous human adult liver-derived stem cells EU/3/12/971 Treatment of carbamoyl-phosphate synthase-1 deficiency Fresenius Medical Care Deutschland GmbH 5/03/2012
Heterologous human adult liver-derived stem cells EU/3/12/983 Treatment of acute liver failure Fresenius Medical Care Deutschland GmbH 26/04/2012
Hexasodium phytate EU/3/12/1026 Treatment of calciphylaxis Laboratoris Sanifit S.L. 17/07/2012
HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor EU/3/04/202 Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients Cellcure A/S 21/06/2004
HLA-B27 derived peptide (amino acid 125-138) EU/3/04/219 Treatment of autoimmune uveitis Dr Gerhild Wildner 2/09/2004
H-Phe-Ser-Arg-Tyr-Ala-Arg-OH acetate EU/3/16/1662 Treatment of amyotrophic lateral sclerosis QRC Ireland 30/05/2016
Human allogeneic bone marrow derived osteoblastic-like cells EU/3/13/1176 Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 5/08/2013
Human allogeneic bone-marrow-derived osteoblastic cells EU/3/15/1533 Treatment of osteogenesis imperfecta Bone Therapeutics SA 10/08/2015
Human Alpha1-Proteinase Inhibitor (respiratory use) EU/3/01/044 Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency CSL Behring GmbH 9/07/2001
Human anti-intercellular adhesion molecule1 monoclonal antibody EU/3/08/600 Treatment of multiple myeloma BioInvent International AB 20/01/2009
Human anti-promyostatin monoclonal antibody EU/3/18/2115 Treatment of spinal muscular atrophy Yes Pharmaceutical Development Services GmbH 14/12/2018
Human apotransferrin EU/3/12/1027 Treatment of congenital hypotransferrinaemia Sanquin Plasma Products B.V. 17/07/2012
Human apotransferrin EU/3/18/2093 Treatment of beta-thalassaemia intermedia and major Sanquin Plasma Products B.V. 19/11/2018
Human autologous bone-forming cells derived from bone marrow stem cells EU/3/07/490 Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 29/10/2007
Human autologous mesenchymal adult stem cells extracted from adipose tissue EU/3/05/303 Treatment of anal fistula TiGenix S.A.U. 26/08/2005
Human coagulation factor X EU/3/07/471 Treatment of hereditary factor X deficiency Bio Products Laboratory Ltd 17/09/2007 Coagadex
Human cytomegalovirus immunoglobulin EU/3/06/408 Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Biotest Pharma GmbH 31/10/2006
Human donor haematopoietic stem and progenitor cells that have been treated ex vivo with the protein transduction domain of the HIV-1 transactivation protein fused to MYC transcription factor EU/3/16/1817 Treatment in haematopoietic stem cell transplantation IQVIA RDS Ireland Limited 12/01/2017
Human embryonic stem-cell-derived retinal pigment epithelial cells EU/3/11/874 Treatment of Stargardt’s disease Astellas Pharma Europe B.V. 21/06/2011
Human erythrocytes encapsulating inositol hexaphosphate EU/3/12/1008 Treatment of sickle cell disease ERYtech Pharma S.A. 4/07/2012
Human glucagon-like peptide-2 analogue linked to a human immunoglobulin Fc fragment EU/3/18/2126 Treatment of short bowel syndrome Hanmi Europe Limited 11/01/2019
Human haptoglobin EU/3/11/936 Treatment of sickle cell disease Bio Products Laboratory Ltd 9/12/2011
Human hemin EU/3/13/1149 Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Borders Technology Management Ltd 17/07/2013
Human hepatoma cell line HepaRG in bioartificial liver EU/3/16/1818 Treatment of acute liver failure Hep-Art Medical Devices BV 12/01/2017
Human heterologous liver cells (for infusion) EU/3/06/362 Treatment of acute liver failure Promethera Biosciences 11/04/2006
Human heterologous liver cells (for infusion) EU/3/07/470 Treatment of ornithine-transcarbamylase deficiency Promethera Biosciences 14/09/2007
Human heterologous liver cells (for infusion) EU/3/10/818 Treatment of citrullinaemia type 1 Promethera Biosciences 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/819 Treatment of hyperargininaemia Promethera Biosciences 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/820 Treatment of argininosuccinic aciduria Promethera Biosciences 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/821 Treatment of carbamoyl-phosphate synthase-1 deficiency Promethera Biosciences 17/12/2010
Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein EU/3/05/334 Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) Edimer Ltd 14/12/2005
Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) EU/3/06/417 Treatment of renal cell carcinoma Immunservice GmbH 27/10/2006
Human MHC non-restricted cytotoxic T-cell line EU/3/09/696 Treatment of ovarian cancer Galileo Research S.r.l. 30/11/2009
Human monoclonal antibody against activin A EU/3/16/1779 Treatment of fibrodysplasia ossificans progressiva Regeneron Ireland U.C. 18/11/2016
Human monoclonal antibody against CD4 EU/3/04/198 Treatment of cutaneous T-cell lymphoma TenX Biopharma Ltd 14/04/2004
Human monoclonal antibody against Fas ligand EU/3/12/956 Treatment of pemphigus PinCell s.r.l. 9/02/2012
Human monoclonal antibody against human interleukin 13 EU/3/13/1205 Treatment of eosinophilic oesophagitis Novartis Europharm Limited 13/11/2013
Human monoclonal antibody against Pseudomonas aeruginosa IATS-O1 EU/3/09/705 Treatment of pneumonia caused by serotype O1 Pseudomonas aeruginosa Envestia Limited 28/01/2010
Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 EU/3/06/381 Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa Envestia Limited 29/06/2006
Human monoclonal antibody targeting Staphylococcus aureus alpha-toxin EU/3/12/968 Treatment of pneumonia caused by Staphylococcus aureus Global Regulatory Limited 5/03/2012
Human monoclonal IgG1 antibody against tissue factor pathway inhibitor EU/3/16/1752 Treatment of haemophilia A Pfizer Europe MA EEIG 14/10/2016
Human monoclonal IgG2 antibody against tissue factor pathway inhibitor EU/3/18/1979 Treatment of haemophilia A Bayer AG 22/02/2018
Human/murine chimeric monoclonal antibody against endoglin EU/3/16/1648 Treatment of soft tissue sarcoma Tracon Pharma Limited 28/04/2016
Human normal immunoglobulin EU/3/17/1866 Treatment in solid organ transplantation Hôpital Foch 20/04/2017
Human papilloma virus type 16 E6/E7 synthetic long peptides EU/3/07/520 Treatment of epithelial neoplasia of the vulva positive for human papilloma virus ISA Therapeutics B.V. 20/12/2007
Human plasma-derived alpha-1 proteinase inhibitor EU/3/15/1455 Treatment of graft-versus-host disease Kamada BioPharma Limited 19/03/2015
Human plasminogen EU/3/07/461 Treatment of ligneous conjunctivitis Kedrion S.p.A. 3/08/2007
Human plasminogen EU/3/15/1511 Treatment of plasminogen deficiency ProMetic BioTherapeutics Ltd 28/07/2015
Human platelet antigen-1a immunoglobulin EU/3/11/922 Prevention of fetal and neonatal alloimmune thrombocytopenia due to human platelet antigen-1a incompatibility Prophylix Pharma AS 27/10/2011
Human reovirus type 3 Dearing strain EU/3/15/1469 Treatment of ovarian cancer Oncolytics Biotech (UK) Limited 19/03/2015
Human reovirus type 3 Dearing strain EU/3/15/1477 Treatment of pancreatic cancer Oncolytics Biotech (UK) Limited 24/04/2015
Human Staphylococcus aureus immunoglobulin EU/3/05/319 Treatment of Staphylococcus aureus bacteremia Biotest Pharma GmbH 28/10/2005
Human telomerase reverse transcriptase peptide (611-626) EU/3/06/384 Treatment of pancreatic cancer Gemvax A/S 25/07/2006
Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys EU/3/09/677 Treatment of acute lung injury Apeptico Forschung und Entwicklung GmbH 8/10/2009
Humanised anti-alpha ν beta 6 monoclonal antibody EU/3/14/1301 Treatment of idiopathic pulmonary fibrosis Biogen Idec Limited 29/07/2014
Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein EU/3/05/290 Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck Viventia Biotech (EU) Limited 20/06/2005
Humanised anti-CD37 monoclonal antibody conjugated to maytansinoid DM1 EU/3/15/1494 Treatment of diffuse large B-cell lymphoma Voisin Consulting S.A.R.L. 21/05/2015
Humanised anti-folate receptor 1 monoclonal antibody conjugated to maytansinoid DM4 EU/3/15/1458 Treatment of ovarian cancer ImmunoGen Europe Limited 19/03/2015
Humanised anti-IL-6 receptor monoclonal antibody EU/3/16/1680 Treatment of neuromyelitis optica spectrum disorders Chugai Pharma France 27/06/2016
Humanised Fc engineered monoclonal antibody against CD19 EU/3/14/1286 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma MorphoSys AG 4/07/2014
Humanised Fc engineered monoclonal antibody against CD19 EU/3/14/1424 Treatment of diffuse large B-cell lymphoma MorphoSys AG 15/01/2015
Humanised Fc-engineered monoclonal antibody against CD19 EU/3/17/1962 Treatment of IgG4-related disease MWB Consulting S.A.R.L. 17/01/2018
Humanised fusion protein consisting of extracellular domain of CD24 linked to IgG1 Fc domain EU/3/15/1575 Prevention of graft-versus-host disease Enpharma Ltd 11/11/2015
Humanised IgG1 kappa antibody against serum amyloid A and AL amyloid EU/3/13/1100 Treatment of amyloid light-chain amyloidosis Prothena Therapeutics Limited 8/02/2013
Humanised IgG1 monoclonal antibody against human eotaxin-2 EU/3/14/1371 Treatment of systemic sclerosis FGK Representative Service GmbH 19/11/2014
Humanised IgG1 monoclonal antibody against human KIR3DL2 EU/3/14/1322 Treatment of cutaneous T-cell lymphoma Innate Pharma S.A. 22/08/2014
Humanised IgG1 monoclonal antibody against the receptor-binding site of human placental growth factor EU/3/16/1819 Treatment of medulloblastoma Oncurious NV 12/01/2017
Humanised IgG4 monoclonal antibody against extracellular tau EU/3/15/1522 Treatment of progressive supranuclear palsy Biogen Idec Limited 28/07/2015
Humanised IgG4 monoclonal antibody against total complement component 1, subcomponent s EU/3/16/1609 Treatment of autoimmune haemolytic anaemia Celerion United Kingdom Limited 17/02/2016
Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 EU/3/09/638 Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation Opsona Therapeutics Limited 15/05/2009
Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 EU/3/17/1837 Treatment of myelodysplastic syndromes Opsona Therapeutics Limited 27/02/2017
Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 EU/3/17/1838 Treatment of pancreatic cancer Opsona Therapeutics Limited 27/02/2017
Humanised monoclonal antibody against CD38 EU/3/14/1268 Treatment of plasma cell myeloma Sanofi-Aventis groupe 29/04/2014
Humanised monoclonal antibody against myostatin EU/3/13/1105 Treatment of Duchenne muscular dystrophy Pfizer Europe MA EEIG 8/02/2013
Humanised monoclonal antibody against P-selectin EU/3/12/1034 Treatment of sickle cell disease Novartis Europharm Limited 9/08/2012
Humanised monoclonal antibody of the IgG4 kappa isotype targeting CD47 EU/3/15/1582 Treatment of acute myeloid leukaemia ICON Clinical Research Limited 11/11/2015
Humanised monoclonal antibody targeting B-cell maturation antigen conjugated with maleimidocaproyl monomethyl auristatin F EU/3/17/1925 Treatment of multiple myeloma GlaxoSmithKline Trading Services Limited 16/10/2017
Humanised monoclonal antibody targeting interleukin-15 EU/3/16/1681 Treatment of eosinophilic oesophagitis Calypso Biotech B.V. 27/06/2016
Humanised monoclonal antibody to the folate receptor alpha EU/3/08/535 Treatment of ovarian cancer Eisai GmbH 1/04/2008
Humanised monoclonal IgG4 antibody against tissue factor pathway inhibitor EU/3/12/1052 Treatment of haemophilia A Novo Nordisk A/S 10/10/2012
Humanised recombinant IgG4 anti-human tau antibody EU/3/16/1649 Treatment of progressive supranuclear palsy AbbVie Deutschland GmbH & Co. KG 28/04/2016
Humanised recombinant monoclonal antibody against epidermal growth factor receptor conjugated to maleimidocaproyl monomethylauristatin F EU/3/14/1305 Treatment of glioma AbbVie Deutschland GmbH & Co. KG 29/07/2014
Humanised single chain monoclonal antibody against CD37 EU/3/12/1083 Treatment of chronic lymphocytic leukaemia Global Regulatory Limited 6/12/2012
Humanized Agonistic Anti-CD28 Monoclonal Antibody EU/3/05/276 Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) TeGenero AG 11/04/2005
Hydrocinnamate-[Orn-Pro-dCha-Trp-Arg]acetate EU/3/15/1527 Treatment of amyotrophic lateral sclerosis PBS Regulatory Consulting Group Limited 28/07/2015
Hydrocortisone (modified release tablet) EU/3/05/296 Treatment of congenital adrenal hyperplasia Diurnal Limited 27/07/2005
Hydrocortisone (modified release tablet) EU/3/06/372 Treatment of adrenal insufficiency Shire Services BVBA 22/05/2006 Plenadren
Hydrocortisone (modified release tablet) EU/3/07/441 Treatment of adrenal insufficiency Diurnal Limited 20/03/2007
Hydroxychloroquine EU/3/16/1820 Treatment of antiphospholipid syndrome Centre Hospitalier Universitaire d'Angers 12/01/2017
Hydroxychloroquine sulphate EU/3/17/1963 Treatment of LIPIN1 disease Professor Pascale De Lonlay 17/01/2018
Hydroxy-propyl-beta-cyclodextrin EU/3/11/895 Treatment of Niemann-Pick disease, type C Alan Boyd Consultants Ltd 30/08/2011
Hypothiocyanite / lactoferrin EU/3/09/654 Treatment of cystic fibrosis Alaxia 24/07/2009
Ibrutinib EU/3/13/1203 Treatment of diffuse large B-cell lymphoma Janssen-Cilag International NV 13/11/2013
Ibrutinib EU/3/13/1212 Treatment of follicular lymphoma Janssen-Cilag International NV 18/12/2013
Ibrutinib EU/3/14/1264 Treatment of lymphoplasmacytic lymphoma Janssen-Cilag International NV 29/04/2014 IMBRUVICA
Ibrutinib EU/3/15/1541 Treatment of marginal zone lymphoma Janssen-Cilag International NV 10/08/2015
Ibrutinib EU/3/16/1780 Treatment of graft-versus-host disease Janssen-Cilag International NV 18/11/2016
Ibudilast EU/3/16/1801 Treatment of amyotrophic lateral sclerosis MediciNova (Europe) Limited 12/12/2016
Ibutamoren mesilate EU/3/17/1882 Treatment of growth hormone deficiency Richardson Associates Regulatory Affairs Ltd 20/06/2017
Icatibant acetate EU/3/03/133 treatment of angioedema Shire Pharmaceuticals Ireland Limited 17/02/2003 Firazyr
Idebenone EU/3/01/062 Treatment of Friedreich’s ataxia Laboratoires Takeda 20/11/2001
Idebenone EU/3/04/189 Treatment of Friedreich’s ataxia Santhera Pharmaceuticals (Deutschland) GmbH 8/03/2004
Idebenone EU/3/07/434 Treatment of Leber's hereditary optic neuropathy Santhera Pharmaceuticals (Deutschland) GmbH 15/02/2007 Raxone
Idebenone EU/3/07/437 Treatment of Duchenne muscular dystrophy Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2007
IL-12-secreting dendritic cells, loaded with autologous tumour lysate EU/3/12/1058 Treatment of glioma Activartis Biotech GmbH 8/11/2012
Ile-Ser-Ile-Thr-Glu-Ile-Lys-Gly-Val-Ile-Val-His-Arg-Ile-Glu-Thr-Ile-Leu-Phe-Lys-Lys-Lys-Lys-Glu-Met-Pro-Ser-Glu-Glu-Gly-Tyr-Gln-Asp EU/3/18/2095 Treatment of multiple system atrophy United Neuroscience Limited 19/11/2018
Imatinib EU/3/14/1357 Treatment of acute respiratory distress syndrome Exvastat Limited 19/11/2014
Imetelstat sodium EU/3/15/1593 Treatment of myelofibrosis Janssen-Cilag International NV 14/12/2015
Imexon EU/3/05/341 Treatment of ovarian cancer ICON Clinical Research (U.K.) Limited 23/12/2005
Imlifidase EU/3/18/2096 Treatment of anti-glomerular basement membrane disease Hansa Medical AB 19/11/2018
Immortalised human C3A hepatoblastoma cells EU/3/13/1143 Treatment of acute liver failure Vital Therapies Limited 19/06/2013
Immunoglobulin G1, anti-(human tumour-associated calcium signal transducer 2)(human-Mus musculus monoclonal hRS7 heavy chain), disulfide with human-Mus musculus monoclonal hRS7 k-chain, dimer, hexakis(thioether) with (4S)-4-[[[[4-[[(2S)-2-(4-aminobutyl)-2-[[2-[2-[[26-[4-[[[[4-[(3-mercapto-2,5-dioxo-1-pyrrolidinyl)methyl]cyclohexyl]carbonyl]amino]methyl]-1H-1,2,3-triazol-1-yl]-3,6,9,12,15,18,21,24-octaoxahexacos-1-yl]amino]-2-oxoethoxy]acetyl]amino]-1-oxoethyl]amino]phenyl]methoxy]carbonyl]oxy]-4,11-diethyl-9-hydroxy-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14(4H,12H)-dione EU/3/14/1343 Treatment of pancreatic cancer Immunomedics GmbH 15/10/2014
Inebilizumab EU/3/17/1856 Treatment of neuromyelitis optica spectrum disorders Quality Regulatory Clinical Ireland Ltd 20/03/2017
Inecalcitol EU/3/13/1223 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Hybrigenics SA 16/01/2014
Inecalcitol EU/3/15/1523 Treatment of acute myeloid leukaemia Hybrigenics SA 28/07/2015
Inolimomab EU/3/01/028 Treatment of Graft versus Host Disease Elsalys Biotech SA 5/03/2001
Inotuzumab ozogamicin EU/3/13/1127 Treatment of B-cell acute lymphoblastic leukaemia Pfizer Europe MA EEIG 7/06/2013 Besponsa
Insulin human EU/3/15/1532 Treatment of short bowel syndrome Sirius Regulatory Consulting EU Limited 10/08/2015
Interferon alfa-n3 EU/3/15/1568 Treatment of Middle East respiratory syndrome NV Hemispherx BioPharma Europe 11/11/2015
Interferon beta EU/3/07/505 Treatment of acute respiratory distress syndrome Faron Pharmaceuticals Limited 29/11/2007
Interferon gamma EU/3/07/491 Treatment of idiopathic pulmonary fibrosis mondoBIOTECH Laboratories AG 29/10/2007
Interferon gamma EU/3/11/935 Treatment of Friedreich's ataxia Horizon Pharma Ireland Limited 9/12/2011
Iodine (131I) iobenguane EU/3/07/525 Treatment of neuroblastoma Molecular Insight Limited 31/01/2008
Iodine (131I) murine IgG1 monoclonal antibody against CD276 EU/3/17/1839 Treatment of neuroblastoma Y-mAbs Therapeutics A/S 27/02/2017
Isavuconazonium sulfate EU/3/14/1276 Treatment of mucormycosis Basilea Medical Ltd 4/06/2014 Cresemba
Isavuconazonium sulfate EU/3/14/1284 Treatment of invasive aspergillosis Basilea Medical Ltd 4/07/2014 Cresemba
Itacitinib EU/3/17/1964 Treatment of graft-versus-host disease Incyte Biosciences Distribution B.V. 17/01/2018
Itraconazole EU/3/17/1901 Treatment of naevoid basal-cell carcinoma syndrome (Gorlin syndrome) Mayne Pharma UK Limited 23/08/2017
Itraconazole EU/3/18/2024 Prevention of invasive aspergillosis Galephar M/F 25/05/2018
Ivacaftor, N-(1,3-dimethyl-1H-pyrazole-4-sulfonyl)-6-[3-(3,3,3-trifluoro-2,2-dimethylpropoxy)-1H-pyrazol-1-yl]-2-[(4S)-2,2,4-trimethylpyrrolidin-1-yl]pyridine-3-carboxamide, tezacaftor EU/3/18/2116 Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 14/12/2018
Ivacaftor, potassium(benzenesulfonyl)({[6-(3-{2-[1-(trifluoromethyl) cyclopropyl]ethoxy}-1H-pyrazol-1-yl)-2-[(4S)-2,2,4-trimethylpyrrolidin-1-yl]pyridin-3-yl]carbonyl})azanide, tezacaftor EU/3/18/2117 Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 14/12/2018
Ivosidenib EU/3/16/1802 Treatment of acute myeloid leukaemia FGK Representative Service GmbH 12/12/2016
Ivosidenib EU/3/18/1994 Treatment of biliary tract cancer Quality Regulatory Clinical Ireland Limited 21/03/2018
Ixazomib EU/3/12/1060 Treatment of systemic light chain amyloidosis Takeda Pharma A/S 8/11/2012
Ketoconazole EU/3/12/965 Treatment of Cushing’s syndrome Laboratoire HRA Pharma 23/04/2012 Ketoconazole HRA
Ketoconazole EU/3/12/1031 Treatment of Cushing’s syndrome Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare 9/08/2012
Ketoconazole EU/3/17/1857 Treatment of granulosa cell tumours Grupo Español de Tumores Huérfanos e Infrecuentes (GETHI) 20/03/2017
l, 1'-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane EU/3/04/227 Treatment to mobilize progenitor cells prior to stem cell transplantation Genzyme Europe B.V. 20/10/2004 Mozobil
Lactobacillus acidophilus and Bifidobacterium bifidum EU/3/13/1213 Prevention of necrotising enterocolitis Laboratorio Farmaceutico S.I.T. s.r.l. 18/12/2013
Lactobacillus reuteri EU/3/15/1436 Prevention of necrotising enterocolitis Infant Bacterial Therapeutics AB 12/02/2015
Lanreotide acetate EU/3/15/1514 Treatment of autosomal dominant polycystic kidney disease Prof. Dr R.T.Gansevoort 10/08/2015
Larotrectinib EU/3/18/1995 Treatment of salivary gland cancer Bayer AG 21/03/2018
Larotrectinib EU/3/18/2097 Treatment of glioma Bayer AG 19/11/2018
Larotrectinib EU/3/18/2098 Treatment of papillary thyroid cancer Bayer AG 19/11/2018
L-asparaginase encapsulated in erythrocytes EU/3/06/409 Treatment of acute lymphoblastic leukaemia ERYtech Pharma S.A. 27/10/2006
L-asparaginase encapsulated in erythrocytes EU/3/09/633 Treatment of pancreatic cancer ERYtech Pharma S.A. 15/05/2009
L-asparaginase encapsulated in erythrocytes EU/3/13/1106 Treatment of acute myeloid leukaemia ERYtech Pharma S.A. 8/02/2013
L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-, complex with keyhole limpet haemocyanin EU/3/11/923 Treatment of glioma Orphix Consulting GmbH 27/10/2011
L-cystine bis(N'-methylpiperazide) EU/3/18/2036 Treatment of cystinuria PharmaKrysto Ltd 27/06/2018
Lenalidomide EU/3/07/494 Treatment of chronic lymphocytic leukaemia Celgene Europe B.V. 19/11/2007
Lenalidomide EU/3/11/868 Treatment of diffuse large B-cell lymphoma Celgene Europe B.V. 13/05/2011
Lenalidomide EU/3/11/924 Treatment of mantle cell lymphoma Celgene Europe B.V. 27/10/2011 Revlimid
Lenalidomide EU/3/12/1097 Treatment of follicular lymphoma Celgene Europe B.V. 24/01/2013
Lenalidomide EU/3/15/1473 Treatment of marginal zone lymphoma Celgene Europe B.V. 24/04/2015
Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene EU/3/10/822 Treatment of Fanconi anaemia type A Consorcio Centro de Investigación Biomédica en Red M.P. 17/12/2010
Lentiviral vector containing the human ABCA4 gene EU/3/09/720 Treatment of Stargardt's disease Sanofi-Aventis groupe 2/02/2010
Lentiviral vector containing the human liver and erythroid pyruvate kinase (PKLR) gene EU/3/14/1330 Treatment of pyruvate kinase deficiency Consorcio Centro de Investigación Biomédica en Red M.P. 22/08/2014
Lentiviral vector containing the human MYO7A gene EU/3/10/727 Treatment of retinitis pigmentosa in Usher syndrome 1B Sanofi-Aventis groupe 23/03/2010
Letermovir EU/3/12/999 Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity Merck Sharp & Dohme B.V. 6/06/2012
Leuprorelin acetate EU/3/16/1821 Treatment of congenital hypogonadotropic hypogonadism Stichting Centre for Human Drug Research (CHDR) 12/01/2017
Levamisol hydrochloride EU/3/05/324 Treatment of nephrotic syndrome ACE Pharmaceuticals BV 28/10/2005
Levoglutamide EU/3/12/1011 Treatment of sickle cell disease Emmaus Medical Europe Limited 4/07/2012
Levosimendan EU/3/18/1980 Treatment of amyotrophic lateral sclerosis Orion Corporation 22/02/2018
Lipid-complexed cisplatin EU/3/13/1169 Treatment of osteosarcoma Richardson Associates Regulatory Affairs Ltd 5/08/2013
Lipopolysaccharide of Ochrobactrum intermedium EU/3/11/941 Prevention of sepsis in at-risk premature infants of less than or equal to 32 weeks of gestational age Diomune S.L. 11/01/2012
Liposomal combination of cytarabine and daunorubicin EU/3/11/942 Treatment of acute myeloid leukaemia Jazz Pharmaceuticals Ireland Ltd 11/01/2012 Vyxeos
Liposomal mannose-1-phosphate EU/3/18/2047 Treatment of phosphomannomutase-2 congenital disorder of glycosylation Glycomine SARL 31/07/2018
Lisocabtagene maraleucel EU/3/18/2099 Treatment of primary mediastinal large-B-cell lymphoma Celgene Europe Limited 19/11/2018
Lisuride hydrogen maleate EU/3/11/869 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Sinoxa Pharma GmbH 13/05/2011
Lithium citrate tetrahydrate (in reverse-micelle formulation) EU/3/09/706 Treatment of Huntington's disease Medesis Pharma 28/01/2010
Live attenuated Listeria monocytogenes bioengineered with a chimeric human epidermal growth factor receptor 2 fused to a truncated form of the Lm protein listeriolysin O EU/3/15/1595 Treatment of osteosarcoma IQVIA RDS Ireland Limited 14/12/2015
Live attenuated Listeria monocytogenes delta actA/delta inlB strain expressing human mesothelin EU/3/15/1594 Treatment of malignant mesothelioma Aduro Biotech Holdings, Europe B.V. 14/12/2015
Live attenuated Listeria monocytogenes delta actA/delta inlB strain expressing human mesothelin EU/3/15/1603 Treatment of pancreatic cancer Aduro Biotech Holdings, Europe B.V. 11/01/2016
Live attenuated Listeria monocytogenes transfected with plasmids encoding the HPV-16E7 protein fused to a truncated fragment of the Lm protein listeriolysin O EU/3/15/1602 Treatment of anal cancer Dr Ulrich Granzer 11/01/2016
Live-attenuated non-replicative Pseudomonas aeruginosa strain expressing large T antigen of Merkel cell polyomavirus EU/3/16/1781 Treatment of Merkel cell carcinoma APCure SAS 18/11/2016
L-Lysine-N-acetyl-L-cysteinate EU/3/01/026 Treatment of cystic fibrosis LABORATOIRES SMB SA 14/02/2001
Lomitapide EU/3/10/823 Treatment of familial chylomicronaemia Aegerion Pharmaceuticals Limited 17/12/2010
Lonafarnib EU/3/13/1225 Treatment of hepatitis delta virus infection Eiger Biopharmaceuticals Europe Limited 16/01/2014
Lonafarnib EU/3/18/2118 Treatment of Hutchinson-Gilford progeria syndrome Eiger Biopharmaceuticals Europe Limited 14/12/2018
Low molecular weight dextran sulfate EU/3/09/669 Prevention of graft rejection during pancreatic islet transplantation TikoMed AB 9/10/2009
Low molecular weight dextran sulfate EU/3/11/883 Treatment for mobilisation of progenitor cells prior to stem cell transplantation TikoMed AB 5/08/2011
L-Pyr-L-Glu-L-Gln-L-Leu-L-Glu-L-Arg-L-Ala-L-Leu-L-Asn-L-Ser-L-Ser EU/3/13/1191 Treatment of sarcoidosis Araim Pharma Europe Ltd 7/10/2013
L-Pyr-L-Glu-L-Gln-L-Leu-L-Glu-L-Arg-L-Ala-L-Leu-L-Asn-L-Ser-L-Ser EU/3/16/1721 Prevention of graft loss in pancreatic islet transplantation Araim Pharma Europe Ltd 29/08/2016
L-selenomethionine EU/3/16/1782 Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
L-threo-3,4-dihydroxyphenylserine EU/3/07/465 Treatment of orthostatic hypotension in patients with pure autonomic failure H. Lundbeck A/S 2/08/2007
L-threo-3,4-dihydroxyphenylserine EU/3/07/466 Treatment of orthostatic hypotension in patients with multiple system atrophy H. Lundbeck A/S 2/08/2007
Lurbinectedin EU/3/12/1053 Treatment of ovarian cancer Pharma Mar S.A. 10/10/2012
Lutetium (177Lu) edotreotide EU/3/14/1269 Treatment of gastro-entero-pancreatic neuroendocrine tumours ITM Solucin GmbH 4/06/2014
Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide EU/3/07/523 Treatment of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 31/01/2008 Lutathera
Lutetium-177(3+),S2,S7-cyclo[N-{4,7,10-tricarboxymethyl-1,4,7,10-tetraaza-cyclododecan-1-yl-acetyl}-4-chloro-L-phenylalanyl-D-cysteinyl-4-[(4S)-2,6-dioxo-1,3-diazinane-4-carboxamido]-L-phenylalanyl-4-(carbamoylamino)-D-phenylalanyl-L-lysyl-L-threonyl-L-cysteinyl-D-tyrosinamide] EU/3/16/1754 Treatment of gastro-entero-pancreatic neuroendocrine tumours Ipsen Pharma 14/10/2016
Macitentan EU/3/09/707 Treatment of idiopathic pulmonary fibrosis Janssen-Cilag International NV 28/01/2010
Macitentan EU/3/11/909 Treatment of pulmonary arterial hypertension Janssen-Cilag International NV 27/09/2011 Opsumit
Macromolecular conjugate of heparin sodium on a polymer backbone EU/3/14/1332 Prevention of ischaemia reperfusion injury associated with solid organ transplantation Corline Biomedical AB 22/08/2014
(manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21a-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-κN5, κN13, κN18, κN21, κN22]-) EU/3/07/522 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Best Regulatory Consulting Ltd 31/01/2008
Mannitolum EU/3/05/325 Treatment of cystic fibrosis Pharmaxis Pharmaceuticals Limited 7/11/2005 Bronchitol
Maribavir EU/3/07/519 Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk Shire Pharmaceuticals Ireland Limited 18/12/2007
Maribavir EU/3/13/1133 Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity Shire Pharmaceuticals Ireland Limited 7/06/2013
Marizomib EU/3/14/1295 Treatment of plasma cell myeloma Celgene Europe B.V. 29/07/2014
Marizomib EU/3/18/2119 Treatment of glioma Celgene Europe B.V. 14/12/2018
Masitinib mesilate EU/3/09/684 Treatment of pancreatic cancer AB Science S.A. 28/10/2009
Masitinib mesilate EU/3/16/1722 Treatment of amyotrophic lateral sclerosis AB Science 29/08/2016
Mavoglurant EU/3/12/1046 Treatment of fragile X syndrome Novartis Europharm Limited 10/10/2012
Mazindol EU/3/15/1547 Treatment of narcolepsy NeuroLifeSciences 9/10/2015
Mecasermin EU/3/05/307 Treatment of primary growth hormone insensitivity syndrome Ipsen Pharma 26/08/2005
Mecasermin rinfabate EU/3/06/399 Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Premacure AB 28/08/2006
Megestrol acetate EU/3/17/1858 Treatment of granulosa cell tumours Grupo Español de Tumores Huérfanos e Infrecuentes (GETHI) 20/03/2017
Melarsoprol EU/3/12/1068 Treatment of African trypanosomiasis Pr. Peter Kennedy 8/11/2012
Melatonin EU/3/12/978 Treatment of perinatal asphyxia Chiesi Farmaceutici S.p.A. 2/04/2012
Melatonin EU/3/16/1682 Treatment of necrotising enterocolitis Worphmed Srl 1/08/2016
Melatonin EU/3/16/1683 Treatment of neonatal sepsis Worphmed Srl 27/06/2016
Melatonin EU/3/16/1755 Treatment of Smith-Magenis syndrome Worphmed Srl 14/10/2016
Melatonin EU/3/18/1996 Treatment of neonatal encephalopathy Worphmed Srl 21/03/2018
Melatonin EU/3/18/2077 Treatment of acute radiation syndrome Worphmed Srl 26/10/2018
Melatonin EU/3/18/2127 Treatment of perinatal asphyxia Therapicon Srl 11/01/2019
Melphalan flufenamide EU/3/15/1463 Treatment of plasma cell myeloma Oncopeptides AB 19/03/2015
Mepolizumab EU/3/04/213 Treatment of hypereosinophilic syndrome GlaxoSmithKline Trading Services Limited 29/07/2004
Mepolizumab EU/3/13/1116 Treatment of Churg-Strauss Syndrome GlaxoSmithKline Trading Services Limited 12/03/2013
Mercaptamine-pantetheine disulfide EU/3/18/2128 Treatment of Rett syndrome Thiogenesis Therapeutics S.A.R.L 11/01/2019
Mercaptopurine (oral liquid) EU/3/07/496 Treatment of acute lymphoblastic leukaemia Orbona Pharma Ltd 22/10/2007
Mercaptopurine (oral suspension) EU/3/09/628 Treatment of acute lymphoblastic leukaemia Nova Laboratories Ireland Limited 30/04/2009 Xaluprine
Mertansine functionalised gold nanoconjugate EU/3/18/1981 Treatment of hepatocellular carcinoma Midatech Pharma Plc 22/02/2018
Metastable technetium 99 [99mTc] demogastrin 2 EU/3/06/400 Diagnosis of medullary thyroid carcinoma Biomedica Life Sciences SA 28/08/2006
Metformin EU/3/16/1803 Treatment of progressive myoclonic epilepsy type 2 (Lafora disease) Consorcio Centro de Investigación Biomédica en Red M.P. 12/12/2016
Metformin and L-citrulline EU/3/17/1965 Treatment of Duchenne muscular dystrophy Duchenne UK 17/01/2018
Methotrexate EU/3/16/1723 Treatment of alkaptonuria aimAKU (Associazione Italiana Malati di Alcaptonuria) 29/08/2016
Methotrexate (oral liquid) EU/3/07/495 Treatment of acute lymphoblastic leukaemia Orbona Pharma Ltd 24/10/2007
Methoxsalen EU/3/06/374 Treatment of Graft-versus-Host disease Therakos (UK) Limited 22/05/2006
Methyl 3-((2R)-2-hydroxy-4-(((((S)-1-methoxy-1-oxopropan-2-yl) amino)(phenoxy)phosphoryl)oxy)-3,3-dimethylbutanamido)propanoate EU/3/16/1612 Treatment of pantothenate-kinase-associated neurodegeneration Retrophin Europe Limited 17/02/2016
Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate EU/3/07/518 Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension Bayer AG 20/12/2007 Adempas
Methyl O-4-O-[2-[2-[2-[2-[[N-[(1R)-1-[[4-(aminoiminomethyl)phenyl]methyl]-2-oxo-2-(1-piperidinyl)ethyl]-N2-[(4-methoxy-2,3,6-trimethylphenyl)sulfonyl]-L-α-asparaginyl-4-aminobutanoyl-N6-[5-[(3aS,4S,6aR)-hexahydro-2-oxo-1H-thieno[3,4-d]imidazol-4-yl]-1-oxopentyl]-L-lysyl]amino]ethoxy]ethoxy]ethoxy]ethyl]-2,3-di-O-methyl-6-O-sulfo-α-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-β-D-glucopyranuronosyl-(1->4)-O-2,3,6-tri-O-sulfo-α-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-α-L-idopyranuronosyl-(1->4)-3-O-methyl-α-D-glucopyranoside 2,6-bis(hydrogen sulfate) octasodium salt EU/3/11/884 Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Endotis Pharma 5/08/2011
Methylthioninium EU/3/10/804 Treatment of progressive supranuclear palsy TauRx Therapeutics Europe Ltd 26/11/2010
Methylthioninium EU/3/10/805 Treatment of behavioural variant frontotemporal dementia TauRx Therapeutics Europe Ltd 26/11/2010
Methylthioninium EU/3/10/806 Treatment of progressive non-fluent aphasia TauRx Therapeutics Europe Ltd 26/11/2010
Methylthioninium EU/3/10/807 Treatment of frontotemporal dementia with parkinsonism-17 TauRx Therapeutics Europe Ltd 26/11/2010
Metreleptin EU/3/12/1022 Treatment of Familial Partial Lipodystrophy Aegerion Pharmaceuticals B.V. 17/07/2012 Myalepta
Metreleptin EU/3/12/1023 Treatment of Barraquer-Simons syndrome Aegerion Pharmaceuticals B.V. 17/07/2012 Myalepta
Metreleptin EU/3/12/1024 Treatment of Lawrence syndrome Aegerion Pharmaceuticals B.V. 17/07/2012 Myalepta
Metreleptin EU/3/12/1025 Treatment of Berardinelli-Seip syndrome Aegerion Pharmaceuticals B.V. 17/07/2012 Myalepta
Metronidazole EU/3/11/875 Treatment of pouchitis Avivia Projects BV 21/06/2011
Mexiletine hydrochloride EU/3/13/1126 Treatment of non-dystrophic myotonia Prof. Michael Hanna 7/06/2013
Mexiletine hydrochloride EU/3/13/1189 Treatment of myotonic disorders Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare 7/10/2013
Mexiletine hydrochloride EU/3/14/1353 Treatment of myotonic disorders Lupin Europe GmbH 19/11/2014 Namuscla
Midostaurin EU/3/04/214 Treatment of acute myeloid leukaemia Novartis Europharm Limited 29/07/2004 Rydapt
Midostaurin EU/3/10/765 Treatment of mastocytosis Novartis Europharm Limited 4/08/2010 Rydapt
Mifamurtide EU/3/16/1699 Treatment of echinococcosis Delta Proteomics SAS 14/07/2016
Mifamurtide EU/3/16/1700 Treatment of hepatocellular carcinoma Delta Proteomics SAS 14/07/2016
Mifepristone EU/3/09/614 Treatment of hypercortisolism (Cushing's syndrome) of endogenous origin EXELGYN 27/02/2009
Mifepristone EU/3/11/925 Treatment of hypercortisolism (Cushing's syndrome) of endogenous origin Dr Ulrich Granzer 27/10/2011
Miglustat EU/3/06/351 Treatment of Niemann-Pick disease, type C Janssen-Cilag International NV 16/02/2006 Zavesca
Miglustat EU/3/18/2129 Treatment of glycogen storage disease type II (Pompe's disease) Amicus Therapeutics UK Ltd 11/01/2019
Milatuzumab EU/3/08/601 Treatment of multiple myeloma Immunomedics GmbH 19/01/2009
Milatuzumab EU/3/08/602 Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 19/01/2009
Milciclib maleate EU/3/12/1059 Treatment of malignant thymoma Tiziana Life Sciences PLC 8/11/2012
Miltefosine EU/3/02/104 Treatment of visceral leishmaniasis Zentaris GmbH 12/06/2002
Miltefosine EU/3/05/282 Treatment of Acanthamoeba keratitis Orpha-Devel Handels und Vertriebs GmbH 27/05/2005
Miltefosine EU/3/08/567 Treatment of cutaneous T-cell lymphoma ExperGen Drug Development GmbH 22/09/2008
Miransertib EU/3/18/1997 Treatment of Proteus syndrome QRC Ireland 21/03/2018
Mixture of seven synthetic fragments consisting of p21 RAS peptides EU/3/11/885 Treatment of pancreatic cancer Targovax ASA 5/08/2011
Mixture of two adeno-associated viral vectors of serotype 8 containing the 5'-half sequence of human ABCA4 gene and the 3'-half sequence of human ABCA4 gene EU/3/14/1283 Treatment of Stargardt's disease Fondazione Telethon 4/07/2014
Mixture of two adeno-associated viral vectors of serotype 8 containing the 5'-half sequence of human MYO7A gene and the 3'-half sequence of human MYO7A gene EU/3/14/1282 Treatment of Usher syndrome Fondazione Telethon 4/07/2014
Modified adenovirus serotype 5/35 containing a CMV promoter-driven transgene cassette with the human transgenes for a membrane-bound CD40 ligand and full length 4-1BBL EU/3/15/1516 Treatment of pancreatic cancer Lokon Pharma AB 28/07/2015
Modified messenger ribonucleic acid encoding human argininosuccinate lyase enzyme encapsulated into lipid nanoparticles EU/3/17/1952 Treatment of argininosuccinic aciduria PhaseRx Ireland, Ltd 12/12/2017
Modified messenger ribonucleic acid encoding human ornithine transcarbamylase enzyme encapsulated into lipid nanoparticles EU/3/17/1867 Treatment of ornithine transcarbamylase deficiency PhaseRx Ireland, Ltd 20/04/2017
Modified mRNA encoding human methylmalonyl-coenzyme A mutase encapsulated into lipid nanoparticles EU/3/18/2025 Treatment of methylmalonic acidaemia Pharma Gateway AB 25/05/2018
Modified mRNA encoding the UGT1A1 protein EU/3/16/1684 Treatment of Crigler-Najjar syndrome Pharma Gateway AB 27/06/2016
Modified recombinant human C-type natriuretic peptide EU/3/12/1094 Treatment of achondroplasia BioMarin Europe Ltd 24/01/2013
Mogamulizumab EU/3/11/943 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Kyowa Kirin Holdings B.V. 11/01/2012
Mogamulizumab EU/3/16/1756 Treatment of cutaneous T-cell lymphoma Kyowa Kirin Holdings B.V. 14/10/2016 Poteligeo
Molgramostim EU/3/16/1685 Treatment of acute respiratory distress syndrome Savara ApS 27/06/2016
Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E EU/3/08/595 Treatment of anaplastic large cell lymphoma Takeda Pharma A/S 15/01/2009 ADCETRIS
Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E EU/3/08/596 Treatment of Hodgkin lymphoma Takeda Pharma A/S 15/01/2009 ADCETRIS
Moxetumomab pasudotox EU/3/13/1150 Treatment of B-lymphoblastic leukaemia/lymphoma AstraZeneca AB 17/07/2013
Multilamellar microvesicle comprising phosphatidylcholine, sphingomyelin, phosphatidylethanolamine, phosphatidylserine, phospatidylinositol and cholesterol EU/3/11/896 Treatment of cystic fibrosis Lamellar Biomedical Ltd 30/08/2011
Muramyl tripeptide phosphatidyl ethanolamine EU/3/04/206 Treatment of osteosarcoma Takeda France SAS 21/06/2004 Mepact
Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 EU/3/08/592 Treatment of hairy cell leukaemia AstraZeneca AB 4/12/2008
Murine IgM monoclonal antibody binding to alpha beta T-cell receptor EU/3/13/1113 Prevention of graft rejection following solid organ transplantation CTI Clinical Trial and Consulting Services Europe GmbH 12/03/2013
Murine monoclonal antibody against CD26 EU/3/10/808 Treatment of graft-versus-host disease ADIENNE S.r.l. 26/11/2010
Myriocin EU/3/15/1449 Treatment of retinitis pigmentosa Nanovector s.r.l. 12/02/2015
N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide EU/3/07/478 Treatment of Hodgkin lymphoma ICON Clinical Research Limited 14/09/2007
N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide EU/3/07/526 Treatment of acute myeloid leukaemia ICON Clinical Research Limited 31/01/2008
N-[(1R)-1-phenylethyl]-6-{1H-pyrazolo[3,4-d]pyrimidin-4-yl}quinazolin-2-amine EU/3/17/1868 Treatment of fragile X syndrome Sentinel Oncology Limited 20/04/2017
N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide EU/3/08/556 Treatment of cystic fibrosis Vertex Pharmaceuticals (Ireland) Limited 8/07/2008 Kalydeco
N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide EU/3/15/1560 Treatment of Duchenne muscular dystrophy FGK Representative Service GmbH 9/10/2015
N-{2-[(6-{[(2,6-dichloro-3,5-dimethoxyphenyl)carbamoyl](methyl)amino}pyrimidin-4-yl)amino]-5-(4-ethylpiperazin-1-yl)phenyl}prop-2-enamide EU/3/17/1902 Treatment of hepatocellular carcinoma Eisai GmbH 23/08/2017
N-[2,6-bis(1-methylethyl)phenyl]-N’-[[1-[4-(dimethylamino) phenyl]cyclopentyl]methyl]urea, hydrochloride salt EU/3/13/1128 Treatment of adrenocortical carcinoma Millendo Therapeutics Ltd 7/06/2013
N-[2,6-bis(1-methylethyl)phenyl]-N'-[[1-[4-(dimethylamino)phenyl]cyclopentyl]methyl]urea, hydrochloride salt EU/3/17/1967 Treatment of congenital adrenal hyperplasia Millendo Therapeutics Ltd 17/01/2018
N-(2-aminophenyl)-4-(1-[(1,3-dimethyl-1H-pyrazol-4-yl)methyl]piperidin)benzamide EU/3/17/1942 Treatment of peripheral T-cell lymphoma Celleron Therapeutics Limited 8/11/2017
N2'-Deacetyl-N2'-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody EU/3/08/593 Treatment of multiple myeloma Biotest AG 3/12/2008
N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl) amino] isonicotinamide hydrochloride EU/3/10/824 Treatment of acute myeloid leukaemia Merck KGaA 17/12/2010
N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride EU/3/09/685 Treatment of pancreatic cancer Merck KGaA 9/11/2009
N-[(2S)-5-{[(1R,2S)-2-(4-fluorophenyl)cyclopropyl]amino}-1-(4-methylpiperazin-1-yl)-1-oxopentan-2-yl]-4-(1H-1,2,3-triazol-1-yl)benzamide, bis-tosylate salt EU/3/16/1757 Treatment of myelofibrosis Imago BioSciences Ltd 14/10/2016
N-(3-(4-(3-(diisobutylamino)propyl)piperazin-1-yl)propyl)-1H-benzo[d]imidazol-2-amine disulphate salt EU/3/15/1446 Treatment of progressive supranuclear palsy AlzProtect sas 12/02/2015
N-3[[4(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl) oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) EU/3/04/188 Treatment of moderate and severe traumatic brain injury Xytis Pharmaceuticals Limited 23/02/2004
N-(4-(1-cyanocyclopentyl)phenyl)-2-(4-pyridinylmethyl)amino-3-pyridinecarboxamide methanesulfonate EU/3/17/1840 Treatment of gastric cancer Sirius Regulatory Consulting Limited 27/02/2017
N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine to be used with folic acid EU/3/12/1043 Diagnosis of positive folate receptor status in ovarian cancer Voisin Consulting S.A.R.L. 10/09/2012
N-(4-methoxyphenyl)-N,2,6-trimethylfuro[2,3-d]pyrimidin-4-amine EU/3/16/1618 Treatment of glioma FLAG Therapeutics Ltd 17/02/2016
N-(5-(6-chloro-2,2-difluorobenzo[d][1,3]dioxol-5-yl)pyrazin-2-yl)-2-fluoro-6-methylbenzamide EU/3/16/1783 Treatment of acute pancreatitis Reglntel Ltd 18/11/2016
N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide EU/3/08/568 Treatment of partial deep dermal and full thickness burn wounds Creative Antibiotics Sweden AB 22/09/2008
N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide EU/3/11/897 Treatment of tuberculosis RLM Consulting 30/08/2011
N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt EU/3/09/622 Treatment of acute myeloid leukaemia Daiichi Sankyo Europe GmbH 23/03/2009
N-(6-(2-aminophenylamino)-6-oxohexyl)-4-methylbenzamide EU/3/10/793 Treatment of Friedreich's ataxia Repligen Europe Limited 1/10/2010
N-acetyl-D-mannosamine monohydrate EU/3/16/1635 Treatment of GNE myopathy Leadiant GmbH 21/03/2016
N-acetylgalactosamine-conjugated synthetic double-stranded oligomer specific to serpin family A member 1 gene EU/3/18/2048 Treatment of congenital alpha-1 antitrypsin deficiency Pharma Gateway AB 31/07/2018
N-adamantanyl-N'-geranyl-ethylenediamine EU/3/07/479 Treatment of tuberculosis RLM Consulting 14/09/2007
Nafamostat mesilate EU/3/10/782 Treatment of cystic fibrosis Mucokinetica Ltd 20/09/2010
Naloxone hydrochloride dihydrate EU/3/12/1057 Treatment of cutaneous T-cell lymphoma Winston Laboratories Ltd 8/11/2012
Nanobody directed towards the human A1 domain of von Willebrand factor EU/3/09/629 Treatment of thrombotic thrombocytopenic purpura Ablynx N.V. 30/04/2009 Cablivi
Nanoliposomal irinotecan EU/3/11/933 Treatment of pancreatic cancer Les Laboratoires Servier 9/12/2011 Onivyde
Naptumomab estafenatox EU/3/07/480 Treatment of renal cell carcinoma Active Biotech AB 14/09/2007
N-(bromoacetyl)-3,3-dinitroazetidine EU/3/17/1966 Treatment of small cell lung cancer Sirius Regulatory Consulting EU Limited 17/01/2018
N-Butyldeoxygalactonojirimycin EU/3/12/1033 Treatment of Fabry disease Idorsia Pharmaceuticals Deutschland GmbH 9/08/2012
N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)-propyl]-carbamoyl}-methyl)-2-[2-(2-fluoro-phenyl)-ethylamino]-N-isobutyl-acetamide EU/3/14/1248 Treatment of optic neuritis Bionure Farma SL 19/02/2014
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/886 Treatment of post-polycythaemia vera myelofibrosis Gilead Sciences Ireland UC 5/08/2011
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/887 Treatment of post-essential thrombocythaemia myelofibrosis Gilead Sciences Ireland UC 5/08/2011
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/888 Treatment of primary myelofibrosis Gilead Sciences Ireland UC 5/08/2011
Nemorubicin hydrochloride EU/3/05/300 Treatment of hepatocellular carcinoma Nerviano Medical Sciences Srl 28/07/2005
NGR-human tumour necrosis factor EU/3/08/549 Treatment of malignant mesothelioma MolMed S.p.A. 3/06/2008
NGR-human tumour necrosis factor EU/3/09/686 Treatment of hepatocellular carcinoma MolMed S.p.A. 9/11/2009
NH2-Cys-Ser-Ser-Val-Thr-Ala-Trp-Thr-Thr-Gly-Cys-Gly-CONH2 EU/3/11/910 Treatment of traumatic spinal cord injury PHARMAXON 27/09/2011
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/993 Treatment of neurofibromatosis type 2 Sirius Regulatory Consulting Limited 26/04/2012
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/996 Treatment of meningioma Sirius Regulatory Consulting Limited 6/06/2012
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/997 Treatment of schwannoma Sirius Regulatory Consulting Limited 6/06/2012
Nilotinib EU/3/06/375 Treatment of chronic myeloid leukaemia Novartis Europharm Limited 22/05/2006 Tasigna
Nimodipine EU/3/15/1554 Treatment of aneurysmal subarachnoid haemorrhage Dr Stefan Blesse 9/10/2015
Nimorazole EU/3/10/842 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Azanta A/S 23/02/2011
Nimorazole maleate EU/3/12/952 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Conventia Medical LLP 9/02/2012
Nimotuzumab EU/3/08/550 Treatment of pancreatic cancer Oncoscience GmbH 3/06/2008
Nintedanib EU/3/13/1123 Treatment of idiopathic pulmonary fibrosis Boehringer Ingelheim International GmbH 26/04/2013 Ofev
Nintedanib EU/3/16/1724 Treatment of systemic sclerosis Boehringer Ingelheim International GmbH 29/08/2016
Nitisinone EU/3/02/096 Treatment of alkaptonuria Swedish Orphan Biovitrum AB (publ) 13/03/2002
Nitric oxide EU/3/13/1209 Treatment of cystic fibrosis Novoteris 18/12/2013
Nitric oxide EU/3/14/1344 Treatment of cystic fibrosis PD Dr med. Joachim Riethmüller 15/10/2014
Nitric oxide EU/3/15/1484 Treatment of cystic fibrosis Biological Consulting Europe Ltd 24/04/2015
Nitroglycerin EU/3/15/1435 Treatment of systemic sclerosis Covis Pharma S.à.r.l. 12/02/2015
[Nle4, D-Phe7]-alpha-melanocyte stimulating hormone EU/3/08/541 Treatment of erythropoietic protoporphyria Clinuvel UK Limited 8/05/2008 Scenesse
[Nle4, D-Phe7]-alpha-melanocyte stimulating hormone EU/3/08/545 Treatment of congenital erythropoietic porphyria Clinuvel UK Limited 8/05/2008
N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate EU/3/06/401 Treatment of familial amyloid polyneuropathy Pfizer Europe MA EEIG 28/08/2006 Vyndaqel
N-methyl-4-({4-[({3-methyl(methylsulfonyl)aminopyrazin-2-yl}methyl)amino]-5-(trifluoromethyl)pyrimidin-2-yl}amino)benzamide hydrochloride EU/3/13/1132 Treatment of malignant mesothelioma TMC Pharma Services Ltd 7/06/2013
N-methyl-4-({4-[({3-methyl(methylsulfonyl)aminopyrazin-2-yl}methyl)amino]-5-(trifluoromethyl)pyrimidin-2-yl}amino)benzamide hydrochloride EU/3/14/1429 Treatment of ovarian cancer TMC Pharma Services Ltd 15/01/2015
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/04/242 Treatment of mastocytosis AB Science S.A. 16/11/2004
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/04/251 Treatment of malignant gastro intestinal stromal tumours AB Science S.A. 21/12/2004
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/05/286 Treatment of multiple myeloma Dr Geoffrey Allan 20/06/2005
N,N'-bis(2-mercaptoethyl)isophthalamide EU/3/11/944 Treatment of mercury toxicity NBMI Science Limited 11/01/2012
Norursodeoxycholic acid EU/3/14/1288 Treatment of primary sclerosing cholangitis Dr Falk Pharma GmbH 4/07/2014
N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase EU/3/09/615 Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) Dr Ulrich Granzer 27/02/2009
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/794 Treatment of primary myelofibrosis Celgene Europe B.V. 1/10/2010
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/810 Treatment of post-essential thrombocythaemia myelofibrosis Celgene Europe B.V. 26/11/2010
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/811 Treatment of post-polycythaemia vera myelofibrosis Celgene Europe B.V. 26/11/2010
N-(tert-butylcarbamoyl)-5-cyano-2-((4'-(difluoromethoxy)-[1,1'-biphenyl]-3-yl)oxy)benzenesulfonamide EU/3/18/1982 Treatment of pulmonary arterial hypertension ATXA Therapeutics Limited 22/02/2018
Obeticholic acid EU/3/13/1228 Treatment of primary sclerosing cholangitis Intercept Pharma Ltd 16/01/2014
Obiltoxaximab EU/3/18/2065 Treatment of anthrax SFL Regulatory Services GmbH 24/08/2018
Obinutuzumab EU/3/12/1054 Treatment of chronic lymphocytic leukaemia Roche Registration GmbH 10/10/2012 Gazyvaro
Obinutuzumab EU/3/15/1504 Treatment of follicular lymphoma Roche Registration GmbH 19/06/2015 Gazyvaro
Octenidine dihydrochloride EU/3/10/755 Prevention of late-onset sepsis in premature infants of less than or equal to 32 weeks of gestational age Schülke & Mayr GmbH 27/07/2010
Octreotide acetate (oral use) EU/3/13/1170 Treatment of acromegaly FGK Representative Service GmbH 5/08/2013
Octreotide chloride (lipid depot solution) EU/3/09/645 Treatment of acromegaly Camurus AB 12/06/2009
Odiparcil EU/3/17/1903 Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Inventiva 23/08/2017
Ofatumumab EU/3/08/581 Treatment of chronic lymphocytic leukaemia Novartis Europharm Limited 7/11/2008 Arzerra
Ofranergene obadenovec EU/3/17/1926 Treatment of ovarian cancer Envigo Pharma Consulting Ltd 16/10/2017
Olaptesed pegol EU/3/14/1364 Treatment of glioma Noxxon Pharma AG 19/11/2014
Olaratumab EU/3/15/1447 Treatment of soft tissue sarcoma Eli Lilly Nederland B.V. 12/02/2015 Lartruvo
Oleylphosphocholine EU/3/12/964 Treatment of leishmaniasis Oblita Therapeutics 23/04/2012
Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt EU/3/05/327 Treatment of glioma Oligovax 28/10/2005
Omaveloxolone EU/3/18/2037 Treatment of Friedreich's ataxia Dr Stefan Blesse 27/06/2018
Omigapil maleate EU/3/08/540 Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). Santhera Pharmaceuticals (Deutschland) GmbH 8/05/2008
Omigapil maleate EU/3/08/544 Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency Santhera Pharmaceuticals (Deutschland) GmbH 8/05/2008
Oregovomab EU/3/02/109 Treatment of ovarian cancer ViRexx International Corp. Limited 30/07/2002
Ornithine phenylacetate EU/3/11/945 Treatment of acute liver failure Mallinckrodt Pharmaceuticals Ireland Limited 11/01/2012
Osilodrostat EU/3/14/1345 Treatment of Cushing's syndrome Novartis Europharm Limited 15/10/2014
Ovine anti-colchicine polyclonal antibody fragments EU/3/10/825 Treatment of colchicine poisoning Laboratoires SERB 17/12/2010
Ovine-specific immunoglobulin (Fab) fragments raised against Vipera berus venom EU/3/15/1548 Treatment of snakebite envenomation MicroPharm Limited 9/10/2015
Oxalobacter formigenes strain HC-1 EU/3/06/354 Treatment of primary hyperoxaluria OxThera AB 17/02/2006
Oxalobacter formigenes strain HC-1 EU/3/14/1346 Treatment of short bowel syndrome OxThera AB 15/10/2014
Oxymetazoline hydrochloride EU/3/17/1892 Treatment of spinal cord injury RDD Pharma Limited 17/07/2017
Oxytocin EU/3/14/1302 Treatment of Prader-Willi syndrome Maïthé Tauber 29/07/2014
Paclitaxel (aqueous gel) EU/3/10/846 Treatment of oesophagus carcinoma BTG plc 23/02/2011
Paclitaxel (liposomal) EU/3/06/419 Treatment of pancreatic cancer SynCore Biotechnology Europe GmbH 31/10/2006
Paclitaxel-succinate-Arg-Arg-Leu-Ser-Tyr-Ser-Arg-Arg-Arg-Phe EU/3/14/1274 Treatment of glioma Orphit 4/06/2014
Palovarotene EU/3/14/1368 Treatment of fibrodysplasia ossificans progressiva Medpace Germany GmbH 19/11/2014
Palovarotene EU/3/18/2038 Treatment of multiple osteochondromas PPD Global Ltd 27/06/2018
Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) EU/3/04/222 Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency TRX Services Limited 2/09/2004
Panobinostat EU/3/12/1063 Treatment of multiple myeloma Novartis Europharm Limited 8/11/2012 Farydak
Paquinimod EU/3/10/836 Treatment of systemic sclerosis Active Biotech AB 23/02/2011
Para-aminosalicylic acid EU/3/10/826 Treatment of tuberculosis Eurocept International B.V. 17/12/2010 Granupas
Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex EU/3/06/367 Treatment of solitary bone cysts Kuros Biosurgery International AG 11/04/2006
Particles comprised of methacrylic acid based co-polymer, cross-linked with a bi-functional cross-linker, purified to bind L-phenylalanine and L-phenylalanine containing peptides EU/3/16/1784 Treatment of hyperphenylalaninaemia MipSalus ApS 18/11/2016
pasireotide EU/3/09/670 Treatment of acromegaly Novartis Europharm Limited 8/10/2009 Signifor
pasireotide EU/3/09/671 Treatment of Cushing's disease Novartis Europharm Limited 8/10/2009 Signifor
Patidegib EU/3/18/1998 Treatment of naevoid basal-cell carcinoma syndrome (Gorlin syndrome) Blue-Reg Europe 21/03/2018
Pegunigalsidase alfa EU/3/17/1953 Treatment of Fabry disease Protalix B.V 12/12/2017
Pegylated arginine deiminase EU/3/05/289 Treatment of hepatocellular carcinoma Dr Francesco Izzo 20/06/2005
Pegylated carboxyhaemoglobin EU/3/09/698 Treatment of sickle cell disease Voisin Consulting S.A.R.L. 26/11/2009
Pegylated L-asparaginase EU/3/08/569 Treatment of acute lymphoblastic leukaemia Sigma-Tau Rare Diseases, S.A. 22/09/2008
Pegylated recombinant arginine deiminase EU/3/14/1409 Treatment of malignant mesothelioma Designerx Europe Limited c/o Olswang LLP 15/01/2015
Pegylated recombinant Erwinia chrysanthemi L-asparaginase EU/3/11/889 Treatment of acute lymphoblastic leukaemia Jazz Pharmaceuticals France SAS 5/08/2011
Pegylated recombinant factor VIII EU/3/12/995 Treatment of haemophilia A Novo Nordisk A/S 26/04/2012
Pegylated recombinant human hyaluronidase PH20 EU/3/14/1394 Treatment of pancreatic cancer Pharm Research Associates (UK) Limited 16/12/2014
Pegylated recombinant human interleukin-10 EU/3/16/1804 Treatment of pancreatic cancer Eli Lilly Nederland B.V. 12/12/2016
Pegylated recombinant phenylalanine ammonia lyase EU/3/09/708 Treatment of hyperphenylalaninaemia BioMarin International Limited 28/01/2010
Pemigatinib EU/3/18/2066 Treatment of biliary tract cancer Incyte Biosciences Distribution B.V. 24/08/2018
Pentamer formyl thiophene acetic acid EU/3/17/1883 Treatment of Creutzfeldt-Jakob disease NeuroScios GmbH 20/06/2017
Pentetrazol EU/3/15/1569 Treatment of idiopathic hypersomnia Balance Therapeutics, Limited 11/11/2015
Pentosan polysulfate sodium EU/3/14/1359 Treatment of mucopolysaccharidosis type I Plexcera Therapeutics EU Limited 19/11/2014
Pentosan polysulfate sodium EU/3/16/1663 Treatment of interstitial cystitis NextraResearch S.r.l. 30/05/2016
Pentosan polysulfate sodium EU/3/16/1822 Treatment of interstitial cystitis HV-Polysaccharides GmbH & Co. KG 12/01/2017
Peptide 144 TGF- β1 inhibitor (TSLDASIIWAMMQN) EU/3/05/326 Treatment of systemic sclerosis Digna Biotech S.L. 28/10/2005
Peptide 144 TGF- β1 inhibitor (TSLDASIIWAMMQN) EU/3/05/329 Treatment of the localised scleroderma Digna Biotech S.L. 28/10/2005
Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis EU/3/09/689 Treatment of myasthenia gravis CuraVac Europe SA 9/11/2009
Peptides YMFPNAPYL, SGQAYMFPNAPYLPSCLES, RSDELVRHHNMHQRNMTKL and PGCNKRYFKLSHLQMHSRKHTG EU/3/18/2078 Treatment of multiple myeloma Sellas Life Sciences Limited 26/10/2018
Peretinoin EU/3/11/890 Treatment of hepatocellular carcinoma Kowa Pharmaceutical Europe GmbH 5/08/2011
P-ethoxy growth factor receptor-bound protein 2 antisense oligonucleotide EU/3/16/1758 Treatment of acute myeloid leukaemia Clinical Network Services (UK) Ltd 14/10/2016
Pevonedistat EU/3/18/2120 Treatment of myelodysplastic syndromes Takeda Pharma A/S 14/12/2018
Phenylephrine Hydrochloride EU/3/01/069 Treatment of ileal pouch anal anastomosis related faecal incontinence S.L.A. Pharma (UK) Limited 20/11/2001
Phosphoinositide 3-kinase gamma peptide EU/3/17/1859 Treatment of cystic fibrosis Kither Biotech s.r.l. 20/03/2017
Phosphorothioate oligonucleotide targeted to apolipoprotein C-III EU/3/14/1249 Treatment of familial chylomicronemia syndrome Akcea Therapeutics UK Ltd 19/02/2014
Phosphorothioate oligonucleotide targeted to transthyretin EU/3/14/1250 Treatment of ATTR amyloidosis Akcea Therapeutics UK Ltd 26/03/2014 Tegsedi
Picropodophyllin EU/3/17/1904 Treatment of glioma Axelar AB 23/08/2017
Pioglitazone EU/3/14/1245 Treatment of adrenoleukodystrophy Minoryx Therapeutics S.L. 19/02/2014
Pioglitazone hydrochloride EU/3/16/1823 Treatment of sudden sensorineural hearing loss Regiomedica GmbH 12/01/2017
Pirfenidone EU/3/04/241 Treatment of idiopathic pulmonary fibrosis Roche Registration GmbH 16/11/2004 Esbriet
Plasmid DNA encoding the human cystic fibrosis transmembrane conductance regulator gene complexed with a non-viral, cationic lipid based gene transfer agent EU/3/14/1277 Treatment of cystic fibrosis Imperial Innovations Limited 4/06/2014
Plerixafor EU/3/14/1403 Treatment of WHIM syndrome Groupe d'étude des neutropénies 16/12/2014
Polatuzumab vedotin EU/3/18/2013 Treatment of diffuse large B-cell lymphoma Roche Registration GmbH 16/04/2018
Polihexanide EU/3/07/498 Treatment of Acanthamoeba keratitis S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. 14/11/2007
Poly[2-[(4-{[1-carboxy-2-(hexadecylcarbamoyl)ethyl]sulfanyl}-2,3-bis({2-[((2S)-2-(2-{[(2R)-2-carbamoyl-(2-{[(2S)-1-ethoxy-3-(3-hydroxy-4oxo-1,4-dihydropyridin-1-yl)-1-oxopropan-2-yl]carbamoyl}ethyl]sulfanyl}-3-{[(2S)-1-ethoxy-3-(3-hydroxy-4-oxo-1,4-dihydropyridin-1-yl)-1-oxopropan-2-yl]carbamoyl}propanamido)-3-(3-hydroxy-4-oxo-1,4-dihydropyridin-1-yl)propanoyl Ethyl ester) )-methoxy]acetyl}oxy)butyl)sulfanyl]-3-(hexadecylcarbamoyl)propanoic acid]-poly(ethylene glycol)-ester] EU/3/13/1220 Treatment of dengue IQVIA RDS Ireland Limited 18/12/2013
Poly-cyclodextrin-bis-cysteine-PEG3400-camptothecin-conjugate EU/3/17/1860 Treatment of ovarian cancer Viadoc Business Solutions Limited 20/03/2017
Polyethylene glycol-modified human recombinant truncated cystathionine beta-synthase EU/3/16/1664 Treatment of homocystinuria Alan Boyd Consultants Ltd 30/05/2016
Poly(oxy-1,2-ethanediyl), alpha-(carboxymethyl)-omega-methoxy-,amide with arginase 1 [cobalt cofactor] (synthetic human) (1:10), trimer EU/3/16/1701 Treatment of hyperargininaemia ERA Consulting GmbH 14/07/2016
Poly(oxy-1,2-ethanediyl),,15,15'-diester with N-acetyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-.alpha.-aspartyl-L-tryptophylglycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-L-threonyl-2-[2-(2-aminoethoxy)ethoxy]acetyl-N6-carboxy-L-lysinamide cyclic (2.fwdarw.12)-(disulfide); where two identical synthetic peptide domains are covalently linked at the ends of the polyethylene glycol chain EU/3/17/1873 Treatment of paroxysmal nocturnal haemoglobinuria Best Regulatory Consulting Ltd 22/05/2017
Polyphenyl(disodium 3-O-sulfo-beta-D-glucopyranuronate)-(1→3)-beta-D-galactopyranoside EU/3/17/1893 Treatment of anti-MAG neuropathy SFL Regulatory Services GmbH 17/07/2017
Pomalidomide EU/3/09/672 Treatment of multiple myeloma Celgene Europe B.V. 8/10/2009 Imnovid
Ponatinib hydrochloride EU/3/14/1421 Treatment of gastrointestinal stromal tumours Incyte Biosciences Distribution B.V. 15/01/2015
Pracinostat EU/3/17/1927 Treatment of acute myeloid leukaemia Helsinn Birex Pharmaceuticals Ltd 16/10/2017
Pralatrexate EU/3/07/444 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Allos Therapeutics Limited 13/04/2007
Pralatrexate EU/3/08/603 Treatment of non-papillary transitional cell carcinoma of the urinary bladder Allos Therapeutics Limited 19/01/2009
Pralatrexate EU/3/10/741 Treatment of cutaneous T-cell lymphoma Allos Therapeutics Limited 10/06/2010
Pralatrexate EU/3/10/795 Treatment of Hodgkin's lymphoma Allos Therapeutics Limited 1/10/2010
Prasterone EU/3/03/156 Treatment of adrenal insufficiency Medicom Healthcare BV 28/07/2003
Pravastatin / zoledronic acid EU/3/10/748 Treatment of Hutchinson-Gilford progeria Prenyl BIO SAS 9/06/2010
Pr-D-Cys-Met-Pip-Arg-Leu-Arg-Sar-Cys-Lys-Arg-Pro-Tyr-Tle-Leu-OH EU/3/16/1824 Treatment of perinatal asphyxia VECT-HORUS 12/01/2017
Propagermanium EU/3/18/2100 Treatment of focal segmental glomerulosclerosis Quality Regulatory Clinical Ireland Limited 19/11/2018
Propranolol EU/3/16/1805 Treatment of soft tissue sarcoma The Anticancer Fund 12/12/2016
Propranolol hydrochloride EU/3/17/1841 Treatment of von Hippel-Lindau disease Consejo Superior de Investigaciones Cientificas (CSIC) 27/02/2017
Pro-Pro-Thr-Val-Pro-Thr-Arg EU/3/14/1375 Treatment of xeroderma pigmentosum ProGeLife S.A.S. 19/11/2014
Purified bromelain EU/3/02/107 Treatment of partial deep dermal and full thickness burns MediWound Germany GmbH 30/07/2002 NexoBrid
Purified pasteurised and freeze-dried cell-wall fragments from Mycobacterium tuberculosis strain RUTI EU/3/17/1905 Treatment of tuberculosis Archivel Farma S.L. 23/08/2017
Pyrazolo[1,5-a]pyrimidine, 3-[4-chloro-2-(4-morpholinyl)-5-thiazolyl]-7-(1-ethylpropyl)-2,5-dimethyl-pyrazolo[1,3-a]pyrimidine EU/3/17/1968 Treatment of congenital adrenal hyperplasia Regintel Limited 17/01/2018
Pyridoxal 5'-phosphate EU/3/14/1347 Treatment of pyridoxamine 5'-phosphate oxidase deficiency Great Ormond Street Hospital for Children, NHS Foundation Trust 15/10/2014
Pyridoxal 5'-phosphate EU/3/18/1983 Treatment of pyridoxamine 5'-phosphate oxidase deficiency Medicure Pharma Europe Limited 22/02/2018
Pyridoxalated haemoglobin polyoxyethylene EU/3/07/463 Treatment of cardiogenic shock Curacyte AG 2/08/2007
Pyridoxine and L-pyroglutamic acid EU/3/16/1673 Treatment of fragile X syndrome FGK Representative Service Ltd 27/06/2016
(R)-1-[1-(4-acetoxy-3,3-dimethyl-2-oxo-butyl)-2-oxo-5-(pyridin-2-yl)-2,3-dihydro-1H-benzo[e][1,4]diazepin-3-yl]-3-(3-methylamino-phenyl)-urea EU/3/15/1588 Treatment of gastro-entero-pancreatic neuroendocrine tumours Trio Medicines Ltd 14/12/2015
R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H -1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea EU/3/07/452 Treatment of gastric carcinoid Trio Medicines Ltd 14/06/2007
(R)-1-(3-(aminomethyl) phenyl)-N-(5-((3-cyanophenyl)(cyclopropylmethylamino)methyl)-2-fluorophenyl)-3-(trifluoromethyl)-1H-pyrazole-5-carboxamide dihydrochloride EU/3/18/2028 Treatment of hereditary angioedema BioCryst UK Ltd 27/06/2018
(R)-2-(5-cyano-2-(6-(methoxycarbonyl)-7-methyl-3-oxo-8-(3-(trifluoromethyl)phenyl)-2,3,5,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyrimidine-5-yl)phenyl)-N,N,N-trimethylethanaminium methanesulfonate dehydrate EU/3/18/1988 Treatment of cystic fibrosis Chiesi Farmaceutici S.p.A. 22/02/2018
(R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole EU/3/07/524 Treatment of tuberculosis Otsuka Novel Products GmbH 1/02/2008 Deltyba
(R)-6-(2-fluorophenyl)-N-(3-(2-((2-methoxyethyl)amino)ethyl)phenyl)-5,6-dihydrobenzo[h]quinazolin-2-amine dihydrochloride EU/3/16/1657 Treatment of biliary tract cancer QRC Consultants Ltd 30/05/2016
Radio-iodinated (131I) anti-CD45 murine monoclonal antibody EU/3/16/1760 Treatment in haematopoietic stem cell transplantation PharmaLex UK Services Limited 14/10/2016
Ralinepag EU/3/18/2130 Treatment of pulmonary arterial hypertension Arena Pharmaceuticals Limited 11/01/2019
Raloxifene hydrochloride EU/3/10/730 Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 10/06/2010
Ramiprilat EU/3/13/1117 Treatment of Stargardt’s disease Iris Pharma 12/03/2013
Ramoplanin EU/3/01/049 Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection Vicuron Pharmaceuticals Italy srl, 9/07/2001
Raxibacumab EU/3/14/1352 Treatment of inhalation anthrax disease Emergent Countermeasures International Ltd 15/10/2014
R-azasetron besylate EU/3/16/1785 Treatment of sudden sensorineural hearing loss Sensorion 18/11/2016
R-baclofen EU/3/11/858 Treatment of fragile X syndrome Lakeside Regulatory Consulting Services Ltd 15/04/2011
Recombinant adeno-associated viral vector containing a bioengineered capsid and a codon-optimised expression cassette to drive the expression of the SQ form of a B-domain deleted human coagulation factor VIII EU/3/18/2079 Treatment of haemophilia A Spark Therapeutics Ireland Ltd 26/10/2018
Recombinant adeno-associated viral vector containing a codon-optimized Padua derivative of human coagulation factor IX cDNA EU/3/18/1999 Treatment of haemophilia B uniQure Biopharma B.V. 21/03/2018
Recombinant adeno-associated viral vector containing human acid alfa-glucosidase-gene EU/3/12/1018 Treatment of glycogen storage disease type II (Pompe's disease) Audentes Therapeutics UK Limited 4/07/2012
Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene EU/3/07/440 Treatment of congenital alpha-1 antitrypsin deficiency TMC Pharma Services Ltd 20/03/2007
Recombinant adeno-associated viral vector containing human CNGA3 gene EU/3/15/1556 Treatment of achromatopsia caused by mutations in the CNGA3 gene TMC Pharma Services Ltd 9/10/2015
Recombinant adeno-associated viral vector containing the human CNGB3 gene EU/3/13/1099 Treatment of achromatopsia caused by mutations in the CNGB3 gene TMC Pharma Services Ltd 8/02/2013
Recombinant adeno-associated viral vector containing the human retinoschisin gene EU/3/13/1107 Treatment of X-linked juvenile retinoschisis TMC Pharma Services Ltd 12/03/2013
Recombinant adeno-associated viral vector containing the human RPGR gene EU/3/16/1665 Treatment of retinitis pigmentosa caused by mutations in the RPGR gene TMC Pharma Services Ltd 30/05/2016
Recombinant adeno-associated viral vector encoding a human micro-dystrophin gene under the control of a muscle specific promoter EU/3/16/1759 Treatment of Duchenne muscular dystrophy Pharma Gateway AB 14/10/2016
Recombinant adeno-associated viral vector serotype 2/1 encoding human beta-hexosaminidase alpha and beta subunits EU/3/17/1969 Treatment of GM2 gangliosidosis University of Cambridge 17/01/2018
Recombinant adeno-associated viral vector serotype 2 carrying the gene for the human aromatic L-amino acid decarboxylase protein EU/3/16/1786 Treatment of aromatic L-amino acid decarboxylase deficiency PTC Therapeutics International Limited 18/11/2016
Recombinant adeno-associated viral vector serotype 5 carrying the gene for the human frataxin protein EU/3/17/1906 Treatment of Friedreich’s ataxia PTC Therapeutics International Limited 23/08/2017
Recombinant adeno-associated viral vector serotype 5 encoding Staphylococcus aureus Cas9 endonuclease and two guide RNAs complementary to two regions of intron 26 of the CEP290 gene EU/3/17/1928 Treatment of Leber’s congenital amaurosis Pharma Gateway AB 16/10/2017
Recombinant adeno-associated viral vector serotype 6 encoding the B-domain-deleted human factor VIII EU/3/17/1874 Treatment of haemophilia A Sangamo Therapeutics UK LTD 22/05/2017
Recombinant adeno-associated viral vector serotype 9 carrying the gene for the human E6-AP ubiquitin protein ligase EU/3/16/1651 Treatment of Angelman syndrome PTC Therapeutics International Limited 28/04/2016
Recombinant adeno-associated viral vector serotype 9 containing human iduronate-2-sulfatase gene EU/3/17/1943 Treatment of mucopolysaccharidosis type II (Hunter’s syndrome) REGENXBIO EU Limited 8/11/2017
Recombinant adeno-associated viral vector serotype 9 containing human iduronidase gene EU/3/18/2039 Treatment of mucopolysaccharidosis type I REGENXBIO EU Limited 27/06/2018
Recombinant adeno-associated viral vector serotype 9 containing the human N-alpha-acetylglucosaminidase gene EU/3/16/1825 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Abeona Therapeutics Europe SL 12/01/2017
Recombinant adeno-associated viral vector serotype S3 containing codon-optimised expression cassette encoding human coagulation factor IX variant EU/3/18/2080 Treatment of haemophilia B Freeline Therapeutics Ltd 26/10/2018
Recombinant antibody construct against human CD30 and CD16A EU/3/09/673 Treatment of Hodgkin lymphoma Affimed GmbH 9/10/2009
Recombinant antibody derivative against human CD19 and CD3 EU/3/03/175 Treatment of mantle cell lymphoma Amgen Europe B.V. 1/12/2003
Recombinant antibody derivative against human CD19 and CD3 EU/3/03/176 Treatment of chronic lymphocytic leukaemia Amgen Europe B.V. 1/12/2003
Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein EU/3/12/1038 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) AOP Orphan Pharmaceuticals AG 9/08/2012
Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein EU/3/12/1039 Treatment of cutaneous T-cell lymphoma AOP Orphan Pharmaceuticals AG 9/08/2012
Recombinant chimeric monoclonal antibody against CD20 EU/3/09/699 Treatment of chronic lymphocytic leukaemia Cambridge Regulatory Services Ltd 26/11/2009
Recombinant derivative of C3 transferase EU/3/08/563 Treatment of traumatic spinal cord injury Vertex Pharmaceuticals (Europe) Limited 5/09/2008
Recombinant dog gastric lipase EU/3/03/157 Treatment of cystic fibrosis Meristem Therapeutics S.A. 9/07/2003
Recombinant factor VIIa modified with three terminal repeats derived from the β chain of human chorionic gonadotropin EU/3/14/1312 Treatment of congenital factor VII deficiency Richardson Associates Regulatory Affairs Ltd 22/08/2014
Recombinant factor VIIa modified with three terminal repeats derived from the β chain of human chorionic gonadotropin EU/3/14/1316 Treatment of haemophilia A Richardson Associates Regulatory Affairs Ltd 22/08/2014
Recombinant factor VIIa modified with three terminal repeats derived from the β chain of human chorionic gonadotropin EU/3/14/1319 Treatment of haemophilia B Richardson Associates Regulatory Affairs Ltd 22/08/2014
Recombinant fragment of human surfactant protein-D EU/3/17/1907 Prevention of bronchopulmonary dysplasia Trimunocor Ltd 23/08/2017
Recombinant fusion protein consisting of a modified form of the extracellular domain of human activin receptor IIB linked to the human IgG1 Fc domain EU/3/14/1300 Treatment of beta-thalassaemia intermedia and major Celgene Europe B.V. 29/07/2014
Recombinant fusion protein consisting of a modified form of the extracellular domain of human activin receptor IIB linked to the human IgG1 Fc domain EU/3/14/1331 Treatment of myelodysplastic syndromes Celgene Europe B.V. 22/08/2014
Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 EU/3/07/453 Treatment of haemophilia B (congenital factor IX deficiency) Swedish Orphan Biovitrum AB (publ) 8/06/2007 ALPROLIX
Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/06/411 Prevention of Graft-versus-Host disease Apogenix AG 31/10/2006
Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/09/709 Treatment of glioma Apogenix AG 28/01/2010
Recombinant fusion protein linking coagulation factor VIIa with albumin EU/3/13/1188 Treatment of congenital factor VII deficiency CSL Behring GmbH 7/10/2013
Recombinant fusion protein linking human coagulation factor IX with human albumin EU/3/09/723 Treatment of haemophilia B CSL Behring GmbH 4/02/2010 IDELVION
Recombinant fusion protein linking human coagulation factor VIIa with human albumin EU/3/11/855 Treatment of haemophilia A CSL Behring GmbH 15/04/2011
Recombinant fusion protein linking human coagulation factor VIIa with human albumin EU/3/11/863 Treatment of haemophilia B CSL Behring GmbH 13/05/2011
Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] EU/3/08/553 Treatment of glioma Pharma Gateway AB 3/06/2008
Recombinant glycoprotein gp350 of Epstein-Barr virus EU/3/02/118 Prevention of post transplantation lympho-proliferative disorders Henogen S.A. 22/10/2002
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/248 Treatment of multiple myeloma CellGenix GmbH 21/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/249 Treatment of follicular lymphoma CellGenix GmbH 23/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/250 Treatment of mantle cell lymphoma CellGenix GmbH 21/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/09/656 Treatment of diffuse large B-cell lymphoma CellGenix GmbH 24/07/2009
Recombinant human acid alpha-glucosidase EU/3/18/2000 Treatment of glycogen storage disease type II (Pompe's disease) Amicus Therapeutics UK Ltd 21/03/2018
Recombinant human acid alpha-glucosidase conjugated with mannose-6-phosphate analogues EU/3/16/1726 Treatment of glycogen storage disease type II (Pompe’s disease) NanoMedSyn 29/08/2016
Recombinant human acid ceramidase EU/3/14/1243 Treatment of Farber disease Enzyvant Farber Ireland Limited 21/02/2014
Recombinant human acid ceramidase EU/3/15/1536 Treatment of cystic fibrosis Enzyvant Farber Ireland Limited 10/08/2015
Recombinant human acid sphingomyelinase EU/3/01/056 Treatment of Niemann-Pick disease Genzyme Europe B.V. 19/09/2001
Recombinant human ADAMTS-13 EU/3/08/588 Treatment of thrombotic thrombocytopenic purpura Baxalta Innovations GmbH 3/12/2008
Recombinant human alkaline phosphatase EU/3/14/1427 Treatment of hypophosphatasia AM-Pharma BV 15/01/2015
Recombinant human alpha 1 chain homotrimer of type VII collagen EU/3/14/1272 Treatment of epidermolysis bullosa Voisin Consulting S.A.R.L. 4/06/2014
Recombinant human alpha-1-microglobulin EU/3/14/1289 Treatment of pre-eclampsia A1M Pharma AB 4/07/2014
Recombinant human alpha-glucosidase conjugated with multiple copies of synthetic bismannose-6-phosphate-tetra-mannose glycan EU/3/14/1251 Treatment of glycogen storage disease type II (Pompe's disease) Genzyme Europe B.V. 26/03/2014
Recombinant human antibody directed against misfolded human superoxide dismutase 1 EU/3/17/1894 Treatment of amyotrophic lateral sclerosis The Medical & Regulatory Partnership Limited 17/07/2017
Recombinant human anti-interferon gamma monoclonal antibody EU/3/10/749 Treatment of haemophagocytic lymphohistiocytosis NovImmune B.V. 9/06/2010
Recombinant human apolipoprotein A-I in a complex with phospholipids EU/3/14/1314 Treatment of ATP-binding cassette transporter A1 deficiency Cerenis Therapeutics Holding SA 22/08/2014
Recombinant human apolipoprotein A-I in a complex with phospholipids EU/3/14/1315 Treatment of apolipoprotein A-I deficiency Cerenis Therapeutics Holding SA 22/08/2014
Recombinant human arylsulfatase A EU/3/10/813 Treatment of metachromatic leukodystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
Recombinant human aspartylglucosaminidase EU/3/14/1410 Treatment of aspartylglucosaminuria Chiesi Farmaceutici S.p.A. 15/01/2015
Recombinant human beta-glucuronidase EU/3/12/973 Treatment of mucopolysaccharidosis type VII (Sly syndrome) Ultragenyx Germany GmbH 21/03/2012 Mepsevii
Recombinant human bone morphogenetic protein 4 EU/3/14/1348 Treatment of glioma STEMGEN S.p.A 15/10/2014
Recombinant human C1-inhibitor EU/3/07/435 Prevention of delayed graft function after solid organ transplantation Pharming Group N.V. 20/02/2007
Recombinant human cerebral dopamine neurotrophic factor EU/3/16/1652 Treatment of amyotrophic lateral sclerosis Herantis Pharma Plc 28/04/2016
Recombinant human club cell 10 KDa protein EU/3/15/1456 Prevention of bronchopulmonary dysplasia RLM Consulting 19/03/2015
Recombinant human club cell 10 KDa protein EU/3/17/1842 Treatment of bronchiolitis obliterans syndrome EUDRAC Limited 27/02/2017
Recombinant human CXCL8 mutant EU/3/08/570 Prevention of delayed graft function after solid organ transplantation ProtAffin Biotechnologie AG 22/09/2008
Recombinant human CXCL8 mutant EU/3/13/1131 Treatment of cystic fibrosis ProtAffin Biotechnologie AG 7/06/2013
Recombinant human diamine oxidase EU/3/14/1320 Treatment of mastocytosis Medical University of Vienna 22/08/2014
Recombinant human dyskerin EU/3/12/1070 Treatment of dyskeratosis congenita Advanced Medical Projects 8/11/2012
Recombinant human ectonucleotide pyrophosphatase/phosphodiesterase 1 fused to the Fc fragment of IgG1 EU/3/18/2049 Treatment of ectonucleotide pyrophosphatase/phosphodiesterase 1 deficiency Inozyme Pharma Ireland Ltd 31/07/2018
Recombinant human elafin EU/3/09/710 Treatment of oesophagus carcinoma Proteo Biotech AG 28/01/2010
Recombinant human factor IX protein modified with three point mutations EU/3/17/1884 Treatment of haemophilia B Voisin Consulting S.A.R.L. 20/06/2017
Recombinant human galactocerebrosidase EU/3/11/911 Treatment of globoid cell leukodystrophy (Krabbe disease) Chiesi Farmaceutici S.p.A. 27/09/2011
Recombinant human glutamate oxaloacetate transaminase 1 EU/3/15/1443 Treatment of glioma Dr Regenold GmbH 12/02/2015
Recombinant human heparan N-sulfatase EU/3/08/582 Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) Shire Pharmaceuticals Ireland Limited 7/11/2008
Recombinant human hepatitis C monoclonal antibody against C4 region of E1 EU/3/07/503 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 6/12/2007
Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein EU/3/08/611 Treatment of acute liver failure Alfact Innovation SAS 11/02/2009
Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 EU/3/07/516 Treatment of acute myeloid leukaemia Xenetic Biosciences Plc 20/12/2007
Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 EU/3/10/840 Treatment of acute lymphoblastic leukaemia Xenetic Biosciences Plc 23/02/2011
Recombinant human IgG1 kappa light chain monoclonal antibody targeting plasma kallikrein EU/3/15/1551 Treatment of hereditary angioedema Shire Pharmaceuticals Ireland Limited 9/10/2015 TAKHZYRO
Recombinant human insulin receptor monoclonal antibody-fused iduronate 2-sulfatase EU/3/13/1198 Treatment of mucopolysaccharidosis type II (Hunter's syndrome) Voisin Consulting S.A.R.L. 13/11/2013
Recombinant human insulin receptor monoclonal antibody-fused-α-L-iduronidase EU/3/14/1349 Treatment of mucopolysaccharidosis type I Voisin Consulting S.A.R.L. 15/10/2014
Recombinant human interleukin-12 EU/3/16/1727 Treatment of acute radiation syndrome IQVIA RDS Ireland Limited 29/08/2016
Recombinant human interleukin-3 truncated diphtheria toxin fusion protein EU/3/15/1563 Treatment of acute myeloid leukaemia TMC Pharma Services Ltd 9/10/2015
Recombinant human interleukin-3 truncated diphtheria toxin fusion protein EU/3/15/1567 Treatment of blastic plasmacytoid dendritic cell neoplasm TMC Pharma (EU) Limited 11/11/2015
Recombinant human interleukin-7 EU/3/12/1013 Treatment of progressive multifocal leukoencephalopathy Inserm-ANRS (Agence Nationale de Recherches sur le Sida et les Hépatites Virales) 4/07/2012
Recombinant human interleukin-7 fused to a hybrid crystallisable fragment region of a human antibody EU/3/17/1875 Treatment of idiopathic CD4 lymphocytopenia NeoImmuneTech, INC., Spółka Akcyjna, Oddział w Polsce 22/05/2017
Recombinant human lecithin cholesterol acyltransferase EU/3/12/1051 Treatment of lecithin cholesterol acyltransferase deficiency AstraZeneca UK Limited 10/10/2012
Recombinant human lysosomal acid lipase EU/3/10/827 Treatment of lysosomal acid lipase deficiency Alexion Europe SAS 17/12/2010 Kanuma
Recombinant human mesencephalic astrocyte-derived neurotrophic factor EU/3/15/1486 Treatment of retinitis pigmentosa Regintel Limited 24/04/2015
Recombinant human methionine proinsulin EU/3/12/985 Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 26/04/2012
Recombinant human minibody against complement component C5 EU/3/08/571 Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system ADIENNE S.r.l. 22/09/2008
Recombinant human minibody against complement component C5 EU/3/11/926 Treatment of primary membranoproliferative glomerulonephritis ADIENNE S.r.l. 27/10/2011
Recombinant Human minibody against complement component C5 fused with RGD-motif EU/3/08/604 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation ADIENNE S.r.l. 20/01/2009
Recombinant human monoclonal antibody against hepatitis B virus EU/3/13/1156 Prevention of hepatitis B re-infection following liver transplantation inVentiv Health Germany GmbH 17/07/2013
Recombinant human monoclonal antibody against mannan-binding lectin-associated serine protease-2 EU/3/18/1984 Treatment of primary IgA nephropathy Omeros London Limited 22/02/2018
Recombinant human monoclonal antibody against mannan-binding lectin-associated serine protease-2 EU/3/18/2067 Treatment in haematopoietic stem cell transplantation Omeros London Limited 24/08/2018
Recombinant human monoclonal antibody binding to vascular adhesion protein-1 EU/3/15/1461 Treatment of primary sclerosing cholangitis Biotie Therapies Corp 19/03/2015
Recombinant human monoclonal antibody of the IgG1 kappa class against human macrophage colony-stimulating factor EU/3/14/1350 Treatment of tenosynovial giant cell tumour, localised and diffused type Novartis Europharm Limited 15/10/2014
Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class EU/3/08/605 Treatment of spinal cord injury Novartis Europharm Limited 19/01/2009
Recombinant human monoclonal antibody to insulin receptor EU/3/16/1702 Treatment of congenital hyperinsulinism XOMA UK Limited 14/07/2016
Recombinant human monoclonal IgG1 antibody against programmed death ligand-1 EU/3/15/1590 Treatment of Merkel cell carcinoma Merck Europe B.V. 14/12/2015 Bavencio
Recombinant human monoclonal IgG1 antibody for fibroblast growth factor 23 EU/3/14/1351 Treatment of X-linked hypophosphataemia Kyowa Kirin Holdings B.V. 15/10/2014 CRYSVITA
Recombinant human monoclonal IgM antibody targeting glucose-regulated protein 78 EU/3/13/1190 Treatment of plasma cell myeloma Patrys GmbH 7/10/2013
Recombinant human N-acetylgalactosamine-6-sulfatase EU/3/09/657 Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) BioMarin International Limited 24/07/2009 Vimizim
Recombinant human nerve growth factor EU/3/13/1135 Treatment of retinitis pigmentosa Dompé farmaceutici S.p.A. 7/06/2013
Recombinant human nerve growth factor EU/3/15/1586 Treatment of neurotrophic keratitis Dompé farmaceutici S.p.A. 14/12/2015 OXERVATE
Recombinant human parathyroid hormone EU/3/13/1210 Treatment of hypoparathyroidism Shire Pharmaceuticals Ireland Limited 18/12/2013 Natpar
Recombinant human pentraxin-2 EU/3/12/1020 Treatment of idiopathic pulmonary fibrosis FGK Representative Service GmbH 17/07/2012
Recombinant human pentraxin-2 EU/3/14/1358 Treatment of post-essential thrombocythaemia myelofibrosis FGK Representative Service GmbH 19/11/2014
Recombinant human pentraxin-2 EU/3/14/1365 Treatment of post-polycythaemia vera myelofibrosis FGK Representative Service GmbH 19/11/2014
Recombinant human pentraxin-2 EU/3/14/1366 Treatment of primary myelofibrosis FGK Representative Service GmbH 19/11/2014
Recombinant human placental growth factor EU/3/18/2040 Treatment of pre-eclampsia IQVIA RDS Ireland Limited 27/06/2018
Recombinant Human Porphobilinogen Deaminase EU/3/02/103 Treatment of acute intermittent porphyria Chiesi Farmaceutici S.p.A. 12/06/2002
Recombinant human proinsulin EU/3/08/612 Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 11/02/2009
Recombinant human soluble Fc-gamma receptor IIb EU/3/07/462 Treatment of idiopathic thrombocytopenic purpura Baxalta Innovations GmbH 2/08/2007
Recombinant human surfactant protein D EU/3/14/1262 Prevention of bronchopulmonary dysplasia Dr Ulrich Granzer 11/04/2014
Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein EU/3/08/594 Treatment of hypophosphatasia Alexion Europe SAS 3/12/2008 Strensiq
Recombinant human transglutaminase 1 encapsulated into liposomes EU/3/13/1130 Treatment of transglutaminase-1-deficient autosomal recessive congenital ichthyosis Westfälische Wilhelms-Universität Münster 7/06/2013
Recombinant human tripeptidyl-peptidase 1 EU/3/13/1118 Treatment of neuronal ceroid lipofuscinosis type 2 BioMarin International Limited 12/03/2013 Brineura
Recombinant human type I pancreatic elastase EU/3/13/1218 Prevention of arteriovenous access dysfunction in haemodialysis patients Proteon Therapeutics Limited 18/12/2013
Recombinant human vascular endothelial growth factor EU/3/09/711 Treatment of amyotrophic lateral sclerosis Newron Sweden AB 29/01/2010
Recombinant human α-Mannosidase EU/3/04/260 Treatment of α-Mannosidosis Chiesi Farmaceutici S.p.A. 26/01/2005 Lamzede
Recombinant humanised monoclonal IgG2 lambda antibody against human sclerostin EU/3/16/1686 Treatment of osteogenesis imperfecta Mereo Biopharma Ireland Ltd 27/06/2016
Recombinant IgG degrading enzyme of Streptococcus pyogenes EU/3/16/1826 Prevention of graft rejection following solid organ transplantation Hansa Medical AB 12/01/2017
Recombinant kallikrein inhibitor EU/3/09/712 Treatment of Netherton syndrome Dermadis S.A.S. 29/01/2010
Recombinant megakaryopoeisis-stimulating protein EU/3/05/283 Treatment of idiopathic thrombocytopenic purpura Amgen Europe B.V. 27/05/2005 Nplate
Recombinant modified human growth hormone EU/3/12/1087 Treatment of growth hormone deficiency Richardson Associates Regulatory Affairs Ltd 24/01/2013
Recombinant modified ricin toxin A-chain subunit EU/3/18/2001 Prevention of ricin poisoning Soligenix UK Ltd 21/03/2018
Recombinant modified vaccinia Ankara expressing human 5T4 EU/3/06/429 Treatment of renal cell carcinoma Oxford Biomedica (UK) Ltd 26/01/2007
Recombinant monoclonal antibody to human serum amyloid P component EU/3/14/1293 Treatment of AL amyloidosis GlaxoSmithKline Trading Services Limited 30/07/2014
Recombinant monoclonal antibody to sialic acid-binding Ig-like lectin 8 EU/3/17/1929 Treatment of mastocytosis Envestia Limited 16/10/2017
Recombinant monoclonal IgG1 antibody against T-cell immune response cDNA 7 EU/3/15/1479 Prevention of graft rejection following solid organ transplantation Nekonal S.a.r.l. 24/04/2015
Recombinant protein derived from the saliva of the Ornithodoros moubata tick EU/3/16/1687 Treatment of Guillain-Barré syndrome Akari Therapeutics Plc 27/06/2016
Recombinant protein derived from the saliva of the Ornithodoros moubata tick EU/3/16/1725 Treatment of paroxysmal nocturnal haemoglobinuria Akari Therapeutics Plc 29/08/2016
Recombinant P-selectin glycoprotein immunoglobulin EU/3/06/376 Prevention of post transplantation graft dysfunction RJM Consultancy Ltd 22/05/2006
Recombinant self-complementary adeno-associated viral vector serotype 9 containing the human CLN3 gene EU/3/16/1806 Treatment of neuronal ceroid lipofuscinosis Abeona Therapeutics Europe SL 12/12/2016
Recombinant thymidine phosphorylase encapsulated in autologous erythrocytes EU/3/11/856 Treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) due to thymidine phosphorylase deficiency St George's University of London 15/04/2011
Recombinant truncated N-terminal fragment of human lens epithelium-derived growth factor EU/3/17/1908 Treatment of retinitis pigmentosa Dorian Regulatory Affairs BV 23/08/2017
Reduced oxydised N-acetyl heparin EU/3/15/1487 Treatment of plasma cell myeloma Leadiant Biosciences Ltd 21/05/2015
Reparixin EU/3/11/912 Prevention of graft rejection in pancreatic islet transplantation Dompé farmaceutici S.p.A. 27/09/2011
Repertaxin L-lysine salt
EU/3/01/058 Prevention of delayed graft function in organ transplant Dompé farmaceutici S.p.A. 19/09/2001
Resiquimod EU/3/16/1653 Treatment of cutaneous T-cell lymphoma Galderma R&D 28/04/2016
Resminostat EU/3/11/913 Treatment of hepatocellular carcinoma 4SC AG 27/09/2011
Resminostat EU/3/11/930 Treatment of Hodgkin's lymphoma 4SC AG 9/12/2011
Retinol EU/3/14/1307 Prevention of bronchopulmonary dysplasia orphanix GmbH 22/08/2014
Retinol EU/3/17/1895 Prevention of retinopathy of prematurity orphanix GmbH 17/07/2017
Retroviral gamma-c cDNA containing vector EU/3/01/038 Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease GENOPOIETIC S.A.S. 30/05/2001
Ribavirin EU/3/18/2002 Treatment of Crimean-Congo haemorrhagic fever Pharmadev Healthcare Ltd 21/03/2018
Ribavirin EU/3/18/2003 Treatment of Lassa fever Pharmadev Healthcare Ltd 21/03/2018
Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide EU/3/08/542 Treatment of acute myeloid leukaemia Dr Ulrich Granzer 8/05/2008
Rifapentine EU/3/10/750 Treatment of tuberculosis Sanofi-Aventis groupe 9/06/2010
Rilotumumab EU/3/14/1291 Treatment of gastric cancer Amgen Europe B.V. 29/07/2014
Riluzole EU/3/14/1401 Treatment of traumatic spinal cord injury Dr Laurent Vinay 16/12/2014
Rimeporide EU/3/15/1478 Treatment of Duchenne muscular dystrophy EUDRAC Limited 24/04/2015
Rimiducid EU/3/16/1666 Treatment of graft-versus-host disease Bellicum Pharma Limited 30/05/2016
Rintatolimod EU/3/15/1480 Treatment of Ebola virus disease NV Hemispherx BioPharma Europe 24/04/2015
Riociguat EU/3/14/1299 Treatment of systemic sclerosis Bayer AG 29/07/2014
Rituximab EU/3/17/1869 Treatment in solid organ transplantation Hôpital Foch 20/04/2017
RNA, [P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a→5') (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5' [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3'[2'a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-β-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-β-alanyl-L-arginyl-6-aminohexanoyl-β-alanyl], octahydrochloride EU/3/09/725 Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 2/02/2010
RNA, [P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a→5')(C-m5U-C-C-A-A-C-A-m5U-C-A-A-G-G-A-A-G-A-m5U-G-G-C-A-m5U-m5U-m5U-C-m5U-A-G), P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy] ethoxy]carbonyl]-1-piperazinyl]-N,N‑dimethylaminophosphonamidate EU/3/08/586 Treatment of Duchenne muscular dystrophy Sarepta Therapeutics Ireland Limited 3/12/2008
Rovalpituzumab tesirine EU/3/16/1667 Treatment of small cell lung cancer AbbVie Deutschland GmbH & Co. KG 30/05/2016
Rozanolixizumab EU/3/18/2131 Treatment of immune thrombocytopenia UCB Biopharma SPRL 11/01/2019
R-salbutamol sulphate EU/3/07/481 Treatment of cutaneous forms of lupus erythematosus Astion Pharma A/S 14/09/2007
R,S-O-(3-piperidino-2-hydroxy-1-propyl)-nicotinic acid amidoxime dihydrochloride EU/3/13/1122 Treatment of Duchenne muscular dystrophy Vudbenk Life Science Kft. 26/04/2013
(R)-troloxamide quinone EU/3/17/1934 Treatment of amyotrophic lateral sclerosis Edison Orphan Pharma BV 8/11/2017
Rubitecan EU/3/03/145 Treatment of pancreatic cancer Eurogen Pharmaceuticals Limited 10/06/2003
Rufinamide EU/3/04/240 Treatment of Lennox-Gastaut syndrome Eisai GmbH 20/10/2004 Inovelon
Rusalatide acetate EU/3/18/1985 Treatment of acute radiation syndrome Raremoon Consulting Ltd 22/02/2018
S[+] apomorphine EU/3/12/954 Treatment of amyotrophic lateral sclerosis University of Sheffield 9/02/2012
(S)-10-[(dimethylamino)methyl]-4-ethyl-9-hydroxy-4-O-[alpha-(2'', 4'', 5'', 7''-tetranitro-9''-fluorenylideneaminooxy)propionyl]-1H-pyrano[3', 4', 6', 7']indolizino[1,2-beta]-quinoline-3, 14-(4H), 12H)-dione, hydrochloride EU/3/10/788 Treatment of hepatocellular carcinoma TLC Biopharmaceuticals B.V. 1/10/2010
(S)-1-(4-fluorophenyl)-1-(2-(4-(6-(1-methyl-1H-pyrazol-4-yl)pyrrolo[2,1-f][1,2,4]triazin-4-yl)piperazin-yl)pyrimidin-5-yl)ethan-1-amine EU/3/17/1889 Treatment of gastrointestinal stromal tumours PhaRA bvba 17/07/2017
S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK EU/3/09/634 Treatment of pancreatic cancer MBiotec GmbH 15/05/2009
(S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine EU/3/07/513 Treatment of tuberculosis FGK Representative Service GmbH 29/11/2007
(S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one EU/3/13/1125 Treatment of chronic lymphocytic leukaemia/small lymphocytic lymphoma Voisin Consulting S.A.R.L. 26/04/2013
(S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one EU/3/13/1157 Treatment of follicular lymphoma Voisin Consulting S.A.R.L. 17/07/2013
S3,S13-cyclo(D-tyrolsyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-aspartyl-L-tryptophyl-N-methyl-L-glycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-N-methyl-L-isoleucinamide) EU/3/14/1327 Treatment of paroxysmal nocturnal haemoglobinuria Amyndas Pharmaceuticals S.A. 22/08/2014
S3,S13-cyclo(D-tyrolsyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-aspartyl-L-tryptophyl-N-methyl-L-glycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-N-methyl-L-isoleucinamide) EU/3/16/1608 Treatment of C3 glomerulopathy Amyndas Pharmaceuticals S.A. 17/02/2016
(S)-3-((S)-2-(2-((2,6-difluorophenyl)amino)-2-oxoacetamido)propanamido)-4-oxo-5-(2,3,5,6-tetrafluorophenoxy)pentanoic acid EU/3/17/1914 Treatment of primary sclerosing cholangitis Pharma Gateway AB 16/10/2017
(S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride EU/3/14/1336 Treatment of Leigh syndrome Khondrion BV 15/10/2014
(S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride EU/3/15/1543 Treatment of mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes Khondrion BV 10/08/2015
(S)-8-{2-amino-6-[1-(5-chloro-biphenyl-2-yl)-(R)-2,2,2-trifluoro-ethoxy]-pyrimidin-4-yl}-2,8-diaza-spiro[4.5]decane-3-carboxylic acid ethyl ester EU/3/17/1861 Treatment of pulmonary arterial hypertension Roivant Sciences Ireland Limited 20/04/2017
(S)-{8-fluoro-2-2[4-(3-methoxyphenyl)-1-piperazinyl]-3-[2-methoxy-5-(trifluoromethyl)-phenyl]-3,4-dihydro-4-quinazolinyl} acetic acid EU/3/11/849 Prevention of cytomegalovirus disease in patients with impaired cell-mediated immunity deemed at risk Merck Sharp & Dohme B.V. 15/04/2011 PREVYMIS
S-acetyl-(S)-4'-phosphopantetheine, calcium salt EU/3/16/1654 Treatment of pantothenate-kinase-associated neurodegeneration TM3 Therapeutics B.V. 28/04/2016
Sacrosidase EU/3/13/1183 Treatment of congenital sucrase-isomaltase deficiency QOL Therapeutics UK Ltd 5/08/2013
Salmonella typhi Ty21a strain transfected with a plasmid vector encoding the human vascular endothelial growth factor receptor 2 EU/3/17/1909 Treatment of glioma Vaximm GmbH 23/08/2017
Sapacitabine EU/3/08/557 Treatment of myelodysplastic syndromes Cyclacel Limited 8/07/2008
Sapacitabine EU/3/08/558 Treatment of acute myeloid leukaemia Cyclacel Limited 10/07/2008
Sarizotan hydrochloride EU/3/15/1531 Treatment of Rett syndrome Newron Pharmaceuticals SpA 28/07/2015
Seladelpar EU/3/17/1930 Treatment of primary biliary cholangitis Larode Ltd 16/10/2017
Seletalisib EU/3/18/1986 Treatment of activated phosphoinositide 3-kinase delta syndrome UCB Biopharma SPRL 22/02/2018
Self-complementary adeno-associated viral vector serotype 9 containing the SGSH gene EU/3/16/1761 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Abeona Therapeutics Europe SL 14/10/2016
Selinexor EU/3/14/1354 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Karyopharm Europe GmbH 19/11/2014
Selinexor EU/3/14/1355 Treatment of plasma cell myeloma Karyopharm Europe GmbH 19/11/2014
Selumetinib EU/3/18/2050 Treatment of neurofibromatosis type 1 AstraZeneca AB 31/07/2018
(S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate EU/3/09/661 Treatment of carcinoid syndrome Ipsen Pharma 8/10/2009 Xermelo
Setmelanotide EU/3/16/1688 Treatment of Prader-Willi syndrome TMC Pharma Services Ltd 27/06/2016
Setmelanotide EU/3/16/1703 Treatment of pro-opiomelanocortin deficiency TMC Pharma Services Ltd 14/07/2016
Setmelanotide EU/3/18/2101 Treatment of leptin receptor deficiency TMC Pharma Services Ltd 19/11/2018
Sevuparin sodium EU/3/15/1433 Treatment of sickle cell disease Modus Therapeutics AB 12/02/2015
Sildenafil EU/3/17/1885 Treatment of congenital diaphragmatic hernia Avivia Beheer BV 20/06/2017
Sildenafil citrate EU/3/10/815 Treatment of postcardiotomy right ventricular failure Pfizer Europe MA EEIG 26/11/2010
Silibinin-C-2',3-dihydrogensuccinate, disodium salt EU/3/10/828 Prevention of recurrent hepatitis C in liver transplant recipients Rottapharm S.p.A 17/12/2010
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/01/079 Treatment of acute lung injury Pharm Research Associates (UK) Limited 4/02/2002
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/04/216 Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/04/217 Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol, sodium salt and palmitic acid EU/3/11/927 Treatment of cystic fibrosis Pharm Research Associates (UK) Limited 27/10/2011
Sindbis virus envelope pseudotyped lentiviral vector encoding New York esophageal squamous cell carcinoma-1 protein EU/3/16/1636 Treatment of soft tissue sarcoma Immune Design Ltd 21/03/2016
Single-chain urokinase plasminogen activator EU/3/14/1383 Treatment of pleural empyema IQVIA RDS Ireland Limited 16/12/2014
Siplizumab EU/3/17/1931 Treatment in solid organ transplantation ITB-MED AB 16/10/2017
Sirolimus EU/3/11/898 Treatment of chronic non-infectious uveitis Santen Oy 30/08/2011
Sirolimus EU/3/13/1204 Prevention of arteriovenous access dysfunction in patients undergoing surgical creation of an arteriovenous access for haemodialysis S-cubed Ltd 13/11/2013
Sirolimus EU/3/15/1557 Treatment of tuberous sclerosis Desitin Arzneimittel GmbH 9/10/2015
Sirolimus EU/3/15/1585 Treatment of beta thalassaemia intermedia and major Rare Partners srl Impresa Sociale 14/12/2015
Sirolimus EU/3/16/1704 Treatment of sporadic lymphangioleiomyomatosis Drug Development and Regulation S.L. 14/07/2016
Sirolimus EU/3/17/1886 Treatment of tuberous sclerosis Vale Pharmaceuticals Limited 20/06/2017
Sirolimus EU/3/17/1896 Treatment of pachyonychia congenita Raremoon Consulting Ltd 17/07/2017
Sirolimus EU/3/17/1910 Treatment of tuberous sclerosis Best Regulatory Consulting Ltd 23/08/2017
Sirolimus EU/3/17/1970 Treatment of sickle cell disease Rare Partners srl Impresa Sociale 17/01/2018
Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector EU/3/09/630 Treatment of dystrophic epidermolysis bullosa Prof. Alain Hovnanian 30/04/2009
Smilagenin EU/3/11/914 Treatment of amyotrophic lateral sclerosis QRC Consultants Ltd 27/09/2011
(S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate EU/3/15/1606 Treatment of soft tissue sarcoma Bayer AG 11/01/2016
S-nitrosoglutathione EU/3/11/870 Treatment of pre-eclampsia Salupont Consulting Ltd 13/05/2011
Sodium (1R,3R,4R,5S)-3-({2-N-acetylamino-2-deoxy-3-O-[(1S)-1-carboxylato-2-cyclohexylethyl]-beta-D-galactopyranosyl}oxy)-4-({6-deoxy-alpha-L-galactopyranosyl}oxy)-5-ethyl-cyclohexan-1-yl-(38-oxo-2,5,8,11,14,17,20,23,26,29,32,35-dodecaoxa-39-azahentetracontan-41-yl)carboxamide EU/3/17/1876 Treatment of acute myeloid leukaemia FGK Representative Service GmbH 22/05/2017
Sodium 2-hydroxylinoleate EU/3/15/1485 Treatment of neuroblastoma Ability Pharmaceuticals SL 24/04/2015
Sodium 2-hydroxylinoleate EU/3/17/1911 Treatment of pancreatic cancer Ability Pharmaceuticals SL 23/08/2017
Sodium 2-hydroxylinoleate EU/3/18/2121 Treatment of biliary tract cancer Ability Pharmaceuticals SL 14/12/2018
Sodium (2R,3S,5R)-5-(4-amino-2-oxo-1,3,5-triazin-1(2H)-yl)-2-(hydroxymethyl)tetrahydrofuran-3-yl ((2R,3S,5R)-5-(2-amino-6-oxo-1H-purin-9(6H)-yl)-3-hydroxytetrahydrofuran-2-yl)methyl phosphate EU/3/15/1597 Treatment of acute myeloid leukaemia Otsuka Pharmaceutical Europe Ltd 14/12/2015
Sodium 3-[(4aR,6R,7R,7aS)-7-hydroxy-2-oxido-2-sulfanylidene-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxaphosphinin-6-yl]-2-bromo-6-phenyl-5H-imidazo[1,2-a]purin-9-one EU/3/15/1462 Treatment of retinitis pigmentosa Universitätsklinikum Tübingen (UKT) 19/03/2015
Sodium acetate salt of the synthetic peptide H-D-Ala-Ser-Pro-Met-Leu-Val-Ala-Tyr-Asp-D-Ala-OH EU/3/14/1294 Treatment for necrotising soft tissue infections FGK Representative Service GmbH 29/07/2014
Sodium ascorbate and menadione sodium bisulfite EU/3/14/1308 Treatment of autosomal dominant polycystic liver disease MCA Regulatory Limited 22/08/2014
Sodium benzoate EU/3/15/1600 Treatment of hyperargininaemia Syri Limited 11/01/2016
Sodium benzoate EU/3/15/1601 Treatment of argininosuccinic aciduria Syri Limited 11/01/2016
Sodium benzoate EU/3/16/1705 Treatment of ornithine transcarbamylase deficiency Lucane Pharma SA 14/07/2016
Sodium benzoate EU/3/16/1706 Treatment of carbamoyl-phosphate synthase-1 deficiency Lucane Pharma SA 14/07/2016
Sodium benzoate EU/3/16/1707 Treatment of citrullinaemia type 1 Lucane Pharma SA 14/07/2016
Sodium benzoate EU/3/16/1708 Treatment of hyperargininaemia Lucane Pharma SA 14/07/2016
Sodium benzoate EU/3/16/1729 Treatment of lysinuric protein intolerance Lucane Pharma SA 29/08/2016
Sodium benzoate EU/3/16/1730 Treatment of ornithine translocase deficiency Lucane Pharma SA 29/08/2016
Sodium benzoate EU/3/16/1787 Treatment of argininosuccinic aciduria Lucane Pharma SA 18/11/2016
Sodium benzoate EU/3/16/1788 Treatment of N-acetylglutamate synthetase deficiency Lucane Pharma SA 18/11/2016
Sodium butyrate (rectal use) EU/3/05/284 Prevention of radiation proctitis Promefarm srl 27/05/2005
Sodium chlorite EU/3/13/1139 Treatment of amyotrophic lateral sclerosis FGK Representative Service GmbH 19/06/2013
Sodium hypochlorite EU/3/16/1709 Treatment of partial deep dermal and full thickness burns Hypo-Stream Ltd 14/07/2016
Sodium nitrite EU/3/12/967 Treatment of pulmonary arterial hypertension FGK Representative Service GmbH 5/03/2012
Sodium nitrite EU/3/13/1224 Treatment of aneurysmal subarachnoid haemorrhage Hope Pharmaceuticals, Ltd 16/01/2014
Sodium nitrite and ethylenediaminetetraacetic acid EU/3/16/1668 Treatment of cystic fibrosis Arch Bio Ireland Ltd 30/05/2016
Sodium phenylbutyrate EU/3/15/1581 Treatment of pyruvate dehydrogenase complex deficiency Fondazione Telethon 11/11/2015
Sodium thiosulfate EU/3/10/848 Treatment of calciphylaxis Dr Franz Köhler Chemie GmbH 23/02/2011
Sodium thiosulfate EU/3/12/979 Treatment of calciphylaxis Aptiv Solutions (UK) Limited 2/04/2012
Sodium thiosulfate EU/3/14/1414 Treatment for calciphylaxis Hope Pharmaceuticals, Ltd 15/01/2015
Sodium valproate EU/3/14/1428 Treatment of Wolfram syndrome Alan Boyd Consultants Ltd 15/01/2015
Soluble recombinant human fibroblast growth factor receptor 3 EU/3/17/1843 Treatment of achondroplasia TherAchon SAS 27/02/2017
Soluble yeast beta-1,3/1,6-glucan EU/3/05/294 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Biotec Pharmacon ASA 16/06/2005
Somapacitan EU/3/18/2068 Treatment of growth hormone deficiency Novo Nordisk A/S 24/08/2018
Somatropin EU/3/00/001 AIDS wasting Merck Serono Europe Limited 8/08/2000
Sorafenib tosylate EU/3/13/1199 Treatment of follicular thyroid cancer Bayer AG 13/11/2013 Nexavar
Sorafenib tosylate EU/3/13/1200 Treatment of papillary thyroid cancer Bayer AG 13/11/2013 Nexavar
Soraprazan EU/3/13/1208 Treatment of Stargardt’s disease Katairo GmbH 13/11/2013
Sulfonated monophosphorylated mannose oligosaccharide EU/3/11/872 Treatment of hepatocellular carcinoma S-cubed Ltd 21/06/2011
Synthetic 12 amino acids peptide designed after subcommissural organ spondin EU/3/13/1206 Treatment of spinal cord injury Neuronax SA 13/11/2013
Synthetic 15-amino-acid macrocyclic peptide acylated with a polyethyleneglycol palmitoylated linker EU/3/16/1762 Treatment of paroxysmal nocturnal haemoglobinuria Pharma Gateway AB 14/10/2016
Synthetic 47-amino-acid N-myristoylated lipopeptide, derived from the preS region of hepatitis B virus EU/3/15/1500 Treatment of hepatitis delta virus infection MYR GmbH 19/06/2015
Synthetic antisense oligonucleotide directed against human dystrophin pre-mRNA EU/3/18/2051 Treatment of Duchenne muscular dystrophy Wave life Sciences Ireland Limited 31/07/2018
Synthetic cyclic 8 amino acid analogue of human unacylated ghrelin EU/3/17/1932 Treatment of Prader-Willi syndrome Millendo Therapeutics SAS 16/10/2017
Synthetic double-stranded short interfering RNA oligonucleotide directed against proopiomelanocortin EU/3/10/798 Treatment of adrenocorticotropin-dependent Cushing's syndrome Diurnal Limited 1/10/2010
Synthetic double-stranded siRNA oligonucleotide directed against antithrombin mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/14/1297 Treatment of haemophilia A Genzyme Europe B.V. 29/07/2014
Synthetic double-stranded siRNA oligonucleotide directed against antithrombin mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/14/1298 Treatment of haemophilia B Genzyme Europe B.V. 29/07/2014
Synthetic double-stranded siRNA oligonucleotide directed against delta-aminolevulinic acid synthase 1 mRNA covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/16/1731 Treatment of acute hepatic porphyria Alnylam Netherlands B.V. 29/08/2016
Synthetic double-stranded siRNA oligonucleotide directed against hydroxyacid oxidase 1 mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/16/1637 Treatment of primary hyperoxaluria Alnylam UK Limited 21/03/2016
Synthetic double-stranded siRNA oligonucleotide directed against lactate dehydrogenase A mRNA and containing four modified nucleosides which form a ligand cluster of four N-acetylgalactosamine residues EU/3/18/2052 Treatment of primary hyperoxaluria Dicerna EU Limited 31/07/2018
Synthetic double-stranded siRNA oligonucleotide directed against p53 mRNA EU/3/10/751 Prevention of delayed graft function after renal transplantation ProductLife Limited 9/06/2010
Synthetic double-stranded siRNA oligonucleotide directed against the keratin 6a N171K mutation EU/3/13/1141 Treatment of pachyonychia congenita Alan Irvine 19/06/2013
Synthetic double-stranded siRNA oligonucleotide directed against TMPRSS6 mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/18/2132 Treatment of beta-thalassaemia intermedia and major Silence Therapeutics GmbH 11/01/2019
Synthetic double-stranded siRNA oligonucleotide directed against transthyretin mRNA EU/3/11/857 Treatment of transthyretin-mediated amyloidosis Alnylam Netherlands B.V. 15/04/2011 Onpattro
Synthetic double-stranded siRNA oligonucleotide targeted against transthyretin mRNA, with six phosphorothioate linkages in the backbone, and nine 2'-fluoro and thirty-five 2'-O-methyl nucleoside residues in the sequence, which is covalently linked via a phosphodiester group to a ligand containing three N-acetylgalactosamine residues EU/3/18/2026 Treatment of transthyretin-mediated amyloidosis Alnylam UK Limited 25/05/2018
Synthetic glucagon analogue modified to contain 7 amino acid substitutions EU/3/17/1887 Treatment of congenital hyperinsulinism Zealand Pharma A/S 20/06/2017
Synthetic hepcidin EU/3/15/1555 Treatment of beta thalassaemia intermedia and major La Jolla Pharmaceutical II BV 9/10/2015
Synthetic human hepcidin EU/3/16/1789 Treatment of sickle cell disease La Jolla Pharmaceutical II BV 18/11/2016
Synthetic hypericin EU/3/15/1515 Treatment of cutaneous T-cell lymphoma Kinesys Consulting Ltd 28/07/2015
Synthetic peptide L-cysteine, L-cysteinylglycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-, cyclic (1.fwdarw.17)-disulfide EU/3/15/1549 Treatment of primary graft dysfunction following lung transplantation Apeptico Forschung und Entwicklung GmbH 9/10/2015
Synthetic peptide L-cysteine, L-cysteinylglycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-, cyclic (1.fwdarw.17)-disulfide EU/3/15/1591 Treatment of pseudohypoaldosteronism type 1B Apeptico Forschung und Entwicklung GmbH 14/12/2015
Synthetic ribonucleic acid oligonucleotide directed against superoxide dismutase 1 messenger ribonucleic acid EU/3/16/1732 Treatment of amyotrophic lateral sclerosis Biogen Idec Limited 29/08/2016
Synthetic signal peptide of human mucin-1 (amino acids 1-21) EU/3/14/1423 Treatment of plasma cell myeloma Richardson Associates Regulatory Affairs Ltd 15/01/2015
(S)-(−)-3-(4-aminophenyl)-2-methoxypropanoic acid EU/3/18/2056 Treatment of idiopathic pulmonary fibrosis Nogra Pharma Limited 24/08/2018
Tacrolimus EU/3/17/1912 Treatment of pulmonary arterial hypertension VIVUS B.V. 23/08/2017
Tadekinig alfa EU/3/16/1763 Treatment of haemophagocytic lymphohistiocytosis IQVIA RDS Ireland Limited 14/10/2016
tafamidis EU/3/12/1066 Treatment of senile systemic amyloidosis Pfizer Europe MA EEIG 8/11/2012
Talactoferrinum alfa EU/3/07/448 Treatment of renal cell carcinoma Agennix Limited 5/06/2007
Taliglucerase alfa EU/3/10/726 Treatment of Gaucher Disease Pfizer Europe MA EEIG 23/03/2010
Tamibarotene EU/3/18/2053 Treatment of acute myeloid leukaemia Lakeside Regulatory Consulting Services Ltd 31/07/2018
Tamoxifen citrate EU/3/17/1877 Treatment of cystic fibrosis GB Pharma Srl 22/05/2017
Tamoxifen citrate EU/3/17/1944 Treatment of Duchenne muscular dystrophy Duchenne UK 8/11/2017
Tasimelteon EU/3/10/841 Treatment of non-24-hour sleep-wake disorders in blind people with no light perception Vanda Pharmaceuticals Limited 23/02/2011 Hetlioz
Tauroursodeoxycholic acid EU/3/17/1844 Treatment of amyotrophic lateral sclerosis Bruschettini s.r.l. 27/02/2017
Tazemetostat EU/3/18/2004 Treatment of diffuse large B-cell lymphoma IQVIA RDS Ireland Limited 21/03/2018
Tazemetostat EU/3/18/2005 Treatment of follicular lymphoma IQVIA RDS Ireland Limited 21/03/2018
Tazemetostat EU/3/18/2006 Treatment of malignant mesothelioma IQVIA RDS Ireland Limited 21/03/2018
Teicoplanin EU/3/17/1913 Treatment of cystic fibrosis Neupharma S.r.l. 23/08/2017
Temocillin sodium EU/3/03/183 Treatment of Burkholderia cepacia lung infection in cystic fibrosis Eumedica N.V. 14/01/2004
Temozolomide EU/3/16/1733 Treatment of glioma Double Bond Pharmaceutical AB 29/08/2016
Temsirolimus EU/3/06/420 Treatment of mantle cell lymphoma Pfizer Europe MA EEIG 6/11/2006 Torisel
Temsirolimus EU/3/16/1669 Treatment of adrenoleukodystrophy Consorcio Centro de Investigación Biomédica en Red M.P. 30/05/2016
Tenofovir disoproxil fumarate EU/3/14/1419 Treatment of Aicardi-Goutières syndrome Dr Yanick Crow 15/01/2015
Terguride EU/3/07/499 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Ergonex Licensing and Regulatory Services AG 29/11/2007
Terguride EU/3/12/1096 Treatment of systemic sclerosis medac Gesellschaft für klinische Spezialpräparate mbH 24/01/2013
Teriparatide EU/3/16/1689 Treatment of hypoparathyroidism Alan Boyd Consultants Ltd 27/06/2016
Tesetaxel EU/3/10/829 Treatment of gastric cancer Genta Development Limited 17/12/2010
Tetracosactide EU/3/18/2054 Treatment of Duchenne muscular dystrophy Mallinckrodt Specialty Pharmaceuticals Ireland Limited 31/07/2018
Tetrahydrobiopterin EU/3/04/199 Treatment of hyperphenylalaninemia BioMarin International Limited 8/06/2004 Kuvan
Tetrofosmin EU/3/16/1764 Diagnosis of glioma ProActina 14/10/2016
TGF-beta2 specific phosphorothioate antisense oligodeoxynucleotide EU/3/02/091 Treatment of high-grade glioma Dr Ulrich Granzer 22/03/2002
Thalidomide EU/3/17/1845 Treatment of hereditary haemorrhagic telangiectasia PlumeStars s.r.l. 27/02/2017
Thiotepa EU/3/06/424 Conditioning treatment prior to haematopoietic progenitor cell transplantation ADIENNE S.r.l. 29/01/2007 Tepadina
Three chimeric human/murine monoclonal antibodies against the Ebola (Zaire) surface glycoprotein EU/3/15/1558 Treatment for Ebola virus disease Dr Stefan Blesse 9/10/2015
Three human monoclonal antibodies against the Ebola virus glycoprotein EU/3/18/2027 Treatment of Ebola virus disease Regeneron Ireland U.C. 25/05/2018
Thymalfasin EU/3/02/110 Treatment of hepatocellular carcinoma SciClone Pharmaceuticals Italy S.r.l 30/07/2002
Thymidine and deoxycytidine EU/3/17/1870 Treatment of mitochondrial DNA depletion syndrome, myopathic form Pharma Gateway AB 20/04/2017
Tilorone EU/3/18/2069 Treatment of idiopathic pulmonary fibrosis Professor Marjukka Myllärniemi 24/08/2018
Tipifarnib EU/3/05/269 Treatment of acute myeloid leukaemia TMC Pharma Services Ltd 10/03/2005
Tirapazamine EU/3/17/1897 Treatment of hepatocellular carcinoma PhaRA bvba 17/07/2017
Tiratricol EU/3/17/1945 Treatment of Allan-Herndon-Dudley syndrome Rare Thyroid Therapeutics 8/11/2017
Tobramycin (inhalation powder) EU/3/03/140 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Novartis Europharm Limited 17/03/2003 TOBI Podhaler
Tolfenamic acid EU/3/16/1613 Treatment of progressive supranuclear palsy RV Developpement 17/02/2016
Tolfenamic acid EU/3/16/1614 Treatment of behavioural variant frontotemporal dementia RV Developpement 17/02/2016
Topotecan hydrochloride (liposomal) EU/3/08/562 Treatment of glioma Dr Matthias Luz 5/09/2008
Tosedostat EU/3/09/659 Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 24/07/2009
Trabectedin EU/3/03/171 Treatment of ovarian cancer Pharma Mar S.A. 17/10/2003 Yondelis
Trabedersen EU/3/09/660 Treatment of pancreatic cancer Dr Ulrich Granzer 24/07/2009
Tranilast EU/3/10/756 Prevention of scarring post glaucoma filtration surgery Altacor Ltd 27/07/2010
Trans-N1-((1R,2S)-2-phenylcyclopropyl)cyclohexane-1,4-diamine bis-hydrochloride EU/3/13/1174 Treatment of acute myeloid leukaemia Oryzon Genomics SA 5/08/2013
Trans-resveratrol EU/3/16/1827 Treatment of spinocerebellar ataxia Luis Pereira de Almeida 12/01/2017
Trebananib EU/3/13/1207 Treatment of ovarian cancer Amgen Europe B.V. 13/11/2013
Trehalose EU/3/15/1496 Treatment of oculopharyngeal muscular dystrophy Dr Ulrich Granzer 21/05/2015
Trehalose EU/3/15/1502 Treatment of spinocerebellar ataxia Dr Ulrich Granzer 19/06/2015
Treosulfan EU/3/04/186 Conditioning treatment prior to haematopoietic progenitor cell transplantation medac Gesellschaft für klinische Spezialpräparate mbH 23/02/2004
Treprostinil diethanolamine EU/3/09/635 Treatment of systemic sclerosis United Therapeutics Europe Ltd 15/05/2009
Treprostinil diethanolamine (oral use) EU/3/05/310 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 26/08/2005
Treprostinil sodium EU/3/13/1103 Treatment of chronic thromboembolic pulmonary hypertension SciPharm S.a.r.L 8/02/2013
Treprostinil sodium (inhalation use) EU/3/04/197 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 14/04/2004
Tretazicar EU/3/08/529 Treatment of visceral leishmaniasis Morvus Technology Limited 4/02/2008
Triamcinolone acetonide EU/3/15/1490 Treatment of non-infectious uveitis S-cubed Ltd 21/05/2015
Trientine dihydrochloride EU/3/03/172 Treatment of Wilson's disease Univar BV 24/10/2003
Triheptanoin EU/3/15/1495 Treatment of glucose transporter type-1 deficiency syndrome Ultragenyx Netherlands B.V. 21/05/2015
Triheptanoin EU/3/15/1508 Treatment of very long-chain acyl-CoA dehydrogenase deficiency Ultragenyx UK Limited 19/06/2015
Triheptanoin EU/3/15/1524 Treatment of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency Ultragenyx UK Limited 28/07/2015
Triheptanoin EU/3/15/1525 Treatment of mitochondrial trifunctional protein deficiency Ultragenyx UK Limited 28/07/2015
Triheptanoin EU/3/15/1526 Treatment of carnitine palmitoyltransferase II deficiency Ultragenyx UK Limited 28/07/2015
Triheptanoin EU/3/16/1710 Treatment of McArdle’s disease Vall d'Hebron Institute of Research 14/07/2016
Tripotassium citrate monohydrate and potassium hydrogen carbonate EU/3/17/1888 Treatment of distal renal tubular acidosis Advicenne Pharma SA 20/06/2017
Two allogenic irradiated pancreatic tumour cell lines EU/3/15/1604 Treatment of pancreatic cancer Aduro Biotech Holdings, Europe B.V. 11/01/2016
Type I native bovine skin collagen EU/3/08/607 Treatment of systemic sclerosis arGentis Autoimmune Europe Limited 9/02/2009
Tyr-Gly-Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-Arg-Gly-Gly-Asp-Leu-Leu-Pro-Arg-Gly-Ser EU/3/16/1790 Treatment of Huntington’s disease Dr Ulrich Granzer 18/11/2016
Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu, Ser-Gly-Gln-Ala-Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu-Pro-Ser-Cys-Leu-Glu-Ser, Arg-Ser-Asp-Glu-Leu-Val-Arg-His-His-Asn-Met-His-Gln-Arg-Asn-Met-Thr-Lys-Leu and Pro-Gly-Cys-Asn-Lys-Arg-Tyr-Phe-Lys-Leu-Ser-His-Leu-Gln-Met-His-Ser-Arg-Lys-His-Thr-Gly EU/3/16/1655 Treatment of acute myeloid leukaemia SELLAS Life Sciences Group UK, Limited 28/04/2016
Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu, Ser-Gly-Gln-Ala-Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu-Pro-Ser-Cys-Leu-Glu-Ser, Arg-Ser-Asp-Glu-Leu-Val-Arg-His-His-Asn-Met-His-Gln-Arg-Asn-Met-Thr-Lys-Leu and Pro-Gly-Cys-Asn-Lys-Arg-Tyr-Phe-Lys-Leu-Ser-His-Leu-Gln-Met-His-Ser-Arg-Lys-His-Thr-Gly EU/3/16/1656 Treatment of malignant mesothelioma SELLAS Life Sciences Group UK, Limited 28/04/2016
Ubenimex EU/3/16/1638 Treatment of pulmonary arterial hypertension Eiger Biopharmaceuticals Europe Limited 21/03/2016
Ubiquinol EU/3/16/1765 Treatment of primary coenzyme Q10 deficiency syndrome Consorcio Centro de Investigación Biomédica en Red M.P. 14/10/2016
Udenafil EU/3/16/1807 Treatment of functional single ventricle congenital heart disease ICON Clinical Research Limited 12/12/2016
Ulinastatin EU/3/14/1318 Treatment of acute pancreatitis BSV BioScience GmbH 22/08/2014
Ulocuplumab EU/3/15/1445 Treatment of acute myeloid leukaemia Bristol-Myers Squibb Pharma EEIG 12/02/2015
Ursodeoxycholic acid EU/3/17/1878 Treatment of Niemann-Pick disease IntraBio Ltd 22/05/2017
Vaccine consisting of 5 survivin peptides with different human leukocyte antigen restrictions EU/3/16/1791 Treatment of ovarian cancer Dr Ulrich Granzer 18/11/2016
Vaccinia GM-CSF/TK-deactivated virus EU/3/09/700 Treatment of hepatocellular carcinoma Transgene S.A. 26/11/2009
Valproic Acid EU/3/16/1734 Treatment of McArdle’s disease Vall d'Hebron Institute of Research 29/08/2016
Valproic acid EU/3/16/1792 Treatment of diffuse large B-cell lymphoma Valcuria AB 18/11/2016
Variant of recombinant human fibroblast growth factor 19 EU/3/14/1329 Treatment of primary biliary cirrhosis Diamond BioPharm Limited 22/08/2014
Variant of recombinant human fibroblast growth factor 19 EU/3/15/1584 Treatment of primary sclerosing cholangitis Diamond BioPharm Limited 14/12/2015
Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar EU/3/04/201 Prevention of stenosis in synthetic grafts used in haemodialysis Finvector Vision Therapies Limited 8/06/2004
Vasoactive Intestinal Peptide EU/3/03/173 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension mondoBIOTECH Laboratories AG 22/12/2003
Vatiquinone EU/3/17/1971 Treatment of RARS2 syndrome Edison Orphan Pharma BV 17/01/2018
Vector based on an adeno-associated virus serotype 2 backbone, pseudo-serotyped with a type 8 capsid, which carries the coding sequence of the human TYMP gene under the control of the human thyroxine binding globulin promoter EU/3/14/1326 Treatment of mitochondrial neurogastrointestinal encephalomyopathy Vall d'Hebron Institute of Research 22/08/2014
Velaglucerase alfa EU/3/10/752 Treatment of Gaucher disease Shire Pharmaceuticals Ireland Limited 9/06/2010 VPRIV
Veliparib EU/3/10/830 Treatment of ovarian cancer AbbVie Deutschland GmbH & Co. KG 17/12/2010
Veltuzumab EU/3/09/713 Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 29/01/2010
Vemurafenib EU/3/16/1670 Treatment of Langerhans’ cell histiocytosis Groupe d'étude des histiocytoses 30/05/2016
Vemurafenib EU/3/17/1846 Treatment of Erdheim-Chester disease Groupe d'étude des histiocytoses 27/02/2017
Venetoclax EU/3/16/1617 Treatment of acute myeloid leukaemia AbbVie Deutschland GmbH & Co. KG 17/02/2016
Venetoclax EU/3/16/1766 Treatment of diffuse large B-cell lymphoma AbbVie Deutschland GmbH & Co. KG 14/10/2016
Venetoclax EU/3/16/1767 Treatment of multiple myeloma AbbVie Deutschland GmbH & Co. KG 14/10/2016
Venetoclax EU/3/17/1954 Treatment of mantle cell lymphoma AbbVie Deutschland GmbH & Co. KG 12/12/2017
Venglustat EU/3/18/2122 Treatment of autosomal dominant polycystic kidney disease Genzyme Europe B.V. 14/12/2018
Vincristine sulphate liposomes EU/3/08/555 Treatment of acute lymphoblastic leukaemia NDA Regulatory Science Ltd 8/07/2008
Vinorelbine tartrate EU/3/18/2133 Treatment of soft tissue sarcoma TLC Biopharmaceuticals B.V. 11/01/2019
Viral vector containing DNA encoding the human SMN protein EU/3/11/876 Treatment of 5q spinal muscular atrophy University of Sheffield 21/06/2011
Vocimagene amiretrorepvec EU/3/18/1987 Treatment of glioma Richardson Associates Regulatory Affairs Ltd 22/02/2018
Voclosporin EU/3/12/1085 Treatment of non-infectious uveitis Granzer Regulatory Consulting & Services 6/12/2012
Volanesorsen sodium EU/3/16/1711 Treatment of familial partial lipodystrophy Akcea Therapeutics UK Ltd 14/07/2016
Volasertib EU/3/14/1255 Treatment of acute myeloid leukaemia Boehringer Ingelheim International GmbH 26/03/2014
Vosaroxin EU/3/12/990 Treatment of acute myeloid leukaemia Sunesis Europe Ltd 26/04/2012
Xenon EU/3/15/1483 Treatment of perinatal asphyxia Neuroprotexeon Ltd 24/04/2015
Xenon EU/3/16/1768 Treatment of ischaemia reperfusion injury associated with cardiac arrest Neuroprotexeon Ltd 14/10/2016
Yttrium (90Y) antiferritin polyclonal antibodies EU/3/03/162 Treatment of Hodgkin lymphoma Mablife 2/10/2003
Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 EU/3/08/608 Treatment of pancreatic cancer Immunomedics GmbH 6/02/2009
Yttrium (90Y)-DTPA-radiolabelled chimeric monoclonal antibody against frizzled homologue 10 EU/3/12/994 Treatment of soft tissue sarcoma Laboratoires OncoTherapy Science France, S.A.R.L 25/05/2012
(Z)-3-(3-(3,5-bis(trifluoromethyl)phenyl)-1H-1,2,4-triazol-1-yl)-N'-(pyrazin-2-yl)acrylohydrazide EU/3/14/1313 Treatment of acute myeloid leukaemia Karyopharm Europe GmbH 22/08/2014
(Z)-3-(3-(3,5-bis(trifluoromethyl)phenyl)-1H-1,2,4-triazol-1-yl)-N'-(pyrazin-2-yl)acrylohydrazide EU/3/14/1317 Treatment of diffuse large B-cell lymphoma Karyopharm Europe GmbH 22/08/2014
Zanolimumab EU/3/07/438 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) TenX Biopharma Ltd 20/03/2007
Zinc gluconate EU/3/16/1793 Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
Zoledronic acid EU/3/13/1192 Treatment of complex regional pain syndrome Axsome Therapeutics Limited 7/10/2013
Zoledronic acid EU/3/16/1735 Treatment of glioma Laboratorio Italiano Biochimico Farmaceutico Lisapharma S.p.A. 29/08/2016
Zosuquidar trihydrochloride EU/3/06/355 Treatment of acute myeloid leukaemia Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP 17/02/2006