Navigation path

Pharmaceuticals - Community Register


Register of designated Orphan Medicinal Products (alphabetical)

Product EU Designation Designated Orphan Indication Sponsor Designation date Tradename
EU Centralised Nr
implemented by
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/767 Treatment of post-essential thrombocythaemia myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/768 Treatment of primary myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/769 Treatment of post-polycythaemia vera myelofibrosis Voisin Consulting S.A.R.L. 25/08/2010
11-(4-Dimethylamino-3-hydroxy-6-methyl-tetrahydro-pyran-2-yloxy)-2-ethyl-3,4,10-trihydroxy-3,5,6,8,10,12,14-heptamethyl-1-oxa-6-aza-cyclopentadecane-13,15-dione EU/3/14/1239 Treatment of cystic fibrosis Synovo GmbH 19/02/2014
1,2:5,6-Dianhydrogalactitol EU/3/12/1093 Treatment of glioma IDIS Ltd 24/01/2013
1-[2-(Benzo[1,2,5]thiadiazol-5-ylamino)-6-(2,6-dichloro-phenyl)-pyrido[2,3-d]pyrimidin-7-yl]-3-tert-butyl-urea EU/3/10/770 Treatment of acute myeloid leukaemia Sanofi-Aventis groupe 20/09/2010
1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine EU/3/05/332 Treatment of acute myeloid leukaemia Vion (UK) Limited, ℅ i3 Research 14/12/2005
1-[(2-Chloro-4-methoxyphenoxy)methyl]-4-[(2,6-dichlorophenoxy)methyl]benzene EU/3/12/1021 Prevention of poliomyelitis in patients with immunodeficiencies deemed at risk ViroDefense Ltd 17/07/2012
1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride EU/3/07/459 Treatment of narcolepsy Bioprojet 10/07/2007
1,3-Propanedisulfonic acid, disodium salt EU/3/01/051 Treatment of Systemic Secondary Amyloidosis C.T. Phinco S.à.r.l. 31/07/2001
1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4 d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one EU/3/12/984 Treatment of chronic lymphocytic leukaemia Janssen-Cilag International NV 26/04/2012
1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one EU/3/13/1115 Treatment of mantle cell lymphoma Janssen-Cilag International NV 12/03/2013
1-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl] thieno [3,2-c]pyridin-3-yl}phenyl)-3-(3-fluorophenyl)urea EU/3/12/1001 Treatment of ovarian cancer AbbVie Ltd 06/06/2012
1-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl]thieno[3,2-c]pyridin-3-yl}phenyl)-3-(3-fluorophenyl)urea EU/3/11/915 Treatment of acute myeloid leukaemia AbbVie Ltd 27/10/2011
16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide EU/3/10/789 Treatment of medulloblastoma Biogenera SpA 01/10/2010
16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide EU/3/12/1016 Treatment of neuroblastoma Biogenera SpA 04/07/2012
16-base single-stranded PNA oligonucleotide linked to a 7-aminoacid peptide EU/3/09/692 Treatment of neuroblastoma Biogenera SpA 25/11/2009
(-)-17-(cyclopropylmethyl)-3,14 ß-dihydroxy-4,5 a-epoxy-6ß-[N-methyl-trans-3-(3-furyl) acrylamido] morphinan hydrochloride (intravenous use) EU/3/02/115 Treatment of uremic pruritus Toray International U.K. Limited 11/09/2002
17-(Dimethylaminoethylamino)-17-demethoxygeldanamycin (after administration of adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5) EU/3/12/1007 Treatment of retinitis pigmentosa Avena Therapeutics Ltd 28/11/2012
1-Cyclopropyl-3-[3-(5-morpholin-4-ylmethyl-1H-benzoimidazol-2-yl)-1H-pyrazol-4-yl]-urea EU/3/09/693 Treatment of acute myeloid leukaemia Astex Therapeutics Limited 26/11/2009
1-deoxygalactonojirimycin hydrochloride EU/3/06/368 Treatment of Fabry disease Amicus Therapeutics UK Limited 22/05/2006
(1-methyl-2-nitro-1H-imidazole-5-yl)methyl N,N'-bis(2-bromoethyl) diamidophosphate EU/3/12/966 Treatment of soft tissue sarcoma Ockham Europe Limited 05/03/2012
(1-methyl-2-nitro-1H-imidazole-5-yl)methyl N,N’-bis(2-bromoethyl)diamidophosphate EU/3/13/1152 Treatment of pancreatic cancer Merck KGaA 17/07/2013
(1R, 2R)-Octanoic acid [2-(2’,3’-dihydro-benzo [1,4] dioxin-6’-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt EU/3/07/514 Treatment of Gaucher Disease Genzyme Europe B.V. 04/12/2007
(1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol EU/3/05/314 Treatment of tuberculosis Janssen-Cilag International NV 26/08/2005 Sirturo
(1R,3R,4R,5S)-3-O-[2-O-benzoyl-3-O-(sodium(2S)-3-cyclohexyl-propanoate-2-yl)-ß-D-galactopyranosyl]-4-O-(a-L-fucopyranosyl)-5-orothylamido-cyclohexane-1-carboxylic acid ethyl-2-amidyl-ethyloxy-2-acetyl-(8-amino-1,3,6-naphthalene-tris sodium sulfonate) amide EU/3/13/1184 Treatment of sickle cell disease Pfizer Limited 05/08/2013
(1S,3S)-3-amino-4-(difluoromethylene) cyclopentanecarboxylic acid hydrochloride EU/3/12/953 Treatment of West syndrome Catalent Pharma Solutions Limited 09/02/2012
20-pentaerythritol poly (oxy-1,2-ethanediyl)-carboxymethyl-glycinate-7-ethyl-10-hydroxycamptothecine 10-[1,4'-bipiperidine]-1'-carboxylate EU/3/11/900 Treatment of ovarian cancer Nektar Therapeutics UK Ltd 27/09/2011
2,2'-{2-[(1R)-1-({[(2,5-dichlorobenzoyl)amino]acetyl}amino)-3-methylbutyl]-5-oxo-1,3,2-dioxaborolane-4,4-diyl}diacetic acid EU/3/11/899 Treatment of multiple myeloma Takeda Development Centre Europe Ltd. 27/09/2011
2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione EU/3/10/802 Treatment of idiopathic pulmonary fibrosis GenKyoTex Innovation S.A.S 26/11/2010
2,2-dimethylbutyric acid, sodium salt EU/3/09/617 Treatment of beta-thalassaemia intermedia and major   Isabelle Ramirez 27/02/2009
2,2-dimethylbutyric acid, sodium salt EU/3/09/621 Treatment of sickle cell disease Isabelle Ramirez 18/03/2009
2,3,4,5 tetrahydro-2,8-dimethyl-5-[2-(6-methyl-3-pyridyl)ethyl]-1H-pyrido[4,3-b]indole dihydrochloride EU/3/08/597 Treatment of Huntington´s disease IDEA Innovative Drug European Associates Limited 20/01/2009
2-[[3-({4-[(5-{2-[(3-Fluorophenyl)amino]-2-oxoethyl}-1H-pyrazol-3-yl)amino]-quinazolin-7-yl}oxy)propyl](ethyl)amino]ethyl dihydrogen phosphate trihydrate EU/3/08/590 Treatment of acute myeloid leukaemia AstraZeneca AB 05/12/2008
2',3',5'-tri-O-acetyluridine EU/3/09/637 Treatment of 5-fluorouracil overdose Wellstat Therapeutics EU Limited 15/05/2009
2-{4-[(5,6-diphenylpyrazin-2-yl)(isopropyl)amino]butoxy}-N-(methylsulfonyl)acetamide EU/3/05/316 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Actelion Registration Ltd 26/08/2005
2-[4-Methoxy-3-(2-m-tolyl-ethoxy)-benzoylamino]-indan-2-carboxylic acid EU/3/13/1108 Treatment of systemic sclerosis Sanofi-Aventis groupe 12/03/2013
2-Allyl-1-[6-(1-hydroxy-1-methylethyl)pyridin-2-yl]-6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-1,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin-3-one EU/3/12/989 Treatment of ovarian cancer Merck Sharp & Dohme Limited 26/04/2012
((2-aminoethyl) carbamic acid (2R,5S,8S,11S,14R,17S,19aS)-11-(4-aminobutyl)-5-benzyl-8-(4-benzyloxy benzyl)-14-(1H-indol-3-ylmethyl)-4,7,10,13,16,19-hexaoxo-17-phenyloctadecahydro-3a,6,9,12,15,18-hexaazacyclopentacyclooctadecen-2-yl ester, di[(S)-2-aminosuccinic acid] salt EU/3/04/200 Treatment of functional gastro-entero-pancreatic endocrine tumours Novartis Europharm Limited 08/06/2004
2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine. EU/3/03/141 Treatment of acute myeloid leukaemia Genzyme Europe B.V. 08/05/2003
2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine EU/3/01/082 Treatment of acute lymphoblastic leukaemia Genzyme Europe B.V. 05/02/2002 Evoltra
[2-Cyano-3-cyclopropyl-3-hydroxy-N-(3-methyl-4-trifluoromethylphenyl)prop-2-enamide] EU/3/12/1050 Treatment of traumatic spinal cord injury Algiax Pharmaceuticals GmbH 10/10/2012
2-hydroxyoleic acid EU/3/11/916 Treatment of glioma Lipopharma Therapeutics SL 27/10/2011
2-hydroxypropyl-ß-cyclodextrin EU/3/13/1124 Treatment of Niemann-Pick disease, type C International Niemann-Pick Disease Alliance (INPDA) 26/04/2013
2-iminobiotin EU/3/09/701 Treatment of perinatal asphyxia Neurophyxia B.V. 28/01/2010
2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol EU/3/04/195 Treatment of anaplastic thyroid cancer Diamond BioPharm Limited 14/04/2004
2-methoxymethyl-2-hydroxymethyl-1-azabicyclo[2,2,2]octan-3-one EU/3/10/742 Treatment of acute myeloid leukaemia Aprea AB 10/06/2010
(-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate EU/3/08/560 Treatment of moderate and severe closed traumatic brain injury KeyNeurotek Pharmaceuticals AG 05/09/2008
(2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl) amino)methyl)tetrahydrofuran-3,4-diol EU/3/13/1231 Treatment of acute lymphoblastic leukaemia Voisin Consulting S.A.R.L. 16/01/2014
(2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl) amino)methyl)tetrahydrofuran-3,4-diol EU/3/13/1230 Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 16/01/2014
2S, 4R ketoconazole EU/3/12/1012 Treatment of Cushing’s syndrome Cortendo AB 04/07/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1040 Treatment of Alagille syndrome Albireo AB 09/08/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1041 Treatment of primary biliary cirrhosis Albireo AB 09/08/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1028 Treatment of progressive familial intrahepatic cholestasis Albireo AB 17/07/2012
(2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide EU/3/05/315 Treatment of progressive myoclonic epilepsies UCB Pharma S.A. 26/08/2005
3-(4´aminoisoindoline-1´-one)-1-piperidine-2,6-dione EU/3/04/192 Treatment of myelodysplastic syndromes Celgene Europe Limited 08/03/2004 Revlimid
3-(4´aminoisoindoline-l´-one)-1-piperidine-2,6-dione EU/3/03/177 Treatment of multiple myeloma Celgene Europe Limited 12/12/2003 Revlimid
3,4-diaminopyridine phosphate EU/3/02/124 Treatment of Lambert-Eaton myasthenic syndrome BioMarin Europe Ltd 18/12/2002 Firdapse
(3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid EU/3/05/278 Treatment of Duchenne muscular dystrophy PTC Therapeutics, Limited 27/05/2005
(3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid EU/3/05/277 Treatment of cystic fibrosis PTC Therapeutics, Limited 27/05/2005
3,5-diiodothyropropionic acid EU/3/13/1193 Treatment of Allan-Herndon-Dudley syndrome CATS Consultants GmbH 07/10/2013
3-(6-(1-(2,2-difluorobenzo [d] [1,3] dioxol-5-yl)cyclopropanecarboxamido)-3-methylpyridin-2-yl)benzoic acid EU/3/10/761 Treatment of cystic fibrosis Vertex Pharmaceuticals (U.K.) Limited 04/08/2010
3-Chloro-4-fluorophenyl-[4-fluoro-4-{[(5-methylpyrimidin-2-ylmethyl) amino]methyl}piperidin-1-yl]methanone EU/3/14/1242 Treatment of Rett syndrome Neurolixis UK Ltd. 19/02/2014
3-methoxy-pregnenolone EU/3/07/511 Treatment of spinal cord injury MAPREG SAS 04/12/2007
(3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt EU/3/10/787 Treatment of mantle cell lymphoma TESARO U.K. Limited 01/10/2010
(3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt EU/3/10/760 Treatment of ovarian cancer TESARO U.K. Limited 04/08/2010
4-[123I]iodo-L-phenylalanine EU/3/06/386 Diagnosis of glioma Therapeia GmbH & Co. KG 25/07/2006
4-[131I]iodo-L-phenylalanine EU/3/06/363 Treatment of glioma Therapeia GmbH & Co. KG 11/04/2006
4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate EU/3/13/1109 Treatment of hepatocellular carcinoma Eli Lilly Nederland B.V. 13/03/2013
4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate EU/3/13/1120 Treatment of glioma Eli Lilly Nederland B.V. 26/04/2013
4-(3,5-bis-(hydroxy-phenyl)-1,2,4) triazol-1-yl)-benzoic acid EU/3/02/092 Treatment of chronic iron overload requiring chelation therapy Novartis Europharm Limited 13/03/2002 Exjade
4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HCl EU/3/05/288 Treatment of Huntington´s disease Teva Pharma GmbH 20/06/2005
4-(4-{[2-(4-chlorophenyl)-4,4-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-({3-nitro-4-[(tetrahydro-2H-pyran-4-ylmethyl)amino]phenyl}sulfonyl)-2-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)benzamide EU/3/12/1080 Treatment of chronic lymphocytic leukaemia AbbVie Ltd 06/12/2012
4,6,4’–trimethylangelicin EU/3/13/1137 Treatment of cystic fibrosis Rare Partners srl Impresa Sociale 19/06/2013
4,7,10,13,16,19-docosahexaenoic acid EU/3/06/412 Treatment of retinitis pigmentosa Natac Pharma S.L. 03/11/2006
4-[[9-[(3S)-tetrahydro-3-furanyl]-8-[(2,4,6-trifluorophenyl)amino]-9H-purin-2-yl]amino]-trans-cyclohexanol EU/3/11/934 Treatment of idiopathic pulmonary fibrosis Celgene Europe Limited 09/12/2011
4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-ß-D-arabinofuranosyl]-2(1H)-pyrimidinone EU/3/07/477 Treatment of hepatocellular carcinoma Interface International Consultancy Limited 14/09/2007
4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline EU/3/06/356 Treatment of renal cell carcinoma Prodimed S.A. 16/02/2006
4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride EU/3/06/390 Treatment of moderate and severe traumatic brain injury vasopharm GmbH 28/08/2006
4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol EU/3/07/487 Treatment of chronic lymphocytic leukaemia BlackSwan Pharma GmbH 14/11/2007
4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one EU/3/05/299 Treatment of pancreatic cancer ICON Clinical Research (U.K.) Limited 27/07/2005
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1216 Treatment of progressive familial intrahepatic cholestasis Lumena Pharma UK Limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1217 Treatment of primary sclerosing cholangitis Lumena Pharma UK Limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1214 Treatment of Alagille syndrome Lumena Pharma UK Limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1215 Treatment of primary biliary cirrhosis Lumena Pharma UK Limited 18/12/2013
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride EU/3/13/1136 Treatment of 5q spinal muscular atrophy Pfizer Limited 07/06/2013
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride EU/3/11/892 Treatment of 5q spinal muscular atrophy Repligen Europe Limited 30/08/2011
5-(2,6-Difluoro-phenoxy)-3(R,S)-{2(S)-[2(S)-(3-methoxycarbonyl-2(S)-{3-methyl-2(S)-[(quinoline-2-carbonyl)-amino]-butyrylamino}-propionylamino)-3-methyl-butyrylamino]-propionylamino}-4-oxo-pentanoic acid methyl ester EU/3/06/403 Treatment of neonatal brain injury Chiesi Farmaceutici S.P.A. 23/10/2006
5,6,7,8-Tetrahydrobiopterin EU/3/03/163 Treatment of hyperphenylalaninemia Orphanetics Pharma Entwicklungs GmbH 02/10/2003
5-aminolevulinic acid hydrochloride EU/3/02/121 Intra-operative photodynamic diagnosis of residual glioma medac Gesellschaft für klinische Spezialpräparate mbH 13/11/2002 Gliolan
5’-CTG CCA CGT TCT CCT GC-(2’ methoxy)A-(2’ methoxy)C-(2’ methoxy)C-3’ EU/3/04/203 Treatment of myasthenia gravis PPD Global Ltd 21/06/2004
5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole EU/3/08/591 Treatment of Duchenne muscular dystrophy Summit (Oxford) Limited 04/12/2008
5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt EU/3/03/182 Treatment of aneurysmal subarachnoid haemorrhage Actelion Registration Ltd 12/12/2003
5´-O-(trans-9´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine EU/3/07/476 Treatment of acute myleoid leukaemia Aqualis ASA 14/09/2007
5(S)-(2´-hydroxy ethoxy)-20(S)- camptothecin EU/3/07/450 Treatment of osteosarcoma Dr. Reddy's Laboratories (UK) Limited 08/06/2007
68Ga-2,2'-(7-(4-((S)-1-((4S,7S,10S,13R,16S,19R)-4-((R)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-ylcarbamoyl)-10-(4-aminobutyl)-16-(4-((S)-2,6-dioxohexahydropyrimidine-4-carboxamido)benzyl)-7-((R)-1-hydroxyethyl)-6,9,12,15,18-pentaoxo-13-(4-ureidobenzyl)-1,2-dithia-5,8,11,14,17-pentaazacycloicosan-19-ylamino)-3-(4-chlorophenyl)-1-oxopropan-2-ylamino)-1-carboxy-4-oxobutyl)-1,4,7-triazonane-1,4-diyl)diacetic acid EU/3/14/1246 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours OctreoPharm Sciences GmbH 19/02/2014
6alpha-ethyl-chenodeoxycholic acid EU/3/10/753 Treatment of primary biliary cirrhosis Intercept Pharma 27/07/2010
(6aS)-1,10-dimethoxy-6-methyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinoline-2,9-diol EU/3/13/1226 Treatment of dystrophic myotonia Valentia BioPharma S.L 16/01/2014
6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide EU/3/09/681 Treatment of Huntington´s disease Siena Biotech SpA 28/10/2009
6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2(3H)-one EU/3/12/970 Treatment of amyotrophic lateral sclerosis ICON Clinical Research (U.K.) Limited 05/03/2012
(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride monohydrate EU/3/09/616 Treatment of amyotrophic lateral sclerosis Knopp Neurosciences Sub Ltd 27/02/2009
6-thioguanine (oral liquid) EU/3/09/694 Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 26/11/2009
7-beta-hydroxycholesteryl-3-beta-oleate EU/3/10/816 Treatment of glioma Intsel Chimos SA 17/12/2010
8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-1,2,4-triazolo[3,4-f][1,6]naphthyridin-3(2H)-one mono-hydrochloride EU/3/09/695 Treatment of ovarian cancer Merck Sharp & Dohme Limited 30/11/2009
9-cis-Retinyl acetate EU/3/11/861 Treatment of Leber's congenital amaurosis QLT Ophthalmics (UK), Ltd 13/05/2011
9-cis-Retinyl acetate EU/3/11/865 Treatment of retinitis pigmentosa QLT Ophthalmics (UK), Ltd 13/05/2011
A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein EU/3/05/317 Treatment of graft-versus-host disease Xenikos B.V. 26/08/2005
Acadesine EU/3/05/280 Treatment of B-cell chronic lymphocytic leukemia (B-CLL) Advancell - Advanced In Vitro Cell Technologies S.A. 27/05/2005
Acadesine EU/3/11/881 Treatment of multiple myeloma Advancell - Advanced In Vitro Cell Technologies S.A. 05/08/2011
Acetylsalicylic acid EU/3/04/208 Treatment of polycythemia vera Bayer HealthCare AG 29/07/2004
Adeno associated viral vector containing the human calpain 3 gene EU/3/06/359 Treatment of calpainopathy Généthon 06/04/2006
Adeno-associated viral vector containing a modified U7-snRNA gene EU/3/05/297 Treatment of Duchenne muscular dystrophy Généthon 27/07/2005
Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene EU/3/10/817 Treatment of rhodopsin-linked retinitis pigmentosa Genable Technologies Ltd 17/12/2010
Adeno-associated viral vector containing modified U1 snRNA EU/3/09/663 Treatment of Duchenne muscular dystrophy uniQure biopharma B.V. 08/10/2009
Adeno-associated viral vector containing porphobilinogen deaminase gene EU/3/09/632 Treatment of acute intermittent porphyria uniQure biopharma B.V. 29/04/2009
Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene EU/3/11/917 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Institut Pasteur 27/10/2011
Adeno-associated viral vector containing the human alpha-sarcoglycan gene EU/3/08/573 Treatment of alpha-sarcoglycanopathy Généthon 07/11/2008
Adeno-associated viral vector containing the human ARSB gene EU/3/11/864 Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Fondazione Telethon 13/05/2011
Adeno-associated viral vector containing the human factor IX gene EU/3/11/938 Treatment of haemophilia B uniQure biopharma B.V. 11/01/2012
Adeno-associated viral vector containing the human gamma-sarcoglycan gene EU/3/04/233 Treatment of gamma-sarcoglycanopathy Généthon 21/10/2004
Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene EU/3/11/860 Treatment of Leber´s hereditary optic neuropathy Gensight-Biologics 13/05/2011
Adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5 (prior to administration of 17-dimethylaminoethylamino-17-demethoxygeldanamycin) EU/3/12/1069 Treatment of retinitis pigmentosa Avena Therapeutics Ltd 08/11/2012
Adeno-associated viral vector expressing lipoprotein lipase EU/3/04/194 Treatment of lipoprotein lipase deficiency uniQure biopharma B.V. 08/03/2004 Glybera
Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene EU/3/12/974 Treatment of primary hyperoxaluria type 1 uniQure biopharma B.V. 21/03/2012
Adeno-associated viral vector serotype 5 containing the human ABCA4 gene EU/3/08/609 Treatment of Stargardt’s disease Fondazione Telethon 06/02/2009
Adeno-associated viral vector serotype 8 containing the human AIPL1 gene EU/3/11/929 Treatment of Leber’s congenital amaurosis type 4 Fondazione Telethon 09/12/2011
Adeno-associated viral vector serotype 8 containing the human GUCY2D gene EU/3/14/1256 Treatment of Leber’s congenital amaurosis Fondazione Telethon 26/03/2014
Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene EU/3/12/1095 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Laboratorios del Dr. Esteve, S.A. 24/01/2013
Adeno-associated viral vector serotype 9 containing the human sulfamidase gene EU/3/11/877 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Laboratorios del Dr. Esteve, S.A. 21/06/2011
Adenoviral vector containing human p53 gene EU/3/06/404 Treatment of Li Fraumeni Syndrome Gendux Molecular Limited 23/10/2006
Adenovirus associated viral vector serotype 2 containing the human RPE65 gene EU/3/12/981 Treatment of Leber’s congenital amaurosis Alan Boyd Consultants Ltd 02/04/2012
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/484 Treatment of Leber's congenital amaurosis Centre Hospitalier Universitaire de Nantes 22/10/2007
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/486 Treatment of retinitis pigmentosa Centre Hospitalier Universitaire de Nantes 14/11/2007
Adenovirus associated viral vector serotype 5 containing the human pde6ß gene EU/3/13/1142 Treatment of retinitis pigmentosa Centre Hospitalier Universitaire de Nantes 19/06/2013
Adenovirus-associated vector containing human Fas-c gene EU/3/12/1002 Treatment of glioma Gregory Fryer Associates Ltd 06/06/2012
Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs EU/3/10/772 Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) LYSOGENE 20/09/2010
Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene EU/3/01/083 Treatment of high-grade glioma with subsequent use of ganciclovir sodium Finvector Vision Therapies Limited 06/02/2002
Adenovirus-specific T-cells derived from allogeneic donor leukocytes, expanded ex vivo EU/3/13/1227 Treatment of adenovirus infection in allogeneic haematopoietic stem-cell transplant recipients Cell Medica Ltd. 16/01/2014
Adrenomedullin EU/3/10/744 Treatment of acute lung injury mondoBIOTECH Laboratories AG 09/06/2010
Afamelanotide EU/3/09/648 Treatment of solar urticaria Clinuvel (UK) Limited 24/07/2009
Alginate oligosaccharide (G-block) fragment EU/3/07/475 Treatment of cystic fibrosis AlgiPharma AS 14/09/2007
Alicaforsen EU/3/09/641 Treatment of pouchitis Atlantic Healthcare plc 15/05/2009
Alisertib EU/3/12/1064 Treatment of ovarian cancer Takeda Development Centre Europe Ltd. 08/11/2012
Alisertib EU/3/12/1074 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Takeda Development Centre Europe Ltd. 06/12/2012
Allantoin EU/3/13/1232 Treatment of epidermolysis bullosa ORS Oxford Ltd 16/01/2014
Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma EU/3/13/1211 Treatment of glioma ERC Belgium 18/12/2013
Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix EU/3/10/843 Prevention of arteriovenous access failure in haemodialysis patients Shire Pharmaceuticals Ireland Limited 23/02/2011
Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media EU/3/13/1129 Treatment of graft-versus-host disease Cell2B Advanced Therapeutics, SA 07/06/2013
Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2 EU/3/11/866 Treatment of acute myeloid leukaemia Fate Therapeutics, LTD 13/05/2011
Allogeneic bone-marrow derived ex-vivo expanded multipotent adult progenitor cells EU/3/13/1233 Prevention of graft-versus-host disease ReGenesys BVBA 16/01/2014
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/664 Treatment of myelodysplastic syndromes Regulatory Resources Group Ltd 08/10/2009
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/665 Treatment of chronic myeloid leukaemia Regulatory Resources Group Ltd 08/10/2009
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/649 Treatment of Hodgkin lymphoma Regulatory Resources Group Ltd 24/07/2009
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/618 Treatment of acute lymphoblastic leukaemia Regulatory Resources Group Ltd 27/02/2009
Allogeneic ex vivo expanded umbilical cord blood cells EU/3/09/619 Treatment of acute myeloid leukaemia Regulatory Resources Group Ltd 27/02/2009
Allogeneic human dendritic cells derived from a CD34+ progenitor cell line EU/3/12/969 Treatment of acute myeloid leukaemia DCPrime BV 22/05/2012
Allogeneic human dermal fibroblasts EU/3/10/774 Treatment of epidermolysis bullosa Intercytex Ltd 20/09/2010
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells EU/3/12/1088 Treatment of 5q spinal muscular atrophy California Stem Cell (UK) Ltd 24/01/2013
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells EU/3/13/1155 Treatment of amyotrophic lateral sclerosis California Stem Cell (UK) Ltd 17/07/2013
Allogeneic T cells encoding an exogenous TK gene EU/3/11/878 Treatment of acute lymphoblastic leukaemia LTKFarma 21/06/2011
Allogeneic T cells encoding an exogenous TK gene EU/3/10/773 Treatment of acute myeloid leukaemia LTKFarma 20/09/2010
Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2 EU/3/11/867 Treatment of acute myeloid leukaemia Fate Therapeutics, LTD 13/05/2011
Allopurinol sodium EU/3/12/1076 Treatment of perinatal asphyxia Pharmathen S.A. 06/12/2012
Alpha-1 antitrypsin (inhalation use) EU/3/04/243 Treatment of cystic fibrosis Triskel EU Services Ltd. 16/11/2004
Alpha-1 antitrypsin (inhalation use) EU/3/04/244 Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Triskel EU Services Ltd. 16/11/2004
Alpha-1 proteinase inhibitor EU/3/06/350 Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Octapharma (IP) Limited 16/02/2006
Alpha-1 proteinase inhibitor (for inhalation use) EU/3/12/1045 Treatment of cystic fibrosis Grifols Deutschland GmbH 10/10/2012
Alpha-1 proteinase inhibitor (inhalation use) EU/3/08/546 Treatment of congenital alpha-1 antitrypsin deficiency Grifols Deutschland GmbH 03/06/2008
Alpha-1 proteinase inhibitor (inhalation use) EU/3/07/474 Treatment of cystic fibrosis CSL Behring GmbH 14/09/2007
Alpha-tocotrienol quinone EU/3/11/937 Treatment of Leigh syndrome Edison Orphan Pharma BV 09/12/2011
Alvocidib EU/3/07/485 Treatment of chronic lymphocytic leukaemia Sanofi-Aventis groupe 23/10/2007
Amatuximab EU/3/13/1222 Treatment of malignant mesothelioma Eisai Europe Limited 16/01/2014
Ambrisentan EU/3/05/273 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Glaxo Group Ltd 11/04/2005 Volibris
Amikacin sulfate EU/3/14/1259 Treatment of nontuberculous mycobacterial lung disease Insmed Limited 08/04/2014
Amikacin sulfate (liposomal) EU/3/06/387 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Insmed Limited 25/07/2006
Ammonium tetrathiomolybdate EU/3/08/539 Treatment of Wilson´s disease JJGConsultancy Ltd 01/04/2008
Amphotericin B (for inhalation use) EU/3/06/391 Prevention of pulmonary fungal infection in patients deemed at risk Novartis Europharm Limited 28/08/2006
Amrubicin hydrochloride EU/3/08/538 Treatment of small cell lung cancer Celgene Europe Limited 02/04/2008
Anagrelide Hydrochloride EU/3/00/010 Treatment of essential thrombocythaemia Shire Pharmaceutical Development Limited 29/12/2000 Xagrid
Anti epidermal growth factor receptor antibody h-R3 EU/3/04/220 Treatment of glioma Oncoscience AG 02/09/2004
Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody EU/3/04/193 Treatment of ovarian cancer Neovii Biotech GmbH 08/03/2004
Antisense NF-Kß p65 Oligonucleotide EU/3/02/106 Treatment of active ulcerative colitis InDex Pharmaceuticals AB 30/07/2002
Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' EU/3/06/416 Treatment of acute myeloid leukaemia EleosInc Limited 03/11/2006
Antisense oligonucleotide targeted to the SMN2 gene EU/3/12/976 Treatment of 5q spinal muscular atrophy Isis USA Ltd 02/04/2012
Antisense oligonucleotide targeting the F508delta mutation of CFTR EU/3/13/1195 Treatment of cystic fibrosis ProQR Therapeutics BV 07/10/2013
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/161 Treatment of neovascular glaucoma Gene Signal SAS 02/10/2003
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/160 Treatment of retinopathy of prematurity Gene Signal SAS 02/10/2003
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/07/445 Prevention of corneal graft rejection Gene Signal SAS 17/04/2007
Aplidine EU/3/04/245 Treatment of multiple myeloma Pharma Mar S.A. 16/11/2004
Apomorphine hydrochloride EU/3/11/862 Treatment of moderate and severe traumatic brain injury Dr. Elkan Raphael Gamzu 13/05/2011
Apomorphine hydrochloride (inhalation use) EU/3/06/349 Treatment of off-periods in Parkinson’s disease not responding to oral treatment Vectura Group plc 16/02/2006
Apremilast EU/3/13/1180 Treatment of Behçet's disease Celgene Europe Limited 05/08/2013
Arimoclomol EU/3/06/406 Treatment of amyotrophic lateral sclerosis Orphazyme ApS 26/10/2006
Artesunate EU/3/12/1079 Treatment of malaria Dafra Pharma International NV 06/12/2012
artesunate EU/3/07/510 Treatment of malaria Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 06/12/2007
artesunate EU/3/07/430 Treatment of malaria Pharmaorigin ApS 20/02/2007
ascorbic acid EU/3/08/531 Treatment of Charcot-Marie-Tooth disease type 1A Murigenetics SAS 01/04/2008
Asp-Arg-Val-Tyr-Ile-His-Pro EU/3/12/1047 Treatment of acute lung injury Gregory Fryer Associates Ltd 10/10/2012
Asp-Arg-Val-Tyr-Ile-His-Pro EU/3/14/1241 Treatment of Duchenne muscular dystrophy Gregory Fryer Associates Ltd 19/02/2014
Ataluren EU/3/12/1010 Treatment of Becker muscular dystrophy PTC Therapeutics, Limited 04/07/2012
Autologous bone marrow-derived mesenchymal stromal cells secreting neurotrophic factors EU/3/13/1148 Autologous bone marrow-derived mesenchymal stromal cells secreting neurotrophic factors Brainstorm Cell Therapeutics UK Ltd 17/07/2013
Autologous bone marrow-derived mononuclear cell fraction EU/3/10/775 Treatment of thromboangiitis obliterans (Buerger's disease) t2cure GmbH 20/09/2010
Autologous CD34+ cells transduced with a lentiviral vector containing the human ADA gene EU/3/13/1134 Treatment of adenosine deaminase-deficient-severe combined immunodeficiency Prof. Bobby Gaspar 07/06/2013
Autologous CD34+ cells transduced with a lentiviral vector containing the human RAG1 gene EU/3/14/1257 Treatment of recombination-activating gene 1 deficient severe combined immunodeficiency Prof. F.J.T.Staal 26/03/2014
Autologous CD34+ cells transduced with a lentiviral vector containing the human Wiskott-Aldrich syndrome gene EU/3/13/1196 Treatment of Wiskott-Aldrich-syndrome Généthon 07/10/2013
Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA EU/3/07/446 Treatment of metachromatic leukodystrophy Fondazione Telethon 13/04/2007
Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene EU/3/12/998 Treatment of Wiskott-Aldrich syndrome Fondazione Telethon 06/06/2012
Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene EU/3/05/313 Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency Glaxo Group Ltd 26/08/2005
Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human betaA-T87Q-globin gene EU/3/12/1091 Treatment of beta-thalassaemia intermedia and major bluebird bio France 24/01/2013
Autologous dendritic cells pulsed with allogeneic tumour cell lysate EU/3/13/1229 Treatment of malignant mesothelioma Amphera BV 16/01/2014
Autologous dendritic cells pulsed with autologous tumour cell lysate EU/3/07/431 Treatment of glioma Northwest Biotherapeutics GmbH 15/02/2007
Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose EU/3/10/776 Treatment of ovarian cancer Prima Biomed GmbH 20/09/2010
Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha) EU/3/14/1247 Treatment of glioma Diamond BioPharm Limited 19/02/2014
Autologous ex-vivo-expanded leucocytes treated with 5-aza-2’-deoxycytidine EU/3/13/1197 Treatment of glioma CytoVac A/S 13/11/2013
Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene EU/3/12/957 Treatment of X-linked chronic granulomatous disease Généthon 09/02/2012
Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene EU/3/09/623 Treatment of beta-thalassaemia intermedia and major   EGT San Rocco Italia SRL 29/04/2009
Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA EU/3/12/1003 Treatment of adrenoleukodystrophy bluebird bio France 06/06/2012
Autologous regulatory T cells with an immunophenotype of CD4+CD25hiFoxP3+ EU/3/13/1171 Prevention of graft rejection following solid organ transplantation iReg Medical AB 07/10/2013
Autologous renal cell tumor vaccine EU/3/02/116 Treatment of renal cell carcinoma Liponova GmbH 21/10/2002
Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex EU/3/05/270 Treatment of renal cell carcinoma Antigenics Therapeutics Limited 11/04/2005
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin EU/3/06/394 Treatment of follicular lymphoma Biovest Europe Limited 28/08/2006
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin EU/3/10/831 Treatment of mantle cell lymphoma Biovest Europe Limited 23/02/2011
Autologous tumour-derived gp96 heat shock protein-peptide complex EU/3/09/624 Treatment of glioma Antigenics Therapeutics Limited 29/04/2009
Avian polyclonal IgY antibody against Pseudomonas aeruginosa EU/3/08/564 Treatment of cystic fibrosis Immunsystem I.M.S. AB 23/09/2008
Aviptadil EU/3/06/395 Treatment of acute lung injury mondoBIOTECH Laboratories Anstalt 28/08/2006
Aviptadil EU/3/07/473 Treatment of sarcoidosis mondoBIOTECH Laboratories Anstalt 14/09/2007
Azacitidine EU/3/01/084 Treatment of myelodysplastic syndromes Celgene Europe Limited 06/02/2002 Vidaza
Azacitidine EU/3/07/509 Treatment of acute myeloid leukaemia Celgene Europe Limited 29/11/2007 Vidaza
Aztreonam lysinate (inhalation use) EU/3/04/204 Treatment of gram negative bacteria lung infections in cystic fibrosis Gilead Sciences International Ltd 21/06/2004 Cayston
Bacterial lipase EU/3/05/323 Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Nordmark Arzneimittel GmbH u. Co. KG 07/11/2005
Becatecarin EU/3/06/388 Treatment of cancers of the biliary tree Helsinn Birex Pharmaceuticals Ltd 25/07/2006
Beclomethasone 17, 21-dipropionate (oral use) EU/3/02/093 Treatment of intestinal graft-versus-host disease Soligenix UK Ltd 13/03/2002
Belinostat EU/3/12/1055 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) TopoTarget A/S 10/10/2012
Belinostat EU/3/13/1151 Treatment of malignant thymoma TopoTarget A/S 17/07/2013
Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] EU/3/09/716 Treatment of chronic myeloid leukaemia ARIAD Pharma Ltd 02/02/2010 Iclusig
Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] EU/3/09/715 Treatment of acute lymphoblastic leukaemia ARIAD Pharma Ltd 02/02/2010 Iclusig
Benzoic acid, sodium salt EU/3/02/111 Treatment of non-ketotic hyperglycinaemia Ethicare GmbH 11/09/2002
Beraprost sodium (modified release tablet) EU/3/08/554 Treatment of pulmonary arterial hypertension IDEA Innovative Drug European Associates Limited 10/07/2008
Beta-artemether / lumefantrine (powder for oral suspension) EU/3/09/702 Treatment of malaria Dafra Pharma International NV 28/01/2010
Betaine anhydrous EU/3/01/045 Treatment of homocystinuria Orphan Europe S.A.R.L. 09/07/2001 Cystadane
Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix EU/3/06/369 Treatment of epidermolysis bullosa TiGenix S.A.U. 22/05/2006
Bimosiamose disodium EU/3/05/285 Treatment of acute lung injury Revotar Biopharmaceuticals AG 27/05/2005
Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium EU/3/04/232 Treatment of glioma Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 20/10/2004
Blinatumomab EU/3/09/650 Treatment of acute lymphoblastic leukaemia Amgen Europe B.V. 24/07/2009
Bosutinib EU/3/10/762 Treatment of chronic myeloid leukaemia Pfizer Limited 04/08/2010 Bosulif
Bovine bile extract EU/3/05/287 Treatment of pancreatic cancer Dr. Ulrich Granzer 20/06/2005
Brentuximab vedotin EU/3/11/939 Treatment of cutaneous T-cell lymphoma Takeda Pharma A/S 11/01/2012
Brivudine EU/3/09/703 Treatment of pancreatic cancer RESprotect GmbH 28/01/2010
Budesonide EU/3/13/1181 Treatment of eosinophilic oesophagitis Dr. Falk Pharma GmbH 05/08/2013
Budesonide (oral use) EU/3/06/413 Treatment of Graft-versus-Host disease Dr. Falk Pharma GmbH 03/11/2006
Caffeine citrate EU/3/03/132 Treatment of primary apnoea of premature newborns Chiesi Farmaceutici S.P.A. 17/02/2003 Peyona
Canakinumab EU/3/12/1071 Treatment of tumour necrosis factor receptor-associated periodic syndrome Novartis Europharm Limited 08/11/2012
Carbetocin EU/3/12/975 Treatment of Prader-Willi syndrome Ferring Pharmaceuticals A/S 21/03/2012
Carboxypeptidase G2 EU/3/02/128 Adjunctive treatment in patients at risk of methotrexate toxicity Protherics Plc 03/02/2003
Cardiotrophin-1 EU/3/06/396 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation Digna Biotech S.L. 28/08/2006
Cardiotrophin-1 EU/3/11/893 Treatment of acute liver failure Digna Biotech S.L. 30/08/2011
Carfilzomib EU/3/08/548 Treatment of multiple myeloma Onyx Pharmaceuticals (UK) Ltd 03/06/2008
Carglumic acid EU/3/08/576 Treatment of methylmalonic acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
Carglumic acid EU/3/08/577 Treatment of propionic acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
Catumaxomab EU/3/06/414 Treatment of gastric cancer Neovii Biotech GmbH 03/11/2006
Celecoxib EU/3/01/070 Treatment of Familial Adenomatous Polyposis Pfizer Limited 20/11/2001 Onsenal
Cenersen EU/3/08/587 Treatment of chronic lymphocytic leukaemia EleosInc Limited 03/12/2008
Chimeric antibody to mesothelin EU/3/08/536 Treatment of pancreatic cancer Eisai Europe Limited 17/03/2008
Chimeric IgG monoclonal antibody cG250 EU/3/02/094 Treatment of renal cell carcinoma Wilex AG 19/03/2002
Chimeric locked nucleic acid-deoxynucleoside phosphorothioate-linked oligonucleotide directed against microRNA-451 EU/3/11/940 Treatment of polycythaemia vera Miragen Therapeutics Europe Ltd 11/01/2012
Chimeric monoclonal antibody against claudin 6 EU/3/12/1092 Treatment of ovarian cancer GANYMED Pharmaceuticals AG 24/01/2013
Chimeric monoclonal antibody against claudin-18 splice variant 2 EU/3/10/803 Treatment of gastric cancer GANYMED Pharmaceuticals AG 26/11/2010
Chimeric monoclonal antibody against claudin-18 splice variant 2 EU/3/13/1177 Treatment of pancreatic cancer GANYMED Pharmaceuticals AG 05/08/2013
Chimeric monoclonal antibody against GD2 EU/3/12/1062 Treatment of neuroblastoma APEIRON Biologics AG 08/11/2012
Chimeric monoclonal antibody against GD2 EU/3/11/879 Treatment of neuroblastoma United Therapeutics Europe Ltd 21/06/2011
Chimeric monoclonal antibody against kappa myeloma antigen EU/3/12/962 Treatment of multiple myeloma Gregory Fryer Associates Ltd 22/05/2012
Chimeric monoclonal antibody to shiga-toxin 1 and 2 EU/3/05/301 Treatment of shiga-toxin producing bacterial infection. Albany Regulatory Consulting Limited 26/08/2005
Chimeric-anti-interleukin-6 monoclonal antibody EU/3/07/508 Treatment of Castleman’s disease Janssen-Cilag International NV 30/11/2007 Sylvant
Chimeric-anti-interleukin-6 monoclonal antibody EU/3/09/642 Treatment of multiple myeloma Janssen Biologics B.V. 12/06/2009
Chlormethine EU/3/12/963 Treatment of cutaneous T-cell lymphoma TMC Pharma Services Ltd. 22/05/2012
Cholest-4-en-3-one, oxime EU/3/05/264 Treatment of 5q spinal muscular atrophies Trophos SA 10/03/2005
Cholic acid EU/3/09/683 Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid FGK Representative Service GmbH 28/10/2009 Cholic Acid FGK
Cholic acid EU/3/02/127 Treatment of inborn errors in primary bile acid synthesis Laboratoires CTRS (Cell Therapies Research & Services) 18/12/2002 Orphacol
Choline tetrathiomolybdate EU/3/12/1089 Treatment of Wilson’s disease Medical Need Europe AB 24/01/2013
Ciclosporin EU/3/10/791 Treatment of moderate and severe closed traumatic brain injury NeuroVive Pharmaceutical AB 01/10/2010
Ciclosporin EU/3/07/489 Treatment of Herpes simplex virus stromal keratitis Novagali Pharma SA 29/10/2007
Ciclosporin EU/3/07/455 Prevention of corneal graft rejection Novagali Pharma SA 22/10/2007
Ciclosporin EU/3/06/360 Treatment of vernal keratoconjunctivitis Novagali Pharma SA 06/04/2006
Ciclosporin (eye drops, solution) EU/3/09/651 Treatment of atopic keratoconjunctivitis Allergan Pharmaceuticals Ireland 24/07/2009
Ciclosporin (inhalation use) EU/3/04/210 Treatment of graft rejection after lung transplantation PARI Pharma GmbH 29/07/2004
Ciclosporin (inhalation use) EU/3/04/209 Prevention of graft rejection after lung transplantation PARI Pharma GmbH 29/07/2004
Ciclosporin (inhalation use) EU/3/05/265 Treatment of graft rejection after lung transplantation Right Track Regulatory Limited 10/03/2005
Ciclosporin (inhalation use) EU/3/05/266 Prevention of graft rejection after lung transplantation Chiron Corporation Limited (trading as Chiron Biopharmaceuticals) 10/03/2005
Ciprofloxacin (inhalation use) EU/3/07/469 Treatment of cystic fibrosis Bayer Schering Pharma AG 03/08/2007
Ciprofloxacin (liposomal) EU/3/09/652 Treatment of cystic fibrosis Interface International Consultancy Limited 24/07/2009
Cisplatin (liposomal) EU/3/07/451 Treatment of pancreatic cancer Regulon AE 08/06/2007
Cladribine EU/3/13/1182 Treatment of mastocytosis Lipomed GmbH 05/08/2013
Cladribine (subcutaneous use) EU/3/01/055 Treatment of indolent non-Hodgkin´s lymphoma Lipomed GmbH 18/09/2001 Litak
Clonidine hydrochloride EU/3/11/919 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy BioAlliance Pharma 27/10/2011
Copper meso-5,15-bis[3-[(1,2-dicarba-closo-dodecaboranyl)methoxy]phenyl]-meso-10,20-dinitroporphyrin EU/3/13/1138 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy MorEx Development Partners LLP 27/06/2013
Covalently closed DNA plasmids coding for cytomegalovirus phosphoprotein 65 and glycoprotein B genes EU/3/12/1042 Prevention of cytomegalovirus disease in patients with impaired cell mediated immunity deemed at risk Astellas Pharma Europe B.V. 09/08/2012
Cyclic pyranopterin monophosphate EU/3/10/777 Treatment of molybdenum cofactor deficiency type A Alexion Europe SAS 20/09/2010
Cyclo-Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys EU/3/13/1102 Treatment of high altitude pulmonary oedema Apeptico Forschung und Entwicklung GmbH 08/02/2013
Cyclo(-gamma-aminobutyryl-L-phenylalanyl-L-tryptophanyl-D-tryptophanyl-L-lysyl-L-threonyl-L phenylalanyl-N-3-carboxypropyl)-glycine amide, acetate salt EU/3/12/1075 Treatment of acromegaly Dr. Ulrich Granzer 06/12/2012
Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl] acetate salt EU/3/13/1114 Treatment of congenital alpha-1 antitrypsin deficiency Polyphor UK Ltd 20/03/2013
Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt EU/3/08/610 Treatment of medullary thyroid carcinoma TMC Pharma Services Ltd. 06/02/2009 Cometriq
Cysteamine EU/3/11/928 Treatment of cystic fibrosis NovaBiotics Ltd 09/12/2011
Cysteamine EU/3/14/1240 Treatment of cystic fibrosis Istituto Europeo per la Ricerca sulla Fibrosi Cistica - ONLUS 19/02/2014
Cysteamine bitartrate EU/3/14/1252 Treatment of pancreatic cancer Raptor Pharmaceuticals Europe BV 26/03/2014
Cysteamine bitartrate (gastroresistant) EU/3/10/778 Treatment of cystinosis Raptor Pharmaceuticals Europe BV 20/09/2010 Procysbi
Cysteamine hydrochloride EU/3/08/578 Treatment of cystinosis Orphan Europe S.A.R.L. 07/11/2008
Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate EU/3/03/149 Treatment of pancreatic cancer in combination with ifosfamide Ziel Biopharma Limited 30/06/2003
Daratumumab EU/3/13/1153 Treatment of plasma cell myeloma Janssen-Cilag International NV 17/07/2013
Darinaparsin EU/3/11/850 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Ziopharm Oncology Limited 15/04/2011
Dasatinib EU/3/05/339 Treatment of chronic myeloid leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 Sprycel
Dasatinib EU/3/05/338 Treatment of acute lymphoblastic leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 Sprycel
Daunorubicin (liposomal) EU/3/08/585 Treatment of acute myeloid leukaemia Diatos S. A. 03/12/2008
Decitabine EU/3/06/370 Treatment of acute myeloid leukaemia Janssen-Cilag International NV 08/06/2006 Dacogen
Decitabine EU/3/03/135 Treatment of myelodysplastic syndromes Janssen-Cilag International NV 14/02/2003
Deferiprone EU/3/10/832 Treatment of sickle cell disease Apotex Europe B.V. 23/02/2011
Defibrotide EU/3/13/1201 Prevention of graft-versus-host disease Gentium S.p.A. 13/11/2013
Defibrotide EU/3/04/212 Treatment of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004 Defitelio
Defibrotide EU/3/04/211 Prevention of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004 Defitelio
Denileukin diftitox EU/3/01/075 Treatment of cutaneous T-cell lymphoma Eisai Limited 11/12/2001
Denufosol tetrasodium EU/3/05/342 Treatment of cystic fibrosis Merck Sharp & Dohme Limited 23/12/2005
Desipramine hydrochloride EU/3/09/643 Treatment of Rett syndrome Targeon SAS 12/06/2009
Dexamethasone (40 mg tablet) EU/3/10/745 Treatment of multiple myeloma Laboratoires CTRS (Cell Therapies Research & Services) 09/06/2010
Dexamethasone phosphate (iontophoretic solution, ocular use) EU/3/09/636 Treatment of corneal graft rejection Interface International Consultancy Limited 15/05/2009
Dexamethasone sodium phosphate encapsulated in human autologous erythrocytes EU/3/13/1158 Treatment of ataxia telangiectasia Erydel S.p.A. 17/07/2013
Dexamethasone sodium phosphate encapsulated in human erythrocytes EU/3/04/230 Treatment of cystic fibrosis Erydel S.p.A. 20/10/2004
Dexrazoxane EU/3/01/059 Treatment of anthracycline extravasations Norgine B.V. 19/09/2001 Savene
Diacerein EU/3/14/1236 Treatment of epidermolysis bullosa Prof. Johann W. Bauer 19/02/2014
dimethyl sulfoxide EU/3/05/263 Treatment of severe closed traumatic brain injury AOP Orphan Pharmaceuticals AG 03/03/2005
Dinaciclib EU/3/11/901 Treatment of chronic lymphocytic leukaemia Merck Sharp & Dohme Limited 27/09/2011
Dipalmitoylphosphatidylcholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol, sodium salt, synthetic surfactant protein C analogue and synthetic surfactant protein B analogue EU/3/12/982 Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Chiesi Farmaceutici S.P.A. 02/04/2012
Donor lymphocyte preparation depleted of functional alloreactive T-cells EU/3/08/561 Prevention of Graft-versus-Host disease Kiadis Pharma Netherlands B.V. 05/09/2008
Doxorubicin (administered after synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine) EU/3/12/1006 Treatment of glioma Avena Therapeutics Ltd 28/11/2012
Doxorubicin hydrochloride (drug eluting beads) EU/3/07/507 Treatment of glioma Biocompatibles UK Limited 29/11/2007
Doxorubicin hydrochloride (in heat-sensitive liposomes) EU/3/10/833 Treatment of hepatocellular carcinoma Biological Consulting Europe Ltd 23/02/2011
Doxorubicin hydrochloride (liposomal) EU/3/06/410 Treatment of soft tissue sarcoma GP-Pharm S.A. 27/10/2006
Doxorubicin polyisohexylcyanoacrylate nanoparticles EU/3/04/229 Treatment of the hepatocellular carcinoma BioAlliance Pharma 21/10/2004
Doxorubicin(6-maleimidocaproyl)hydrazone EU/3/14/1258 Treatment of soft tissue sarcoma Eudax Srl 26/03/2014
Doxycycline hyclate EU/3/12/961 Treatment of systemic amyloidosis caused by beta-2 microglobulin Giampaolo Merlini 05/03/2012
Doxycycline hyclate EU/3/12/955 Treatment of familial amyloid polyneuropathy Giampaolo Merlini 02/04/2012
Drotrecogin alfa (activated) EU/3/08/565 Treatment of acute respiratory distress syndrome Drugrecure Aps 22/09/2008
Dry extract from birch bark (DER 0.1-0.2:1), extraction solvent n-heptane 95% (V/V) EU/3/10/845 Treatment of epidermolysis bullosa Birken AG 23/02/2011
Duramycin EU/3/02/120 Treatment of cystic fibrosis AOP Orphan Pharmaceuticals AG 13/11/2002
E. Coli heat-shock protein 70 with bovine retinal S-antigen EU/3/05/346 Treatment of autoimmune uveitis Biotech Tools SA 24/01/2006
(E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/279 Treatment of cutaneous T-cell lymphoma Celgene Europe Limited 27/05/2005
(E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/328 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Celgene Europe Limited 28/10/2005
(E)-2,4,6-trimethoxystyryl-3-carboxymethylamino-4-methoxybenzyl-sulfone sodium salt EU/3/12/987 Treatment of myelodysplastic syndromes Onconova Europe GmbH 26/04/2012
Ecopipam EU/3/09/717 Treatment of Lesch-Nyhan disease Dr. Alain Munoz 03/02/2010
Ecteinascidin 743 EU/3/01/039 Treatment of soft tissue sarcoma Pharma Mar S.A. 30/05/2001
Ecteinascidin 743 EU/3/01/039 Treatment of soft tissue sarcoma Pharma Mar S.A. 30/05/2001 Yondelis
Eculizumab EU/3/13/1185 Treatment of neuromyelitis optica Alexion Europe SAS 05/08/2013
Eculizumab EU/3/03/166 Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe SAS 17/10/2003 Soliris
Eculizumab EU/3/14/1254 Prevention of graft rejection following solid organ transplantation Alexion Europe SAS 26/03/2014
Eculizumab EU/3/14/1238 Prevention of delayed graft function after solid organ transplantation Alexion Europe SAS 19/02/2014
Eculizumab EU/3/12/1015 Treatment of infection-associated haemolytic uraemic syndrome Alexion Europe SAS 04/07/2012
Eculizumab EU/3/09/653 Treatment of atypical haemolytic uremic syndrome Alexion Europe SAS 24/07/2009
Eflornithine EU/3/11/902 Treatment of neuroblastoma Cancer Prevention Pharma Limited 27/09/2011
Eflornithine EU/3/10/779 Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 20/09/2010
Eflornithine in combination with sulindac EU/3/12/1086 Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 24/01/2013
Eicosapentaenoic acid EU/3/09/666 Treatment of familial adenomatous polyposis S.L.A. Pharma (UK) Limited 08/10/2009
Elafin EU/3/07/443 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Proteo Biotech AG 20/03/2007
Elotuzumab EU/3/12/1037 Treatment of multiple myeloma Bristol-Myers Squibb Pharma EEIG 09/08/2012
Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor EU/3/12/1072 Treatment of macular telangiectasia type 2 Enpharma Ltd 08/11/2012
Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor EU/3/12/1098 Treatment of retinitis pigmentosa Enpharma Ltd 24/01/2013
Entinostat EU/3/10/732 Treatment of Hodgkin's lymphoma Ockham Europe Limited 10/06/2010
Enzastaurin hydrochloride EU/3/05/343 Treatment of glioma Eli Lilly Nederland B.V. 23/12/2005
Enzastaurin hydrochloride EU/3/07/442 Treatment of diffuse large B cell lymphoma Eli Lilly Nederland B.V. 20/03/2007
Eptacog alfa (activated) EU/3/05/333 Treatment of diffuse alveolar haemorrhage Pharmaorigin ApS 14/12/2005
Erdosteine EU/3/12/1067 Treatment of mercury toxicity Rafifarm SRL 08/11/2012
Erdosteine EU/3/12/1084 Treatment of lead toxicity Rafifarm SRL 06/12/2012
Estradiol Hemihydrate and Progesterone EU/3/05/275 Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age Dr. Frank Pohlandt 11/04/2005
Ethanol (96 per cent ) (gel for injection) EU/3/04/190 Treatment of congenital lymphatic malformations Orfagen 08/03/2004
Ethanol (96 per cent ) (gel for injection) EU/3/04/191 Treatment of congenital venous malformations Orfagen 08/03/2004
Ethyl Eicosopentaenoate EU/3/00/013 Treatment of Huntington´s disease Amarin Neuroscience Limited 29/12/2000
Etilefrin EU/3/02/122 Treatment of low flow priapism Laboratoires SERB 13/11/2002
Everolimus EU/3/10/764 Treatment of tuberous sclerosis Novartis Europharm Limited 04/08/2010 Votubia
Exon 44 specific phosphorothioate oligonucleotide EU/3/08/598 Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 27/02/2009
Exon 45 specific phosphorothioate oligonucleotide EU/3/12/991 Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 26/04/2012
Exon 51 specific phosphorothioate oligonucleotide EU/3/08/599 Treatment of Duchenne muscular dystrophy Glaxo Group Ltd 27/02/2009
Exon 52 specific phosphorothioate oligonucleotide EU/3/12/1077 Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 06/12/2012
Exon 53 specific phosphorothioate oligonucleotide EU/3/12/992 Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 26/04/2012
Exon 55 specific phosphorothioate oligonucleotide EU/3/12/1078 Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 06/12/2012
Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue EU/3/09/667 Treatment of anal fistula TiGenix S.A.U. 08/10/2009
Expanded human allogeneic neural retinal progenitor cells extracted from neural retina EU/3/13/1140 Treatment of retinitis pigmentosa ReNeuron Ltd 19/06/2013
Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower EU/3/05/302 Treatment of sickle cell disease Xechem UK Ltd 26/08/2005
Ex-vivo cultured adult human mesenchymal stem cells EU/3/07/432 Treatment of Graft-versus-Host disease Voisin Consulting S.A.R.L. 20/02/2007
Ex-vivo expanded autologous human corneal epithelium containing stem cells EU/3/13/1168 Treatment of limbal stem cell deficiency University Newcastle upon Tyne 17/07/2013
Ex-vivo expanded autologous human corneal epithelium containing stem cells EU/3/08/579 Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns Chiesi Farmaceutici S.P.A. 07/11/2008
Ex-vivo-cultured human mesenchymal stromal cells EU/3/14/1253 Prevention of graft rejection following solid organ transplantation iCell Science AB 26/03/2014
fampridine EU/3/07/458 Treatment of Guillain-Barré syndrome Dr. Ulrich Granzer 10/07/2007
Fenfluramine hydrochloride EU/3/13/1219 Treatment of Dravet syndrome Brabant Pharma Limited 18/12/2013
Filgrastim EU/3/08/580 Treatment of spinal cord injury Sygnis Bioscience GmbH & Co. KG 07/11/2008
filgrastim EU/3/08/532 Treatment of amyotrophic lateral sclerosis Sygnis Bioscience GmbH & Co. KG 01/04/2008
Fingolimod EU/3/09/718 Treatment of chronic inflammatory demyelinating polyneuropathy Novartis Europharm Limited 02/02/2010
Fixed-dose combination of (R-S) baclofen, naltrexone hydrochloride and D-sorbitol EU/3/14/1260 Treatment of Charcot-Marie-Tooth disease type 1A Pharnext SAS 26/03/2014
Fluocinolone acetonide (prolonged-release intravitreal implant) EU/3/05/261 Treatment of non-infectious uveitis affecting the posterior segment of the eye Bausch & Lomb Ireland 07/03/2005
Folic acid to be used with N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine EU/3/12/1044 Diagnosis of positive folate receptor status in ovarian cancer Endocyte Europe B.V. 10/09/2012 Neocepri
Forodesine EU/3/10/780 Treatment of chronic lymphocytic leukaemia Mundipharma Research Limited 20/09/2010
Forodesine hydrochloride EU/3/06/421 Treatment of acute lymphoblastic leukaemia Napp Pharmaceuticals Research Limited 18/12/2006
Forodesine hydrochloride EU/3/06/428 Treatment of cutaneous T-cell lymphoma Napp Pharmaceuticals Research Limited 29/01/2007
Fosbretabulin tromethamine EU/3/13/1154 Treatment of ovarian cancer Diamond BioPharm Limited 17/07/2013
Fresolimumab EU/3/11/882 Treatment of focal segmental glomerulosclerosis Genzyme Europe B.V. 05/08/2011
Fumagillin EU/3/01/081 Treatment of diarrhoea associated with intestinal microsporidial infection Sanofi-Aventis groupe 04/02/2002
G17(9) gastrin-diphtheria toxoid conjugate EU/3/02/129 Treatment of pancreatic cancer Cato Europe GmbH 24/01/2003
G17(9) gastrin-diphtheria toxoid conjugate EU/3/02/130 Treatment of gastric cancer Cato Europe GmbH 28/01/2003
Gadodiamide (liposomal) EU/3/08/583 Treatment of glioma Dr. Matthias Luz 03/12/2008
Gallium (68Ga)-pasireotide tetraxetan EU/3/11/920 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours OctreoPharm Sciences GmbH 27/10/2011
Gallium [Ga-68]-N-[(4,7,10-tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-Lcysteinyl-L-threonine-cyclic(2-7)disulfide EU/3/14/1237 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications SA 19/02/2014
Gemtuzumab Ozogamicin EU/3/00/005 Treatment of acute myeloid leukaemia Pfizer Limited 18/10/2000
Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) EU/3/06/405 Treatment of renal cell carcinoma MOLOGEN AG 23/10/2006
Genetically modified human adenovirus encoding human PH20 hyaluronidase EU/3/11/880 Treatment of pancreatic cancer VCN Biosciences S.L. 21/06/2011
Genetically modified Lactococcus lactis bacteria containing the human trefoil factor 1 gene EU/3/11/903 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy ActoGeniX N.V. 27/09/2011
Genetically modified serotype 5/3 adenovirus coding for granulocyte-macrophage colony-stimulating factor EU/3/13/1145 Treatment of soft tissue sarcoma Oncos Therapeutics Oy 19/06/2013
Genistein sodium salt dihydrate EU/3/12/980 Treatment of mucopolysaccharidosis type III (Sanfilippo syndrome) Axcentua Pharmaceuticals AB 02/04/2012
Gevokizumab EU/3/13/1111 Treatment of chronic non-infectious uveitis Les Laboratoires Servier 12/03/2013
Gimatecan EU/3/03/174 Treatment of glioma Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 01/12/2003
Givinostat EU/3/09/719 Treatment of polycythaemia vera Italfarmaco S.p.A. 03/02/2010
Givinostat EU/3/12/1009 Treatment of Duchenne muscular dystrophy Italfarmaco S.p.A. 04/07/2012
Glucagon EU/3/12/960 Treatment of congenital hyperinsulinism Biodel UK Limited 05/03/2012
Glufosfamide EU/3/11/851 Treatment of pancreatic cancer Theradex (Europe) Ltd. 15/04/2011
Glutathione EU/3/06/361 Treatment of cystic fibrosis Mukoviszidose e.V. 11/04/2006
Glutathione-pegylated liposomal doxorubicin hydrochloride EU/3/10/781 Treatment of glioma to-BBB Technologies BV 20/09/2010
[gly2] Recombinant human glucagon-like peptide EU/3/01/077 Treatment of Short Bowel Syndrome NPS Pharma Holdings Limited 11/12/2001 Revestive
Glyceryl tri-(4-phenylbutyrate) EU/3/10/739 Treatment of citrullinaemia type 2 Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/733 Treatment of carbamoyl-phosphate synthase-1 deficiency Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/737 Treatment of hyperargininaemia Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/734 Treatment of ornithine carbamoyltransferase deficiency Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/736 Treatment of argininosuccinic aciduria Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/738 Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Hyperion Therapeutics Limited 10/06/2010
Glyceryl tri-(4-phenylbutyrate) EU/3/10/735 Treatment of citrullinaemia type 1 Hyperion Therapeutics Limited 10/06/2010
Glycosylation independent lysosomal targeting tagged recombinant human acid alpha glucosidase EU/3/11/921 Treatment of glycogen storage disease type II (Pompe's disease) BioMarin Europe Ltd 27/10/2011
Granulocyte macrophage colony stimulating factor EU/3/13/1147 Treatment of pulmonary alveolar proteinosis Serendex ApS 17/07/2013
Guanabenz EU/3/09/625 Treatment of traumatic spinal cord injury Acure Pharma AB 29/04/2009
Gusperimus trihydrochloride EU/3/01/034 Treatment of Wegener’s granulomatosis Nordic Group B.V. 29/03/2001
Halofuginone Hydrobromide EU/3/01/074 Treatment of systemic sclerosis PPD Global Ltd 11/12/2001
Halofuginone Hydrobromide EU/3/12/988 Treatment of Duchenne muscular dystrophy Biological Consulting Europe Ltd 26/04/2012
H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt EU/3/07/521 Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients Vaxon Biotech 18/12/2007
H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 EU/3/05/292 Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Auris Medical Limited 16/06/2005
Heat-killed Mycobacterium vaccae (whole cell) EU/3/10/786 Treatment of tuberculosis Immodulon Therapeutics Ltd 20/09/2010
Heparin sodium EU/3/06/371 Treatment of cystic fibrosis Ockham Biotech Limited 22/05/2006
Heparin sodium EU/3/04/223 Treatment of idiopathic pulmonary fibrosis Prof. Dr. Seeger 02/09/2004
Heparin-activated recombinant human fibroblast growth factor 1 (on a biodegradable device made from alpha-calcium sulphate hemihydrate) EU/3/10/754 Treatment of traumatic spinal cord injury BioArctic Neuroscience AB 27/07/2010
Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 EU/3/06/407 Prevention of necrotizing enterocolitis Dr. Michael Moore 31/10/2006
Hepatitis C Immunoglobulin EU/3/05/295 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 08/07/2005
Herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes EU/3/03/168 Adjunctive treatment in hematopoietic cell transplantation MolMed S.p.A. 20/10/2003
Herpes simplex virus lacking infected cell protein 34.5 EU/3/03/153 Treatment of glioma Virttu Biologics Limited 09/07/2003
Heterologous human adult liver derived stem cells EU/3/08/530 Treatment of ornithinine transcarbamylase deficiency Promethera Biosciences 04/02/2008
Heterologous human adult liver derived stem cells EU/3/07/506 Treatment of Crigler-Najjar syndrome Promethera Biosciences 29/11/2007
Heterologous human adult liver-derived progenitor cells EU/3/13/1164 Treatment of hyperargininaemia Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1162 Treatment of citrullinaemia type 1 Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1163 Treatment of argininosuccinic aciduria Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1165 Treatment of N-acetylglutamate synthetase (NAGS) deficiency Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1167 Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1166 Treatment of citrullinaemia type 2 Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1161 Treatment of carbamoyl-phosphate synthase-1 deficiency Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived stem cells EU/3/12/983 Treatment of acute liver failure Fresenius Medical Care Deutschland GmbH 26/04/2012
Heterologous human adult liver-derived stem cells EU/3/11/904 Treatment of ornithine transcarbamylase deficiency Fresenius Medical Care Deutschland GmbH 27/09/2011
Heterologous human adult liver-derived stem cells EU/3/12/971 Treatment of carbamoyl-phosphate synthase-1 deficiency Fresenius Medical Care Deutschland GmbH 05/03/2012
Hexasodium phytate EU/3/12/1026 Treatment of calciphylaxis Sanifit Laboratoris, S.L. 17/07/2012
Histamine dihydrochloride EU/3/05/272 Treatment of acute myeloid leukaemia Meda AB 11/04/2005 Ceplene
HLA class I/II binding tumour associated peptides (ADF-APO-CCN-GUC-K67-MET- MMP-MUC-RGS) EU/3/07/433 Treatment of renal cell carcinoma Immatics Biotechnologies GmbH 15/02/2007
HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor EU/3/04/202 Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients Cellcure A/S 21/06/2004
HLA-B27 derived peptide (amino acid 125-138) EU/3/04/219 Treatment of autoimmune uveitis Dr. Gerhild Wildner 02/09/2004
Homoharringtonine EU/3/04/228 Treatment of acute myeloid leukaemia Teva Pharma GmbH 20/10/2004
Homoharringtonine EU/3/04/224 Treatment of chronic myeloid leukaemia Teva Pharma GmbH 02/09/2004
Human allogeneic bone marrow derived osteoblastic-like cells EU/3/13/1176 Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 05/08/2013
Human Alpha1-Proteinase Inhibitor (respiratory use) EU/3/01/044 Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency CSL Behring GmbH 09/07/2001
Human anthrax immunoglobulin EU/3/09/690 Post-exposure prophylaxis of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 09/11/2009
Human anthrax immunoglobulin EU/3/09/691 Treatment of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 05/11/2009
Human anthrax monoclonal antibody EU/3/11/852 Treatment of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 15/04/2011
Human anthrax monoclonal antibody EU/3/11/891 Post-exposure prophylaxis of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 05/08/2011
Human anti-intercellular adhesion molecule1 monoclonal antibody EU/3/08/600 Treatment of multiple myeloma BioInvent International AB 20/01/2009
Human apotransferrin EU/3/12/1027 Treatment of congenital hypotransferrinaemia Sanquin Blood Supply Foundation 17/07/2012
Human autologous bone-forming cells derived from bone marrow stem cells EU/3/07/490 Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 29/10/2007
Human autologous mesenchymal adult stem cells extracted from adipose tissue EU/3/05/303 Treatment of anal fistula TiGenix S.A.U. 26/08/2005
Human coagulation factor X EU/3/07/471 Treatment of hereditary factor X deficiency Bio Products Laboratory 17/09/2007
Human cytomegalovirus immunoglobulin EU/3/06/408 Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Biotest Pharma GmbH 31/10/2006
Human embryonic stem-cell-derived retinal pigment epithelial cells EU/3/11/874 Treatment of Stargardt’s disease TMC Pharma Services Ltd. 21/06/2011
Human erythrocytes encapsulating inositol hexaphosphate EU/3/12/1008 Treatment of sickle cell disease ERYtech Pharma S.A. 04/07/2012
Human haptoglobin EU/3/11/936 Treatment of sickle cell disease Bio Products Laboratory Ltd 09/12/2011
Human hemin EU/3/13/1149 Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Borders Technology Management Ltd 17/07/2013
Human heterologous liver cells (for infusion) EU/3/10/820 Treatment of argininosuccinic aciduria Cytonet GmbH & Co. KG 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/821 Treatment of carbamoyl-phosphate synthase-1 deficiency Cytonet GmbH & Co. KG 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/819 Treatment of hyperargininaemia Cytonet GmbH & Co. KG 17/12/2010
Human heterologous liver cells (for infusion) EU/3/07/470 Treatment of ornithine-transcarbamylase deficiency Cytonet GmbH & Co. KG 14/09/2007
Human heterologous liver cells (for infusion) EU/3/06/362 Treatment of acute liver failure Cytonet GmbH & Co. KG 11/04/2006
Human heterologous liver cells (for infusion) EU/3/10/818 Treatment of citrullinaemia type 1 Cytonet GmbH & Co. KG 17/12/2010
Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein EU/3/05/334 Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) Edimer Ltd 14/12/2005
Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) EU/3/06/417 Treatment of renal cell carcinoma Immunservice GmbH 27/10/2006
Human MHC non-restricted cytotoxic T-cell line EU/3/09/696 Treatment of ovarian cancer Galileo Research S.r.l. 30/11/2009
Human monoclonal antibody against CD4 EU/3/04/198 Treatment of cutaneous T-cell lymphoma TenX Biopharma Ltd 14/04/2004
Human monoclonal antibody against Fas ligand EU/3/12/956 Treatment of pemphigus PinCell s.r.l. 09/02/2012
Human monoclonal antibody against human interleukin 13 EU/3/13/1205 Treatment of eosinophilic oesophagitis Novartis Europharm Limited 13/11/2013
Human monoclonal antibody against Pseudomonas aeruginosa IATS-O1 EU/3/09/705 Treatment of pneumonia caused by serotype O1 Pseudomonas aeruginosa Envestia Limited 28/01/2010
Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 EU/3/06/381 Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa Voisin Consulting S.A.R.L. 29/06/2006
Human monoclonal antibody targeting Staphylococcus aureus alpha-toxin EU/3/12/968 Treatment of pneumonia caused by Staphylococcus aureus Envestia Limited 05/03/2012
Human papilloma virus type 16 E6/E7 synthetic long peptides EU/3/07/520 Treatment of epithelial neoplasia of the vulva positive for human papilloma virus ISA Therapeutics B.V. 20/12/2007
Human plasmin EU/3/10/834 Treatment of acute peripheral arterial occlusion Grifols Deutschland GmbH 23/02/2011
Human plasminogen EU/3/07/461 Treatment of ligneous conjunctivitis Kedrion S.p.A. 03/08/2007
Human platelet antigen-1a immunoglobulin EU/3/11/922 Prevention of fetal and neonatal alloimmune thrombocytopenia due to human platelet antigen-1a incompatibility Prophylix Pharma AS 27/10/2011
Human Staphylococcus aureus immunoglobulin EU/3/05/319 Treatment of Staphylococcus aureus bacteremia Biotest Pharma GmbH 28/10/2005
Human telomerase reverse transcriptase peptide (611-626) EU/3/06/384 Treatment of pancreatic cancer Gemvax A/S 25/07/2006
Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys EU/3/09/677 Treatment of acute lung injury Apeptico Forschung und Entwicklung GmbH 08/10/2009
Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein EU/3/05/290 Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck Viventia Biotech (EU) Limited 20/06/2005
Humanised IgG1 kappa antibody against serum amyloid A and AL amyloid EU/3/13/1100 Treatment of amyloid light-chain amyloidosis Onclave Therapeutics Limited 08/02/2013
Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 EU/3/09/638 Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation Opsona Therapeutics Limited 15/05/2009
Humanised monoclonal antibody against myostatin EU/3/13/1105 Treatment of Duchenne muscular dystrophy Pfizer Limited 08/02/2013
Humanised monoclonal antibody against P-selectin EU/3/12/1034 Treatment of sickle cell disease Quintiles Ireland Ltd 09/08/2012
Humanised monoclonal antibody to the folate receptor alpha EU/3/08/535 Treatment of ovarian cancer Eisai Europe Limited 01/04/2008
Humanised monoclonal IgG4 antibody against tissue factor pathway inhibitor EU/3/12/1052 Treatment of haemophilia A Novo Nordisk A/S 10/10/2012
Humanised monoclonal modified IgG4 antibody with bispecific structure targeting factors IX, IXa, X and Xa EU/3/13/1221 Treatment of haemophilia A Chugai Pharma Europe Ltd 18/12/2013
Humanised single chain monoclonal antibody against CD37 EU/3/12/1083 Treatment of chronic lymphocytic leukaemia Emergent Product Development UK Limited 06/12/2012
Humanized Agonistic Anti-CD28 Monoclonal Antibody EU/3/05/276 Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) TeGenero AG 11/04/2005
Hydrocortisone (modified release tablet) EU/3/05/296 Treatment of congenital adrenal hyperplasia Diurnal Limited 27/07/2005
Hydrocortisone (modified release tablet) EU/3/06/372 Treatment of adrenal insufficiency ViroPharma SPRL-BVBA 22/05/2006 Plenadren
Hydrocortisone (modified release tablet) EU/3/07/441 Treatment of adrenal insufficiency Diurnal Limited 20/03/2007
Hydroxy-propyl-beta-cyclodextrin EU/3/11/895 Treatment of Niemann-Pick disease, type C Susan French 30/08/2011
Hydroxyurea EU/3/03/154 Treatment of sickle cell syndrome Addmedica SAS 09/07/2003 Siklos
Hypothiocyanite / lactoferrin EU/3/09/654 Treatment of cystic fibrosis Alaxia 24/07/2009
Ibrutinib EU/3/13/1212 Treatment of follicular lymphoma Janssen-Cilag International NV 18/12/2013
Ibrutinib EU/3/13/1203 Treatment of diffuse large B-cell lymphoma Janssen-Cilag International NV 13/11/2013
Ibuprofen EU/3/01/020 Treatment of patent ductus arteriosus Orphan Europe S.A.R.L. 14/02/2001 Pedea
Icatibant acetate EU/3/03/133 treatment of angioedema Shire Orphan Therapies GmbH 17/02/2003 Firazyr
Idebenone EU/3/07/437 Treatment of Duchenne muscular dystrophy Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2007
Idebenone EU/3/07/434 Treatment of Leber's hereditary optic neuropathy Santhera Pharmaceuticals (Deutschland) GmbH 15/02/2007
Idebenone EU/3/01/062 Treatment of Friedreich’s ataxia Laboratoires Takeda 20/11/2001
Idebenone EU/3/04/189 Treatment of Friedreich’s ataxia Santhera Pharmaceuticals (Deutschland) GmbH 08/03/2004
Iduronate-2-sulfatase EU/3/01/078 Treatment of Mucopolysaccharidosis, type II (Hunter Syndrome) Shire Human Genetic Therapies AB 11/12/2001 Elaprase
IL-12-secreting dendritic cells, loaded with autologous tumour lysate EU/3/12/1058 Treatment of glioma Activartis Biotech GmbH 08/11/2012
Imexon EU/3/05/341 Treatment of ovarian cancer ICON Clinical Research (U.K.) Limited 23/12/2005
Immortalised human C3A hepatoblastoma cells EU/3/13/1143 Treatment of acute liver failure Vital Therapies Limited 19/06/2013
Inecalcitol EU/3/13/1223 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Hybrigenics SA 16/01/2014
Inolimomab EU/3/01/028 Treatment of Graft versus Host Disease EUSA Pharma SAS 05/03/2001
Inotuzumab ozogamicin EU/3/13/1127 Treatment of B-cell acute lymphoblastic leukaemia Pfizer Limited 07/06/2013
Interferon beta EU/3/07/505 Treatment of acute lung injury Faron Pharmaceuticals Limited 29/11/2007
Interferon gamma EU/3/07/491 Treatment of idiopathic pulmonary fibrosis mondoBIOTECH Laboratories AG 29/10/2007
Interferon gamma EU/3/11/935 Treatment of Friedreich's ataxia Prof. Roberto Testi 09/12/2011
Iodine (123I) Serum Amyloid P EU/3/03/134 Diagnosis of the extent of histologically proven amyloidosis Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. 14/02/2003
Iodine (131I) anti-tenascin monoclonal antibody 81C6 EU/3/06/418 Treatment of glioma The Weinberg Group Ltd 30/10/2006
Iodine (131I) chimeric IgG monoclonal antibody cG250 EU/3/02/095 Treatment of renal cell carcinoma Wilex AG 19/03/2002
Iodine (131I) chlorotoxin EU/3/07/492 Treatment of glioma Eisai Europe Limited 22/10/2007
Iodine (131I) iobenguane EU/3/07/525 Treatment of neuroblastoma Molecular Insight Limited 31/01/2008
Iodine (¹³¹I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody EU/3/02/119 Treatment of glioma Interface International Consultancy Limited 13/11/2002
Iodine (¹³¹I) tositumomab EU/3/03/136 Treatment of follicular lymphoma GlaxoSmithKline Research & Development Limited 14/02/2003
Irinotecan hydrochloride (drug eluting beads) EU/3/07/504 Treatment of glioma Biocompatibles UK Limited 29/11/2007
Isofagomine tartrate EU/3/07/493 Treatment of Gaucher Disease Amicus Therapeutics UK Limited 23/10/2007
Ixazomib EU/3/12/1060 Treatment of systemic light chain amyloidosis Takeda Development Centre Europe Ltd. 08/11/2012
Ketoconazole EU/3/12/1031 Treatment of Cushing’s syndrome Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare 09/08/2012
Ketoconazole EU/3/12/965 Treatment of Cushing’s syndrome Laboratoire HRA Pharma 23/04/2012
Kifunensine EU/3/11/908 Treatment of gamma-sarcoglycanopathy Généthon 27/09/2011
Kifunensine EU/3/11/907 Treatment of delta-sarcoglycanopathy Généthon 27/09/2011
Kifunensine EU/3/11/905 Treatment of alpha-sarcoglycanopathy Généthon 27/09/2011
Kifunensine EU/3/11/906 Treatment of beta-sarcoglycanopathy Généthon 27/09/2011
l, 1´-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane EU/3/04/227 Treatment to mobilize progenitor cells prior to stem cell transplantation Genzyme Europe B.V. 20/10/2004 Mozobil
Lactobacillus acidophilus and Bifidobacterium bifidum EU/3/13/1213 Prevention of necrotising enterocolitis Laboratorio Farmaceutico S.I.T. s.r.l. 18/12/2013
L-Asparaginase EU/3/04/258 Treatment of acute lymphoblastic leukaemia medac Gesellschaft für klinische Spezialpräparate mbH 26/01/2005
L-asparaginase encapsulated in erythrocytes EU/3/09/633 Treatment of pancreatic cancer ERYtech Pharma S.A. 15/05/2009
L-asparaginase encapsulated in erythrocytes EU/3/06/409 Treatment of acute lymphoblastic leukaemia ERYtech Pharma S.A. 27/10/2006
L-asparaginase encapsulated in erythrocytes EU/3/13/1106 Treatment of acute myeloid leukaemia ERYtech Pharma S.A. 08/02/2013
L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-, complex with keyhole limpet haemocyanin EU/3/11/923 Treatment of glioma Orphix Consulting GmbH 27/10/2011
Lenalidomide EU/3/07/494 Treatment of chronic lymphocytic leukaemia Celgene Europe Limited 19/11/2007
Lenalidomide EU/3/12/1097 Treatment of follicular lymphoma Celgene Europe Limited 24/01/2013
Lenalidomide EU/3/11/924 Treatment of mantle cell lymphoma Celgene Europe Limited 27/10/2011
Lenalidomide EU/3/11/868 Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 13/05/2011
Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene EU/3/10/822 Treatment of Fanconi anaemia type A Center for Biomedical Network Research on Rare Diseases (CIBERER) 17/12/2010
Lentiviral vector containing the human ABCA4 gene EU/3/09/720 Treatment of Stargardt´s disease Oxford Biomedica (UK) Ltd 02/02/2010
Lentiviral vector containing the human MYO7A gene EU/3/10/727 Treatment of retinitis pigmentosa in Usher syndrome 1B Oxford Biomedica (UK) Ltd 23/03/2010
Lentiviral vector containing the human Wiskott Aldrich syndrome protein gene EU/3/05/345 Treatment of Wiskott-Aldrich syndrome Généthon 24/01/2006
Lenvatinib EU/3/13/1121 Treatment of papillary thyroid cancer Eisai Europe Limited 26/04/2013
Lenvatinib EU/3/13/1119 Treatment of follicular thyroid cancer Eisai Europe Limited 26/04/2013
Lestaurtinib EU/3/06/389 Treatment of acute myeloid leukaemia Teva Santé 25/07/2006
Letermovir EU/3/12/999 Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity Merck Sharp & Dohme Limited 06/06/2012
Levamisol hydrochloride EU/3/05/324 Treatment of nephrotic syndrome Addmedica SAS 28/10/2005
Levodopa and Carbidopa (Gastroenteral use) EU/3/01/035 Treatment of advanced idiopathic Parkinson´s disease with severe motor fluctuations and not responding to oral treatment AbbVie Ltd 10/05/2001
Levofloxacin hemihydrate EU/3/08/566 Treatment of cystic fibrosis Aptalis Pharma SAS 23/09/2008
Levoglutamide EU/3/12/1011 Treatment of sickle cell disease Emmaus Medical Europe Limited 04/07/2012
Liarozole EU/3/03/144 Treatment of congenital ichthyoses Stiefel Laboratories (U.K.) Limited 10/06/2003
Lipid-complexed cisplatin EU/3/13/1169 Treatment of osteosarcoma Richardson Associates Regulatory Affairs Ltd 05/08/2013
Lipopolysaccharide of Ochrobactrum intermedium EU/3/11/941 Prevention of sepsis in at-risk premature infants of less than or equal to 32 weeks of gestational age Diomune S.L. 11/01/2012
Liposomal combination of cytarabine and daunorubicin EU/3/11/942 Treatment of acute myeloid leukaemia Celator (UK) Ltd 11/01/2012
Liposomal daunorubicin EU/3/12/1056 Treatment of acute myeloid leukaemia Galen limited 10/10/2012
Lisuride hydrogen maleate EU/3/11/869 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Sinoxa Pharma GmbH 13/05/2011
Lithium citrate tetrahydrate (in reverse-micelle formulation) EU/3/09/706 Treatment of Huntington´s disease Medesis Pharma 28/01/2010
L-Lysine-N-acetyl-L-cysteinate EU/3/01/026 Treatment of cystic fibrosis LABORATOIRES SMB SA 14/02/2001
Lomitapide EU/3/10/823 Treatment of familial chylomicronaemia Aegerion Pharmaceuticals 17/12/2010
Lonafarnib EU/3/13/1225 Treatment of hepatitis delta virus infection Eiger Biopharmaceuticals Europe Limited 16/01/2014
Low molecular weight dextran sulfate EU/3/09/669 Prevention of graft rejection during pancreatic islet transplantation TikoMed AB 09/10/2009
Low molecular weight dextran sulfate EU/3/11/883 Treatment for mobilisation of progenitor cells prior to stem cell transplantation TikoMed AB 05/08/2011
L-Pyr-L-Glu-L-Gln-L-Leu-L-Glu-L-Arg-L-Ala-L-Leu-L-Asn-L-Ser-L-Ser EU/3/13/1191 Treatment of sarcoidosis Araim Pharma Europe Ltd 07/10/2013
L-threo-3,4-dihydroxyphenylserine EU/3/07/465 Treatment of orthostatic hypotension in patients with pure autonomic failure The Weinberg Group Ltd 02/08/2007
L-threo-3,4-dihydroxyphenylserine EU/3/07/466 Treatment of orthostatic hypotension in patients with multiple system atrophy The Weinberg Group Ltd 02/08/2007
Lurbinectedin EU/3/12/1053 Treatment of ovarian cancer Pharma Mar S.A. 10/10/2012
Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide EU/3/07/523 Treatment of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 31/01/2008
Macitentan EU/3/09/707 Treatment of idiopathic pulmonary fibrosis Actelion Registration Ltd 28/01/2010
Macitentan EU/3/11/909 Treatment of pulmonary arterial hypertension Actelion Registration Ltd 27/09/2011 Opsumit
(manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21°-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) EU/3/07/522 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Celtic Bio-Pharma Services Ltd 31/01/2008
Mannitolum EU/3/05/325 Treatment of cystic fibrosis Pharmaxis Pharmaceuticals Limited 07/11/2005 Bronchitol
Maribavir EU/3/07/519 Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk ViroPharma SPRL-BVBA 18/12/2007
Maribavir EU/3/13/1133 Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity ViroPharma SPRL-BVBA 07/06/2013
Masitinib mesilate EU/3/09/684 Treatment of pancreatic cancer AB Science S.A. 28/10/2009
Mavoglurant EU/3/12/1046 Treatment of fragile X syndrome Novartis Europharm Limited 10/10/2012
Maytansinoid-conjugated human monoclonal antibody against mesothelin EU/3/12/1073 Treatment of malignant mesothelioma Bayer Pharma AG 06/12/2012
Maytansinoid-conjugated humanised monoclonal antibody against CD56 EU/3/10/792 Treatment of small cell lung cancer ImmunoGen Europe Limited 01/10/2010
Maytansinoid-conjugated humanised monoclonal antibody against CD56 EU/3/10/835 Treatment of multiple myeloma ImmunoGen Europe Limited 23/02/2011
Maytansinoid-conjugated humanised monoclonal antibody against CD56 EU/3/10/746 Treatment of Merkel cell carcinoma ImmunoGen Europe Limited 09/06/2010
Mecasermin EU/3/05/307 Treatment of primary growth hormone insensitivity syndrome Ipsen Pharma 26/08/2005
Mecasermin EU/3/06/373 Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects Ipsen Pharma 22/05/2006 INCRELEX
Mecasermin rinfabate EU/3/06/399 Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Premacure AB 28/08/2006
Melarsoprol EU/3/12/1068 Treatment of African trypanosomiasis Pr. Peter Kennedy 08/11/2012
Melatonin EU/3/05/274 Non-24-Hour Sleep-Wake Disorder in blind people with no light perception ICON Clinical Research (U.K.) Limited 11/04/2005
Melatonin EU/3/12/978 Treatment of perinatal asphyxia Dr. Nicola J. Robertson 02/04/2012
Mepolizumab EU/3/04/213 Treatment of hypereosinophilic syndrome Glaxo Group Ltd 29/07/2004
Mepolizumab EU/3/13/1116 Treatment of Churg-Strauss Syndrome Glaxo Group Ltd 12/03/2013
Mercaptopurine (oral liquid) EU/3/07/496 Treatment of acute lymphoblastic leukaemia Orbona Pharma Ltd 22/10/2007
Mercaptopurine (oral suspension) EU/3/09/628 Treatment of acute lymphoblastic leukaemia Nova Laboratories Limited 30/04/2009 Xaluprine
Metastable technetium 99 [99mTc] demogastrin 2 EU/3/06/400 Diagnosis of medullary thyroid carcinoma Biomedica Life Sciences SA 28/08/2006
Methotrexate (oral liquid) EU/3/07/495 Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 24/10/2007
Methoxsalen EU/3/06/374 Treatment of Graft-versus-Host disease Therakos (UK) Limited 22/05/2006
Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate EU/3/07/518 Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension Bayer Schering Pharma AG 20/12/2007 Adempas
Methyl O-4-O-[2-[2-[2-[2-[[N-[(1R)-1-[[4-(aminoiminomethyl)phenyl]methyl]-2-oxo-2-(1-piperidinyl)ethyl]-N2-[(4-methoxy-2,3,6-trimethylphenyl)sulfonyl]-L-a-asparaginyl-4-aminobutanoyl-N6-[5-[(3aS,4S,6aR)-hexahydro-2-oxo-1H-thieno[3,4-d]imidazol-4-yl]-1-oxopentyl]-L-lysyl]amino]ethoxy]ethoxy]ethoxy]ethyl]-2,3-di-O-methyl-6-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-ß-D-glucopyranuronosyl-(1->4)-O-2,3,6-tri-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-a-L-idopyranuronosyl-(1->4)-3-O-methyl-a-D-glucopyranoside 2,6-bis(hydrogen sulfate) octasodium salt EU/3/11/884 Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Endotis Pharma 05/08/2011
Methylthioninium EU/3/10/805 Treatment of behavioural variant frontotemporal dementia Prof. Claude Wischik 26/11/2010
Methylthioninium EU/3/10/806 Treatment of progressive non-fluent aphasia Prof. Claude Wischik 26/11/2010
Methylthioninium EU/3/10/804 Treatment of progressive supranuclear palsy Prof. Claude Wischik 26/11/2010
Methylthioninium EU/3/10/807 Treatment of frontotemporal dementia with parkinsonism-17 Prof. Claude Wischik 26/11/2010
Metreleptin EU/3/12/1022 Treatment of Familial Partial Lipodystrophy AstraZeneca AB 17/07/2012
Metreleptin EU/3/12/1024 Treatment of Lawrence syndrome Bristol-Myers Squibb/AstraZeneca EEIG 17/07/2012
Metreleptin EU/3/12/1023 Treatment of Barraquer-Simons syndrome AstraZeneca AB 17/07/2012
Metreleptin EU/3/12/1025 Treatment of Berardinelli-Seip syndrome Bristol-Myers Squibb/AstraZeneca EEIG 17/07/2012
Metronidazole EU/3/11/875 Treatment of pouchitis FORMAC Pharmaceuticals NV 21/06/2011
Mexiletine hydrochloride EU/3/13/1189 Treatment of myotonic disorders Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare 07/10/2013
Mexiletine hydrochloride EU/3/13/1126 Treatment of non-dystrophic myotonia Prof Michael Hanna 07/06/2013
Midostaurin EU/3/04/214 Treatment of acute myeloid leukaemia Novartis Europharm Limited 29/07/2004
Midostaurin EU/3/10/765 Treatment of mastocytosis Novartis Europharm Limited 04/08/2010
Mifepristone EU/3/11/925 Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin FGK Representative Service GmbH 27/10/2011
Mifepristone EU/3/09/614 Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin EXELGYN 27/02/2009
Miglustat EU/3/06/351 Treatment of Niemann-Pick disease, type C Actelion Registration Ltd 16/02/2006 Zavesca
Milatuzumab EU/3/08/602 Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 19/01/2009
Milatuzumab EU/3/08/601 Treatment of multiple myeloma Immunomedics GmbH 19/01/2009
Milciclib maleate EU/3/12/1059 Treatment of malignant thymoma Nerviano Medical Sciences Srl 08/11/2012
Miltefosine EU/3/05/282 Treatment of Acanthamoeba keratitis Orphanidis Pharma Research GmbH 27/05/2005
Miltefosine EU/3/02/104 Treatment of visceral leishmaniasis Zentaris GmbH 12/06/2002
Miltefosine EU/3/08/567 Treatment of cutaneous T-cell lymphoma ExperGen Drug Development GmbH 22/09/2008
Mitotane EU/3/02/102 Treatment of adrenal cortical carcinoma Laboratoire HRA Pharma 12/06/2002 Lysodren
Mixture of recombinant human IgG1 monoclonal antibodies against human cytomegalovirus envelope glycoproteins EU/3/14/1235 Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Roche Registration Limited 19/02/2014
Mixture of seven synthetic fragments consisting of p21 RAS peptides EU/3/11/885 Treatment of pancreatic cancer Targovax AS 05/08/2011
Mixture of two allogeneic human pancreatic cancer cell lines stably transduced with a retroviral vector encoding the murine alpha-(1,3)-galactosyltransferase gene EU/3/12/1048 Treatment of pancreatic cancer European Medical Advisory Services Limited 10/10/2012
Modified recombinant human C-type natriuretic peptide EU/3/12/1094 Treatment of achondroplasia BioMarin Europe Ltd 24/01/2013
Mogamulizumab EU/3/11/943 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) ProStrakan Limited 11/01/2012
Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E EU/3/08/596 Treatment of Hodgkin lymphoma Takeda Pharma A/S 15/01/2009 ADCETRIS
Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E EU/3/08/595 Treatment of anaplastic large cell lymphoma Takeda Pharma A/S 15/01/2009 ADCETRIS
Moxetumomab pasudotox EU/3/13/1150 Treatment of B-lymphoblastic leukaemia/lymphoma MedImmune Ltd 17/07/2013
Multilamellar microvesicle comprising phosphatidylcholine, sphingomyelin, phosphatidylethanolamine, phosphatidylserine, phospatidylinositol and cholesterol EU/3/11/896 Treatment of cystic fibrosis Lamellar Biomedical Ltd 30/08/2011
Muramyl tripeptide phosphatidyl ethanolamine EU/3/04/206 Treatment of osteosarcoma Takeda France SAS 21/06/2004 Mepact
Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 EU/3/08/592 Treatment of hairy cell leukaemia MedImmune Ltd 04/12/2008
Murine IgM monoclonal antibody binding to alpha beta T-cell receptor EU/3/13/1113 Prevention of graft rejection following solid organ transplantation CTI Clinical Trial and Consulting Services 12/03/2013
Murine monoclonal antibody against CD26 EU/3/10/808 Treatment of graft-versus-host disease ADIENNE S.r.l. 26/11/2010
Mycophenolate mofetil EU/3/05/298 Treatment of Cushing’s syndrome secondary to ectopic ACTH secretion Laboratoire HRA Pharma 27/07/2005
N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide EU/3/07/478 Treatment of Hodgkin lymphoma CanReg (Europe) Limited 14/09/2007
N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide EU/3/07/526 Treatment of acute myeloid leukaemia CanReg (Europe) Limited 31/01/2008
N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide EU/3/08/556 Treatment of cystic fibrosis Vertex Pharmaceuticals (U.K.) Limited 08/07/2008 Kalydeco
N-[2,6-bis(1-methylethyl)phenyl]-N’-[[1-[4-(dimethylamino) phenyl]cyclopentyl]methyl]urea, hydrochloride salt EU/3/13/1128 Treatment of adrenocortical carcinoma Atterocor Ltd 07/06/2013
N-{2-Chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N´-(5-methyl-3-isoxazolyl) urea hydrochloride monohydrate EU/3/10/747 Treatment of renal cell carcinoma Astellas Pharma Europe B.V. 09/06/2010
N2´-Deacetyl-N2´-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody EU/3/08/593 Treatment of multiple myeloma Biotest AG 03/12/2008
N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl) amino] isonicotinamide hydrochloride EU/3/10/824 Treatment of acute myeloid leukaemia Merck KGaA 17/12/2010
N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride EU/3/09/685 Treatment of pancreatic cancer Merck KGaA 09/11/2009
N-3[[4(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl) oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) EU/3/04/188 Treatment of moderate and severe traumatic brain injury Xytis Pharmaceuticals Limited 23/02/2004
N-(3-(5-fluoro-2-(4-(2-methoxyethoxy)phenylamino)pyrimidin-4-ylamino) phenyl)acrylamide benzenesulfonic acid salt EU/3/13/1234 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Celgene Europe Limited 16/01/2014
N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine to be used with folic acid EU/3/12/1043 Diagnosis of positive folate receptor status in ovarian cancer Endocyte Europe B.V. 10/09/2012 Folcepri
N-[4-(3-amino-1H-indazol-4-yl)phenyl]-N´-(2-fluoro-5-methylphenyl) urea EU/3/07/517 Treatment of hepatocellular carcinoma AbbVie Ltd 20/12/2007
N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide EU/3/08/568 Treatment of partial deep dermal and full thickness burn wounds Creative Antibiotics Sweden AB 22/09/2008
N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide EU/3/11/897 Treatment of tuberculosis Pfizer Limited 30/08/2011
N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt EU/3/09/622 Treatment of acute myeloid leukaemia Ambit Europe Limited 23/03/2009
N-(6-(2-aminophenylamino)-6-oxohexyl)-4-methylbenzamide EU/3/10/793 Treatment of Friedreich's ataxia Repligen Europe Limited 01/10/2010
N-acetylgalactosamine-4-sulfatase EU/3/01/025 Treatment of Mucopolysaccharidosis, type VI (Maroteaux-Lamy Syndrome) BioMarin Europe Ltd 14/02/2001 Naglazyme
N-adamantanyl-N'-geranyl-ethylenediamine EU/3/07/479 Treatment of tuberculosis RLM Consulting 14/09/2007
Nafamostat mesilate EU/3/10/782 Treatment of cystic fibrosis Mucokinetica Ltd 20/09/2010
Naloxone hydrochloride dihydrate EU/3/12/1057 Treatment of cutaneous T-cell lymphoma Winston Laboratories Ltd 08/11/2012
Nanobody directed towards the human A1 domain of von Willebrand factor EU/3/09/629 Treatment of thrombotic thrombocytopenic purpura Ablynx N.V. 30/04/2009
Nanoliposomal irinotecan EU/3/11/933 Treatment of pancreatic cancer Merrimack Pharmaceuticals UK Limited 09/12/2011
Naproxcinod EU/3/13/1194 Treatment of Duchenne muscular dystrophy NicOx 07/10/2013
Naptumomab estafenatox EU/3/07/480 Treatment of renal cell carcinoma Active Biotech AB 14/09/2007
N-Butyldeoxygalactonojirimycin EU/3/12/1033 Treatment of Fabry disease Actelion Registration Ltd 09/08/2012
N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)-propyl]-carbamoyl}-methyl)-2-[2-(2-fluoro-phenyl)-ethylamino]-N-isobutyl-acetamide EU/3/14/1248 Treatment of optic neuritis Bionure Farma SL 19/02/2014
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/887 Treatment of post-essential thrombocythaemia myelofibrosis Gilead Sciences International Ltd 05/08/2011
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/888 Treatment of primary myelofibrosis Gilead Sciences International Limited 05/08/2011
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/886 Treatment of post-polycythaemia vera myelofibrosis Gilead Sciences International Ltd 05/08/2011
nelarabine EU/3/05/293 Treatment of acute lymphoblastic leukaemia Glaxo Group Ltd 16/06/2005 Atriance
Nemorubicin hydrochloride EU/3/05/300 Treatment of hepatocellular carcinoma Nerviano Medical Sciences Srl 28/07/2005
NGR-human tumour necrosis factor EU/3/09/686 Treatment of hepatocellular carcinoma MolMed S.p.A. 09/11/2009
NGR-human tumour necrosis factor EU/3/08/549 Treatment of malignant mesothelioma MolMed S.p.A. 03/06/2008
NH2-Cys-Ser-Ser-Val-Thr-Ala-Trp-Thr-Thr-Gly-Cys-Gly-CONH2 EU/3/11/910 Treatment of traumatic spinal cord injury PHARMAXON 27/09/2011
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/997 Treatment of schwannoma Sirius Regulatory Consulting Limited 06/06/2012
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/996 Treatment of meningioma Sirius Regulatory Consulting Limited 06/06/2012
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/993 Treatment of neurofibromatosis type 2 Sirius Regulatory Consulting Limited 26/04/2012
Nilotinib EU/3/06/375 Treatment of chronic myeloid leukaemia Novartis Europharm Limited 22/05/2006 Tasigna
Nimorazole EU/3/10/842 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Azanta A/S 23/02/2011
Nimorazole maleate EU/3/12/952 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Conventia Medical LLP 09/02/2012
Nimotuzumab EU/3/08/550 Treatment of pancreatic cancer Oncoscience AG 03/06/2008
Nintedanib EU/3/13/1123 Treatment of idiopathic pulmonary fibrosis Boehringer Ingelheim International GmbH 26/04/2013
Nitisinone EU/3/02/096 Treatment of alkaptonuria Swedish Orphan International AB 13/03/2002
nitisinone EU/3/00/012 Treatment of tyrosinaemia type I Swedish Orphan Biovitrum International AB 29/12/2000 Orfadin
Nitric oxide EU/3/13/1209 Treatment of cystic fibrosis Novoteris 18/12/2013
[Nle4, D-Phe7]-alpha-melanocyte stimulating hormone EU/3/08/541 Treatment of erythropoietic protoporphyria Clinuvel (UK) Limited 08/05/2008
[Nle4, D-Phe7]-alpha-melanocyte stimulating hormone EU/3/08/545 Treatment of congenital erythropoietic porphyria Clinuvel (UK) Limited 08/05/2008
N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate EU/3/06/401 Treatment of familial amyloid polyneuropathy Pfizer Limited 28/08/2006 Vyndaqel
N-methyl-4-({4-[({3-methyl(methylsulfonyl)aminopyrazin-2-yl}methyl)amino]-5-(trifluoromethyl)pyrimidin-2-yl}amino)benzamide hydrochloride EU/3/13/1132 Treatment of malignant mesothelioma TMC Pharma Services Ltd. 07/06/2013
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/04/242 Treatment of mastocytosis OxThera AB 16/11/2004
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/04/251 Treatment of malignant gastro intestinal stromal tumours AB Science S.A. 21/12/2004
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/05/286 Treatment of multiple myeloma Dr. Geoffrey Allan 20/06/2005
N,N'-bis(2-mercaptoethyl)isophthalamide EU/3/11/944 Treatment of mercury toxicity CTI Science Limited 11/01/2012
N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase EU/3/09/615 Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) Dr. Ulrich Granzer 27/02/2009
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/810 Treatment of post-essential thrombocythaemia myelofibrosis Sanofi-Aventis groupe 26/11/2010
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/811 Treatment of post-polycythaemia vera myelofibrosis Sanofi-Aventis groupe 26/11/2010
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/794 Treatment of primary myelofibrosis Sanofi-Aventis groupe 01/10/2010
Obeticholic acid EU/3/13/1228 Treatment of primary sclerosing cholangitis Intercept Italia S.R.L. 16/01/2014
Obinutuzumab EU/3/12/1054 Treatment of chronic lymphocytic leukaemia Roche Registration Limited 10/10/2012
Octenidine dihydrochloride EU/3/10/755 Prevention of late-onset sepsis in premature infants of less than or equal to 32 weeks of gestational age Schülke & Mayr GmbH 27/07/2010
Octreotide acetate (oral use) EU/3/13/1170 Treatment of acromegaly Larode Ltd 05/08/2013
Octreotide chloride (lipid depot solution) EU/3/09/645 Treatment of acromegaly Camurus AB 12/06/2009
Ofatumumab EU/3/08/581 Treatment of chronic lymphocytic leukaemia Glaxo Group Ltd 07/11/2008 Arzerra
Olaparib EU/3/07/501 Treatment of ovarian cancer AstraZeneca AB 06/12/2007
Oleylphosphocholine EU/3/12/964 Treatment of leishmaniasis Dafra Pharma International NV 23/04/2012
Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt EU/3/05/327 Treatment of glioma Oligovax 28/10/2005
Ombrabulin EU/3/11/853 Treatment of soft tissue sarcoma Sanofi-Aventis groupe 15/04/2011
Omigapil maleate EU/3/08/544 Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency Santhera Pharmaceuticals (Deutschland) GmbH 08/05/2008
Omigapil maleate EU/3/08/540 Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). Santhera Pharmaceuticals (Deutschland) GmbH 08/05/2008
Oregovomab EU/3/02/109 Treatment of ovarian cancer ViRexx International Corp. Limited 30/07/2002
Ornithine phenylacetate EU/3/11/945 Treatment of acute liver failure Dr. Ulrich Granzer 11/01/2012
Ovine anti-colchicine polyclonal antibody fragments EU/3/10/825 Treatment of colchicine poisoning Laboratoires SERB 17/12/2010
Oxalobacter formigenes strain HC-1 EU/3/06/354 Treatment of primary hyperoxaluria OxThera AB 17/02/2006
Paclitaxel (aqueous gel) EU/3/10/846 Treatment of oesophagus carcinoma BTG plc 23/02/2011
Paclitaxel (liposomal) EU/3/06/419 Treatment of pancreatic cancer MediGene AG 31/10/2006
Paclitaxel (micellar) EU/3/06/422 Treatment of ovarian cancer Oasmia Pharmaceutical AB 18/12/2006
Palifosfamide EU/3/08/584 Treatment of soft tissue sarcoma Ziopharm Oncology Limited 03/12/2008
Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) EU/3/04/222 Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Eli Lilly Nederland B.V. 02/09/2004
Panobinostat EU/3/12/1063 Treatment of multiple myeloma Novartis Europharm Limited 08/11/2012
Paquinimod EU/3/10/836 Treatment of systemic sclerosis Active Biotech AB 23/02/2011
Para-aminosalicylic acid EU/3/10/826 Treatment of tuberculosis Lucane Pharma SA 17/12/2010 Para-aminosalicylic acid Lucane
Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex EU/3/06/367 Treatment of solitary bone cysts Kuros Biosurgery International AG 11/04/2006
pasireotide EU/3/09/670 Treatment of acromegaly Novartis Europharm Limited 08/10/2009
pasireotide EU/3/09/671 Treatment of Cushing's disease Novartis Europharm Limited 08/10/2009 Signifor
Pegylated arginine deiminase EU/3/05/289 Treatment of hepatocellular carcinoma Dr. Francesco Izzo 20/06/2005
Pegylated B-domain-deleted sequence-modified recombinant human factor VIII EU/3/10/847 Treatment of haemophilia A Bayer Schering Pharma AG 23/02/2011
Pegylated carboxyhaemoglobin EU/3/09/698 Treatment of sickle cell disease Voisin Consulting S.A.R.L. 26/11/2009
Pegylated L-asparaginase EU/3/08/569 Treatment of acute lymphoblastic leukaemia Sigma-Tau Rare Diseases, S.A. 22/09/2008
Pegylated proline-interferon alpha-2b EU/3/11/932 Treatment of polycythaemia vera AOP Orphan Pharmaceuticals AG 09/12/2011
Pegylated recombinant anti-Pseudomonas aeruginosa PcrV Fab' antibody EU/3/13/1178 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis KaloBios Ltd 05/08/2013
Pegylated recombinant Erwinia chrysanthemi L-asparaginase EU/3/11/889 Treatment of acute lymphoblastic leukaemia EUSA Pharma SAS 05/08/2011
Pegylated recombinant factor VIIa EU/3/08/551 Treatment of haemophilia A Novo Nordisk A/S 04/06/2008
Pegylated recombinant factor VIIa EU/3/08/552 Treatment of haemophilia B Novo Nordisk A/S 03/06/2008
Pegylated recombinant factor VIII EU/3/12/995 Treatment of haemophilia A Novo Nordisk A/S 26/04/2012
Pegylated recombinant human factor IX EU/3/09/640 Treatment of haemophilia B Novo Nordisk A/S 15/05/2009
Pegylated recombinant phenylalanine ammonia lyase EU/3/09/708 Treatment of hyperphenylalaninaemia BioMarin Europe Ltd 28/01/2010
Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) EU/3/05/326 Treatment of systemic sclerosis Digna Biotech S.L. 28/10/2005
Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) EU/3/05/329 Treatment of the localised scleroderma Digna Biotech S.L. 28/10/2005
Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis EU/3/09/689 Treatment of myasthenia gravis CuraVac Europe SA 09/11/2009
Peretinoin EU/3/11/890 Treatment of hepatocellular carcinoma Kowa Pharmaceutical Europe Co. Ltd. 05/08/2011
Phenylephrine Hydrochloride EU/3/01/069 Treatment of ileal pouch anal anastomosis related faecal incontinence S.L.A. Pharma (UK) Limited 20/11/2001
Phosphorothioate oligonucleotide targeted to apolipoprotein C-III EU/3/14/1249 Treatment of familial chylomicronemia syndrome Isis USA Ltd 19/02/2014
Phosphorothioate oligonucleotide targeted to transthyretin EU/3/14/1250 Treatment of ATTR amyloidosis Isis USA Ltd 26/03/2014
Pioglitazone EU/3/14/1245 Treatment of adrenoleukodystrophy Minoryx Therapeutics S.L. 19/02/2014
Pirfenidone EU/3/04/241 Treatment of idiopathic pulmonary fibrosis InterMune UK Limited 16/11/2004 Esbriet
Plerixafor EU/3/11/931 Adjunctive treatment to cytotoxic therapy in acute myeloid leukaemia Genzyme Europe B.V. 09/12/2011
Polihexanide EU/3/07/498 Treatment of Acanthamoeba keratitis S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. 14/11/2007
Poloxamer 188 EU/3/13/1112 Treatment of sickle cell disease Theradex (Europe) Ltd. 12/03/2013
Poly[2-[(4-{[1-carboxy-2-(hexadecylcarbamoyl)ethyl]sulfanyl}-2,3-bis({2-[((2S)-2-(2-{[(2R)-2-carbamoyl-(2-{[(2S)-1-ethoxy-3-(3-hydroxy-4oxo-1,4-dihydropyridin-1-yl)-1-oxopropan-2-yl]carbamoyl}ethyl]sulfanyl}-3-{[(2S)-1-ethoxy-3-(3-hydroxy-4-oxo-1,4-dihydropyridin-1-yl)-1-oxopropan-2-yl]carbamoyl}propanamido)-3-(3-hydroxy-4-oxo-1,4-dihydropyridin-1-yl)propanoyl Ethyl ester) )-methoxy]acetyl}oxy)butyl)sulfanyl]-3-(hexadecylcarbamoyl)propanoic acid]-poly(ethylene glycol)-ester] EU/3/13/1220 Treatment of dengue Coté Orphan Consulting UK Limited 18/12/2013
Pomalidomide EU/3/10/758 Treatment of post-polycythaemia vera myelofibrosis Celgene Europe Limited 27/07/2010
Pomalidomide EU/3/10/757 Treatment of primary myelofibrosis Celgene Europe Limited 27/07/2010
Pomalidomide EU/3/10/759 Treatment of post-essential thrombocythaemia myelofibrosis Celgene Europe Limited 27/07/2010
Pomalidomide EU/3/12/986 Treatment of systemic sclerosis Celgene Europe Limited 26/04/2012
Pomalidomide EU/3/09/672 Treatment of multiple myeloma Celgene Europe Limited 08/10/2009 Imnovid (Ex Pomalidomide Celgene)
Pralatrexate EU/3/07/444 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Allos Therapeutics Limited 13/04/2007
Pralatrexate EU/3/10/741 Treatment of cutaneous T-cell lymphoma Allos Therapeutics Limited 10/06/2010
Pralatrexate EU/3/10/795 Treatment of Hodgkin's lymphoma Allos Therapeutics Limited 01/10/2010
Pralatrexate EU/3/08/603 Treatment of non-papillary transitional cell carcinoma of the urinary bladder Allos Therapeutics Limited 19/01/2009
Prasterone EU/3/03/156 Treatment of adrenal insufficiency Medicom Healthcare BV 28/07/2003
Pravastatin / zoledronic acid EU/3/10/748 Treatment of Hutchinson-Gilford progeria Prenyl BIO SAS 09/06/2010
Progesterone EU/3/13/1101 Treatment of moderate and severe traumatic brain injury BHR Pharma Belgium 08/02/2013
Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein EU/3/02/101 Treatment of glioma EUDRAC Limited 30/04/2002
Purified bromelain EU/3/02/107 Treatment of partial deep dermal and full thickness burns MediWound Germany GmbH 30/07/2002 NexoBrid
Pyr-His-Trp-Ser-Tyr-D-Lys(doxorubicinylglutarate)-Leu-Arg-Pro-Gly-NH2, acetate salt EU/3/10/766 Treatment of ovarian cancer Æterna Zentaris GmbH 04/08/2010
Pyridoxalated haemoglobin polyoxyethylene EU/3/07/463 Treatment of cardiogenic shock Curacyte AG 02/08/2007
R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H -1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea EU/3/07/452 Treatment of gastric carcinoid Trio Medicines Ltd 14/06/2007
(R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole EU/3/07/524 Treatment of tuberculosis Otsuka Novel Products GmbH 01/02/2008 Deltyba
(R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate EU/3/09/620 Treatment of myelofibrosis secondary to polycythemia vera or essential thrombocythemia Novartis Europharm Limited 03/04/2009 Jakavi
(R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate EU/3/08/572 Treatment of chronic idiopathic myelofibrosis Novartis Europharm Limited 07/11/2008 Jakavi
Raloxifene hydrochloride EU/3/10/730 Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 10/06/2010
Ramiprilat EU/3/13/1117 Treatment of Stargardt’s disease Iris Pharma 12/03/2013
Ramoplanin EU/3/01/049 Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection Vicuron Pharmaceuticals Italy srl, 09/07/2001
Ramucirumab EU/3/12/1004 Treatment of gastric cancer Eli Lilly Nederland B.V. 04/07/2012
Ramucirumab EU/3/12/1019 Treatment of hepatocellular carcinoma Eli Lilly Nederland B.V. 04/07/2012
R-baclofen EU/3/11/858 Treatment of fragile X syndrome Lakeside Regulatory Consulting Services Ltd 15/04/2011
Recombinant adeno-associated viral vector containing human acid alfa-glucosidase-gene EU/3/12/1018 Treatment of glycogen storage disease type II (Pompe's disease) TMC Pharma Services Ltd. 04/07/2012
Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene EU/3/07/440 Treatment of congenital alpha-1 antitrypsin deficiency TMC Pharma Services Ltd. 20/03/2007
Recombinant adeno-associated viral vector containing the human CNGB3 gene EU/3/13/1099 Treatment of achromatopsia caused by mutations in the CNGB3 gene TMC Pharma Services Ltd. 08/02/2013
Recombinant antibody construct against human CD30 and CD16A EU/3/09/673 Treatment of Hodgkin lymphoma Affimed Therapeutics AG 09/10/2009
Recombinant antibody derivative against human CD19 and CD3 EU/3/03/176 Treatment of chronic lymphocytic leukaemia Amgen Europe B.V. 01/12/2003
Recombinant antibody derivative against human CD19 and CD3 EU/3/03/175 Treatment of mantle cell lymphoma Amgen Europe B.V. 01/12/2003
Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein EU/3/12/1039 Treatment of cutaneous T-cell lymphoma AOP Orphan Pharmaceuticals AG 09/08/2012
Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein EU/3/12/1038 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) AOP Orphan Pharmaceuticals AG 09/08/2012
Recombinant chimeric monoclonal antibody against CD20 EU/3/09/699 Treatment of chronic lymphocytic leukaemia LFB-Biotechnologies 26/11/2009
Recombinant derivative of C3 transferase EU/3/08/563 Treatment of traumatic spinal cord injury Triskel EU Services Ltd. 05/09/2008
Recombinant dog gastric lipase EU/3/03/157 Treatment of cystic fibrosis Meristem Therapeutics S.A. 09/07/2003
Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 EU/3/07/453 Treatment of haemophilia B (congenital factor IX deficiency) Biogen Idec Limited 08/06/2007
Recombinant fusion protein consisting of human coagulation factor VIII attached to the Fc domain of human IgG1 EU/3/10/783 Treatment of haemophilia A Biogen Idec Limited 20/09/2010
Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/06/411 Prevention of Graft-versus-Host disease Apogenix GmbH 31/10/2006
Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/09/709 Treatment of glioma Apogenix GmbH 28/01/2010
Recombinant fusion protein consisting of the extracellular portion of human activin receptor IIB linked to the human IgG1 Fc domain EU/3/10/812 Treatment of Duchenne muscular dystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
Recombinant fusion protein linking coagulation factor VIIa with albumin EU/3/13/1188 Treatment of congenital factor VII deficiency CSL Behring GmbH 07/10/2013
Recombinant fusion protein linking human coagulation factor IX with human albumin EU/3/09/723 Treatment of haemophilia B CSL Behring GmbH 04/02/2010
Recombinant fusion protein linking human coagulation factor VIIa with human albumin EU/3/11/855 Treatment of haemophilia A CSL Behring GmbH 15/04/2011
Recombinant fusion protein linking human coagulation factor VIIa with human albumin EU/3/11/863 Treatment of haemophilia B CSL Behring GmbH 13/05/2011
Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] EU/3/08/553 Treatment of glioma Gregory Fryer Associates Ltd 03/06/2008
Recombinant glycoprotein gp350 of Epstein-Barr virus EU/3/02/118 Prevention of post transplantation lympho-proliferative disorders Henogen S.A. 22/10/2002
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/09/656 Treatment of diffuse large B-cell lymphoma CellGenix GmbH 24/07/2009
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/250 Treatment of mantle cell lymphoma CellGenix GmbH 21/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/249 Treatment of follicular lymphoma CellGenix GmbH 23/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/248 Treatment of multiple myeloma CellGenix GmbH 21/12/2004
Recombinant human acid alpha-glucosidase EU/3/00/018 Treatment of Glycogen Storage Disease type II (Pompe´s disease) Genzyme Europe B.V. 14/02/2001 Myozyme
Recombinant human acid ceramidase EU/3/14/1243 Treatment of Farber disease QOL Therapeutics UK Ltd 21/02/2014
Recombinant human acid sphingomyelinase EU/3/01/056 Treatment of Niemann-Pick Disease, type B Genzyme Europe B.V. 19/09/2001
Recombinant human ADAMTS-13 EU/3/08/588 Treatment of thrombotic thrombocytopenic purpura Baxter AG 03/12/2008
Recombinant human alpha-glucosidase conjugated with multiple copies of synthetic bismannose-6-phosphate-tetra-mannose glycan EU/3/14/1251 Treatment of glycogen storage disease type II (Pompe's disease) Genzyme Europe B.V. 26/03/2014
Recombinant human alpha-Mannosidase EU/3/04/260 Treatment of alpha-Mannosidosis Zymenex A/S 26/01/2005
Recombinant human alpha-N-acetylglucosaminidase EU/3/13/1144 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Synageva BioPharma Ltd. 19/06/2013
Recombinant human anti-interferon gamma monoclonal antibody EU/3/10/749 Treatment of haemophagocytic lymphohistiocytosis NovImmune B.V. 09/06/2010
Recombinant human arylsulfatase A EU/3/10/813 Treatment of metachromatic leukodystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
Recombinant human beta-glucuronidase EU/3/12/973 Treatment of mucopolysaccharidosis type VII (Sly syndrome) NDA Group AB 21/03/2012
Recombinant human bile salt-stimulated lipase EU/3/04/257 Treatment of cystic fibrosis Arexis AB 26/01/2005
Recombinant human C1-inhibitor EU/3/07/435 Prevention of delayed graft function after solid organ transplantation Pharming Group N.V. 20/02/2007
Recombinant human CXCL8 mutant EU/3/08/570 Prevention of delayed graft function after solid organ transplantation ProtAffin Biotechnologie AG 22/09/2008
Recombinant human CXCL8 mutant EU/3/13/1131 Treatment of cystic fibrosis ProtAffin Biotechnologie AG 07/06/2013
Recombinant human dyskerin EU/3/12/1070 Treatment of dyskeratosis congenita Advanced Medical Projects 08/11/2012
Recombinant human elafin EU/3/09/710 Treatment of oesophagus carcinoma Proteo Biotech AG 28/01/2010
Recombinant human galactocerebrosidase EU/3/11/911 Treatment of globoid cell leukodystrophy (Krabbe disease) ACE BioSciences A/S 27/09/2011
Recombinant human growth hormone modified by fusion with two hydrophilic polypeptide chains EU/3/13/1179 Treatment of growth hormone deficiency Larode Ltd 05/08/2013
Recombinant human heat shock protein 70 EU/3/13/1110 Treatment of Niemann-Pick disease, type C Orphazyme ApS 12/03/2013
Recombinant human heparan N-sulfatase EU/3/08/582 Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) Shire Pharmaceutical Development Limited 07/11/2008
Recombinant human hepatitis C monoclonal antibody against C4 region of E1 EU/3/07/503 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 06/12/2007
Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein EU/3/08/611 Treatment of acute liver failure Alfact Innovation SAS 11/02/2009
Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 EU/3/10/840 Treatment of acute lymphoblastic leukaemia Xenetic Biosciences Plc 23/02/2011
Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 EU/3/07/516 Treatment of acute myeloid leukaemia Xenetic Biosciences Plc 20/12/2007
Recombinant human insulin receptor monoclonal antibody-fused iduronate 2-sulfatase EU/3/13/1198 Treatment of mucopolysaccharidosis type II (Hunter's syndrome) Voisin Consulting S.A.R.L. 13/11/2013
Recombinant human interleukin-21 EU/3/04/226 Treatment of renal cell carcinoma Bristol-Myers Squibb International Corporation 02/09/2004
Recombinant human interleukin-7 EU/3/12/1013 Treatment of progressive multifocal leukoencephalopathy CYTHERIS SA 04/07/2012
Recombinant human lecithin cholesterol acyltransferase EU/3/12/1051 Treatment of lecithin cholesterol acyltransferase deficiency Alphacore Pharma Limited 10/10/2012
Recombinant human lysosomal acid lipase EU/3/10/827 Treatment of lysosomal acid lipase deficiency Synageva BioPharma Ltd. 17/12/2010
Recombinant human methionine proinsulin EU/3/12/985 Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 26/04/2012
Recombinant human minibody against complement component C5 EU/3/08/571 Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system ADIENNE S.r.l. 22/09/2008
Recombinant human minibody against complement component C5 EU/3/11/926 Treatment of primary membranoproliferative glomerulonephritis ADIENNE S.r.l. 27/10/2011
Recombinant Human minibody against complement component C5 fused with RGD-motif EU/3/08/604 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation ADIENNE S.r.l. 20/01/2009
Recombinant human monoclonal antibody against activin receptor type IIB EU/3/12/1035 Treatment of inclusion body myositis Novartis Europharm Limited 09/08/2012
Recombinant human monoclonal antibody against hepatitis B virus EU/3/13/1156 Prevention of hepatitis B re-infection following liver transplantation CRO-PharmaNet Services GmbH 17/07/2013
Recombinant human monoclonal antibody against transforming growth factor beta-1, 2 and 3 EU/3/08/533 Treatment of idiopathic pulmonary fibrosis Genzyme Europe B.V. 01/04/2008
Recombinant human monoclonal antibody of the IgG1 kappa class against prostate stem cell antigen EU/3/12/1090 Treatment of pancreatic cancer Astellas Pharma Europe B.V. 24/01/2013
Recombinant human monoclonal antibody to human interleukin (IL)-17A of the IgG1/k class EU/3/09/724 Treatment of chronic non-infectious uveitis Novartis Europharm Limited 02/02/2010
Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class EU/3/08/605 Treatment of spinal cord injury Novartis Europharm Limited 19/01/2009
Recombinant human monoclonal IgM antibody targeting glucose-regulated protein 78 EU/3/13/1190 Treatment of plasma cell myeloma Patrys GmbH 07/10/2013
Recombinant human N-acetylgalactosamine-6-sulfatase EU/3/09/657 Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) BioMarin Europe Ltd 24/07/2009 Vimizim
Recombinant human nerve growth factor EU/3/13/1135 Treatment of retinitis pigmentosa Dompé S.p.A. 07/06/2013
Recombinant human parathyroid hormone EU/3/13/1210 Treatment of hypoparathyroidism NPS Phama UK Ltd 18/12/2013
Recombinant human pentraxin-2 EU/3/12/1020 Treatment of idiopathic pulmonary fibrosis Appletree Europe S.à.r.l. 17/07/2012
Recombinant Human Porphobilinogen Deaminase EU/3/02/103 Treatment of acute intermittent porphyria Zymenex A/S 12/06/2002
Recombinant human proinsulin EU/3/08/612 Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 11/02/2009
Recombinant human rod-derived cone viability factor EU/3/07/500 Treatment of retinitis pigmentosa Fovea Pharmaceuticals SA 29/11/2007
Recombinant human soluble Fc-gamma receptor Iib EU/3/07/462 Treatment of idiopathic thrombocytopenic purpura SuppreMol GmbH 02/08/2007
Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein EU/3/08/594 Treatment of hypophosphatasia Alexion Europe SAS 03/12/2008
Recombinant human transglutaminase 1 encapsulated into liposomes EU/3/13/1130 Treatment of transglutaminase-1-deficient autosomal recessive congenital ichthyosis Westfälische Wilhelms-Universität Münster 07/06/2013
Recombinant human tripeptidyl-peptidase 1 EU/3/13/1118 Treatment of neuronal ceroid lipofuscinosis type 2 BioMarin Europe Ltd 12/03/2013
Recombinant human type I pancreatic elastase EU/3/13/1218 Prevention of arteriovenous access dysfunction in haemodialysis patients Proteon Therapeutics Limited 18/12/2013
Recombinant human vascular endothelial growth factor EU/3/09/711 Treatment of amyotrophic lateral sclerosis Newron Sweden AB 29/01/2010
Recombinant human von Willebrand factor EU/3/10/814 Treatment of von Willebrand disease Baxter Innovations GmbH 26/11/2010
Recombinant humanised anti-human interleukin-1 beta monoclonal antibody EU/3/10/796 Treatment of Behçet's disease Les Laboratoires Servier 01/10/2010
Recombinant humanised monoclonal antibody to human Nogo-A protein of the IgG1/kappa class EU/3/10/797 Treatment of amyotrophic lateral sclerosis Glaxo Group Ltd 01/10/2010
Recombinant inhibitor of human plasma kallikrein EU/3/02/126 treatment of angioedema Dyax s.a. 18/12/2002
Recombinant kallikrein inhibitor EU/3/09/712 Treatment of Netherton syndrome Dermadis S.A.S. 29/01/2010
Recombinant megakaryopoeisis-stimulating protein EU/3/05/283 Treatment of idiopathic thrombocytopenic purpura Amgen Europe B.V. 27/05/2005 Nplate
Recombinant modified human growth hormone EU/3/12/1087 Treatment of growth hormone deficiency Richardson Associates Regulatory Affairs Ltd 24/01/2013
Recombinant modified vaccinia Ankara expressing human 5T4 EU/3/06/429 Treatment of renal cell carcinoma Oxford Biomedica (UK) Ltd 26/01/2007
Recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A EU/3/05/318 Prevention of tuberculosis disease in BCG vaccinated individuals University of Oxford 28/10/2005
Recombinant porcine factor VIII (B domain deleted) EU/3/10/784 Treatment of haemophilia A Baxter Innovations GmbH 20/09/2010
Recombinant protein consisting of modified human growth hormone releasing hormone and the translocation and endopeptidase domains of botulinum toxin serotype D EU/3/11/947 Treatment of acromegaly Syntaxin Limited 11/01/2012
Recombinant P-selectin glycoprotein immunoglobulin EU/3/06/376 Prevention of post transplantation graft dysfunction RJM Consultancy Ltd 22/05/2006
Recombinant thymidine phosphorylase encapsulated in autologous erythrocytes EU/3/11/856 Treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) due to thymidine phosphorylase deficiency St George's University of London 15/04/2011
Reparixin EU/3/11/912 Prevention of graft rejection in pancreatic islet transplantation Dompé S.p.A. 27/09/2011
Repertaxin L-lysine salt EU/3/01/058 Prevention of delayed graft function in organ transplant Dompé S.p.A. 19/09/2001
Resminostat EU/3/11/913 Treatment of hepatocellular carcinoma 4SC AG 27/09/2011
Resminostat EU/3/11/930 Treatment of Hodgkin's lymphoma 4SC AG 09/12/2011
Retroviral gamma-c cDNA containing vector EU/3/01/038 Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease GENOPOIETIC S.A.S. 30/05/2001
Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide EU/3/08/542 Treatment of acute myeloid leukaemia Dr. Ulrich Granzer 08/05/2008
Rifapentine EU/3/10/750 Treatment of tuberculosis Sanofi-Aventis groupe 09/06/2010
Rilonacept EU/3/07/456 Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA) Regeneron UK Limited 10/07/2007 Rilonacept Regeneron
RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´[2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride EU/3/08/586 Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 03/12/2008
RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´[2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride EU/3/09/725 Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 02/02/2010
R-salbutamol sulphate EU/3/07/481 Treatment of cutaneous forms of lupus erythematosus Astion Pharma A/S 14/09/2007
R,S-O-(3-piperidino-2-hydroxy-1-propyl)-nicotinic acid amidoxime dihydrochloride EU/3/13/1122 Treatment of Duchenne muscular dystrophy N-GENE Kutatási és Fejlesztési Kft 26/04/2013
Rubitecan EU/3/03/145 Treatment of pancreatic cancer Eurogen Pharmaceuticals Limited 10/06/2003
Rucaparib EU/3/12/1049 Treatment of ovarian cancer Clovis Oncology UK Limited 10/10/2012
Rufinamide EU/3/04/240 Treatment of Lennox-Gastaut syndrome Eisai Limited 20/10/2004 Inovelon
Ruxolitinib EU/3/14/1244 Treatment of polycythaemia vera Novartis Europharm Limited 19/02/2014
S[+] apomorphine EU/3/12/954 Treatment of amyotrophic lateral sclerosis University of Sheffield 09/02/2012
(S)-10-[(dimethylamino)methyl]-4-ethyl-9-hydroxy-4-O-[alpha-(2´´, 4´´, 5´´, 7´´-tetranitro-9´´-fluorenylideneaminooxy)propionyl]-1H-pyrano[3´, 4´, 6´, 7´]indolizino[1,2-beta]-quinoline-3, 14-(4H), 12H)-dione, hydrochloride EU/3/10/788 Treatment of hepatocellular carcinoma TLC Biopharmaceuticals B.V. 01/10/2010
S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK EU/3/09/634 Treatment of pancreatic cancer MBiotec GmbH 15/05/2009
(S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine EU/3/07/513 Treatment of tuberculosis Dr. Ulrich Granzer 29/11/2007
(S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one EU/3/13/1125 Treatment of chronic lymphocytic leukaemia/small lymphocytic lymphoma Voisin Consulting S.A.R.L. 26/04/2013
(S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one EU/3/13/1157 Treatment of follicular lymphoma Voisin Consulting S.A.R.L. 17/07/2013
(S)-3´-(OH)-desazadesferrithiocin-polyether, magnesium salt EU/3/09/647 Treatment of chronic iron overload requiring chelation therapy Shire Pharmaceutical Development Limited 24/07/2009
(S)-{8-fluoro-2-2[4-(3-methoxyphenyl)-1-piperazinyl]-3-[2-methoxy-5-(trifluoromethyl)-phenyl]-3,4-dihydro-4-quinazolinyl} acetic acid EU/3/11/849 Prevention of cytomegalovirus disease in patients with impaired cell-mediated immunity deemed at risk Merck Sharp & Dohme Limited 15/04/2011
Sacrosidase EU/3/13/1183 Treatment of congenital sucrase-isomaltase deficiency QOL Therapeutics UK Ltd 05/08/2013
Salirasib EU/3/11/871 Treatment of pancreatic cancer Kadmon International Ltd. 21/06/2011
Sapacitabine EU/3/08/558 Treatment of acute myeloid leukaemia Cyclacel Limited 10/07/2008
Sapacitabine EU/3/08/557 Treatment of myelodysplastic syndromes Cyclacel Limited 08/07/2008
Sequence-modified recombinant human factor VIIa EU/3/09/676 Treatment of haemophilia B Bayer Schering Pharma AG 08/10/2009
Sequence-modified recombinant human factor VIIa EU/3/09/675 Treatment of haemophilia A Bayer Schering Pharma AG 09/10/2009
(S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate EU/3/09/661 Treatment of carcinoid tumours Lexicon Celtic Limited 08/10/2009
Sialic acid EU/3/12/972 Treatment of hereditary inclusion body myopathy NDA Group AB 05/03/2012
Sildenafil citrate EU/3/03/178 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Pfizer Limited 12/12/2003 Revatio
Sildenafil citrate EU/3/10/815 Treatment of postcardiotomy right ventricular failure Pfizer Limited 26/11/2010
Silibinin-C-2',3-dihydrogensuccinate, disodium salt EU/3/10/828 Prevention of recurrent hepatitis C in liver transplant recipients Rottapharm S.p.A 17/12/2010
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/04/217 Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/04/216 Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/01/079 Treatment of acute lung injury Pharm Research Associates (UK) Limited 04/02/2002
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol, sodium salt and palmitic acid EU/3/11/927 Treatment of cystic fibrosis Pharm Research Associates (UK) Limited 27/10/2011
Sirolimus EU/3/11/898 Treatment of chronic non-infectious uveitis Santen Oy 30/08/2011
Sirolimus EU/3/13/1204 Prevention of arteriovenous access dysfunction in patients undergoing surgical creation of an arteriovenous access for haemodialysis S-cubed Ltd 13/11/2013
Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector EU/3/09/630 Treatment of dystrophic epidermolysis bullosa Prof. Alain Hovnanian 30/04/2009
Smilagenin EU/3/11/914 Treatment of amyotrophic lateral sclerosis QRC Consultants Ltd. 27/09/2011
S-nitrosoglutathione EU/3/11/870 Treatment of pre-eclampsia Salupont Consulting Ltd 13/05/2011
Sodium butyrate (rectal use) EU/3/05/284 Prevention of radiation proctitis Promefarm srl 27/05/2005
Sodium chlorite EU/3/13/1139 Treatment of amyotrophic lateral sclerosis Shore Limited 19/06/2013
Sodium nitrite EU/3/13/1224 Treatment of aneurysmal subarachnoid haemorrhage Hope Pharmaceuticals, Ltd 16/01/2014
Sodium nitrite EU/3/12/967 Treatment of pulmonary arterial hypertension FGK Representative Service GmbH 05/03/2012
Sodium phenylbutyrate EU/3/11/948 Treatment of 5q spinal muscular atrophy GMP-Orphan SAS 11/01/2012
Sodium thiosulfate EU/3/10/848 Treatment of calciphylaxis Dr. Franz Köhler Chemie GmbH 23/02/2011
Sodium thiosulfate EU/3/12/979 Treatment of calciphylaxis Aptiv Solutions (UK) Limited 02/04/2012
Soluble yeast beta-1,3/1,6-glucan EU/3/05/294 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Biotec Pharmacon ASA 16/06/2005
Somatropin EU/3/00/001 AIDS wasting Merck Serono Europe Limited 08/08/2000
Sorafenib tosylate EU/3/13/1200 Treatment of papillary thyroid cancer Bayer HealthCare AG 13/11/2013
Sorafenib tosylate EU/3/04/207 Treatment of renal cell carcinoma Bayer Schering Pharma AG 29/07/2004 Nexavar
Sorafenib tosylate EU/3/13/1199 Treatment of follicular thyroid cancer Bayer HealthCare AG 13/11/2013
Sorafenib tosylate EU/3/06/364 Treatment of hepatocellular carcinoma Bayer Schering Pharma AG 11/04/2006 Nexavar
Soraprazan EU/3/13/1208 Treatment of Stargardt’s disease Katairo GmbH 13/11/2013
Stiripentol EU/3/01/071 Treatment of severe myoclonic epilepsy in infancy Biocodex 05/12/2001 Diacomit
Sulfonated monophosphorylated mannose oligosaccharide EU/3/11/872 Treatment of hepatocellular carcinoma S-cubed Ltd 21/06/2011
Synthetic 12 amino acids peptide designed after subcommissural organ spondin EU/3/13/1206 Treatment of spinal cord injury Neuronax SAS 13/11/2013
Synthetic double-stranded short interfering RNA oligonucleotide directed against proopiomelanocortin EU/3/10/798 Treatment of adrenocorticotropin-dependent Cushing´s syndrome The University of Sheffield 01/10/2010
Synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine (prior to administration of doxorubicin) EU/3/12/1065 Treatment of glioma Avena Therapeutics Ltd 08/11/2012
Synthetic double-stranded siRNA oligonucleotide directed against p53 mRNA EU/3/10/751 Prevention of delayed graft function after renal transplantation ProductLife Limited 09/06/2010
Synthetic double-stranded siRNA oligonucleotide directed against the keratin 6a N171K mutation EU/3/13/1141 Treatment of pachyonychia congenita Alan Irvine 19/06/2013
Synthetic double-stranded siRNA oligonucleotide directed against transthyretin mRNA EU/3/11/857 Treatment of familial amyloid polyneuropathy Voisin Consulting S.A.R.L. 15/04/2011
tafamidis EU/3/12/1066 Treatment of senile systemic amyloidosis Pfizer Limited 08/11/2012
Talactoferrinum alfa EU/3/07/448 Treatment of renal cell carcinoma Agennix Limited 05/06/2007
Talarozole EU/3/12/1017 Treatment of recessive X-linked ichthyosis Stiefel Laboratories (U.K.) Limited 05/07/2012
Talarozole EU/3/12/1005 Treatment of autosomal recessive congenital ichthyosis Stiefel Laboratories (U.K.) Limited 04/07/2012
Talarozole EU/3/12/1014 Treatment of keratinopathic ichthyosis Stiefel Laboratories (U.K.) Limited 04/07/2012
Taliglucerase alfa EU/3/10/726 Treatment of Gaucher Disease Pfizer Limited 23/03/2010
Tasimelteon EU/3/10/841 Treatment of non-24-hour sleep-wake disorders in blind people with no light perception Vanda Pharmaceuticals Limited 23/02/2011
Tazarotene EU/3/06/423 Treatment of congenital ichthyoses Orfagen 18/12/2006
Temocillin sodium EU/3/03/183 Treatment of Burkholderia cepacia lung infection in cystic fibrosis Belpharma N.V. 14/01/2004
Temsirolimus EU/3/06/420 Treatment of mantle cell lymphoma Pfizer Limited 06/11/2006 Torisel
Temsirolimus EU/3/06/365 Treatment of renal cell carcinoma Pfizer Limited 06/04/2006 Torisel
Terguride EU/3/12/1096 Treatment of systemic sclerosis Serodapharm GmbH 24/01/2013
Terguride EU/3/07/499 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Ergonex Licensing and Regulatory Services AG 29/11/2007
Tesetaxel EU/3/10/829 Treatment of gastric cancer Genta Development Limited 17/12/2010
Tetrahydrobiopterin EU/3/04/199 Treatment of hyperphenylalaninemia Merck Serono Europe Limited 08/06/2004 Kuvan
TGF-beta2 specific phosphorothioate antisense oligodeoxynucleotide EU/3/02/091 Treatment of high-grade glioma Isarna Therapeutics GmbH 22/03/2002
Thalidomide EU/3/01/067 Treatment of multiple myeloma Celgene Europe Limited 20/11/2001 Thalidomide Celgene
Thiotepa EU/3/06/424 Conditioning treatment prior to haematopoietic progenitor cell transplantation ADIENNE S.r.l. 29/01/2007 Tepadina
Thymalfasin EU/3/02/110 Treatment of hepatocellular carcinoma SciClone Pharmaceuticals Italy S.r.l 30/07/2002
Tipifarnib EU/3/05/269 Treatment of acute myeloid leukaemia Janssen-Cilag International NV 10/03/2005
Tivantinib EU/3/13/1202 Treatment of hepatocellular carcinoma Daiichi Sankyo Development Ltd 13/11/2013
Tobramycin (inhalation powder) EU/3/03/140 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Novartis Europharm Limited 17/03/2003 TOBI Podhaler
Tobramycin (inhalation use) EU/3/09/613 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis PARI Pharma GmbH 27/02/2009
Tolvaptan EU/3/13/1175 Treatment of autosomal dominant polycystic kidney disease Otsuka Pharmaceutical Europe Ltd. 05/08/2013
Topotecan hydrochloride (liposomal) EU/3/08/562 Treatment of glioma Dr. Matthias Luz 05/09/2008
Tosedostat EU/3/09/659 Treatment of acute myeloid leukaemia Chroma Therapeutics Ltd 24/07/2009
Tositumomab EU/3/03/137 Treatment of follicular lymphoma GlaxoSmithKline Research & Development Limited 14/02/2003
Trabectedin EU/3/03/171 Treatment of ovarian cancer Pharma Mar S.A. 17/10/2003 Yondelis
Trabedersen EU/3/09/660 Treatment of pancreatic cancer Isarna Therapeutics GmbH 24/07/2009
Tralokinumab EU/3/12/1061 Treatment of idiopathic pulmonary fibrosis MedImmune Ltd 08/11/2012
Tranilast EU/3/10/756 Prevention of scarring post glaucoma filtration surgery Altacor Ltd 27/07/2010
Trans-4-[4-[5-[[6-(trifluoromethyl)-3-pyridinyl]amino]-2-pyridinyl]phenyl] cyclohexane acetic acid sodium salt EU/3/12/1036 Treatment of familial chylomicronaemia syndrome (type I hyperlipoproteinaemia) Novartis Europharm Limited 14/09/2012
Trans-N1-((1R,2S)-2-phenylcyclopropyl)cyclohexane-1,4-diamine bis-hydrochloride EU/3/13/1174 Treatment of acute myeloid leukaemia Oryzon Genomics SA 05/08/2013
Trebananib EU/3/13/1207 Treatment of ovarian cancer Amgen Europe B.V. 13/11/2013
Treosulfan EU/3/04/186 Conditioning treatment prior to haematopoietic progenitor cell transplantation medac Gesellschaft für klinische Spezialpräparate mbH 23/02/2004
Treprostinil diethanolamine EU/3/09/635 Treatment of systemic sclerosis United Therapeutics Europe Ltd 15/05/2009
Treprostinil diethanolamine (oral use) EU/3/05/310 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 26/08/2005
Treprostinil sodium EU/3/13/1103 Treatment of chronic thromboembolic pulmonary hypertension SciPharm S.a.r.L 08/02/2013
Treprostinil sodium (inhalation use) EU/3/04/197 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 14/04/2004
Tretazicar EU/3/08/529 Treatment of visceral leishmaniasis Morvus Technology Limited 04/02/2008
Trientine dihydrochloride EU/3/03/172 Treatment of Wilson's disease Univar BV 24/10/2003
Triheptanoin EU/3/12/1082 Treatment of long-chain L-3-hydroxyacyl-CoA-dehydrogenase deficiency B. Braun Melsungen AG 06/12/2012
Triheptanoin EU/3/12/1081 Treatment of very-long-chain-acyl-CoA dehydrogenase deficiency B. Braun Melsungen AG 06/12/2012
Type I native bovine skin collagen EU/3/08/607 Treatment of systemic sclerosis arGentis Autoimmune Europe Limited 09/02/2009
Unoprostone isopropyl EU/3/13/1146 Treatment of retinitis pigmentosa Sucampo Pharma Europa Ltd 19/06/2013
Vaccinia GM-CSF/TK-deactivated virus EU/3/09/700 Treatment of hepatocellular carcinoma Transgene S.A. 26/11/2009
Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar EU/3/04/201 Prevention of stenosis in synthetic grafts used in haemodialysis Finvector Vision Therapies Limited 08/06/2004
Vasoactive Intestinal Peptide EU/3/03/173 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension mondoBIOTECH Laboratories AG 22/12/2003
Vatreptacog alfa (activated) EU/3/12/1032 Treatment of haemophilia B Novo Nordisk A/S 09/08/2012
Vatreptacog alfa (activated) EU/3/12/1030 Treatment of haemophilia A Novo Nordisk A/S 09/08/2012
Velaglucerase alfa EU/3/10/752 Treatment of Gaucher disease Shire Pharmaceuticals Ireland Limited 09/06/2010 VPRIV
Veliparib EU/3/10/830 Treatment of ovarian cancer AbbVie Ltd 17/12/2010
Veltuzumab EU/3/09/713 Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 29/01/2010
vildagliptin EU/3/08/575 Treatment of isovaleric acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
Vincaleukoblastin-23-oic acid, O4-deacetyl-2-[(2-mercaptoethoxy)carbonyl]hydrazide, disulfide with N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-L-gamma-glutamyl-L-alpha-aspartyl-L-arginyl-L-alpha-aspartyl-L-alpha-aspartyl-L-cysteine EU/3/12/959 Treatment of ovarian cancer Endocyte Europe B.V. 09/02/2012 Vynfinit
Vincristine sulphate liposomes EU/3/08/555 Treatment of acute lymphoblastic leukaemia NDA Regulatory Science Ltd 08/07/2008
Viral vector containing DNA encoding the human SMN protein EU/3/11/876 Treatment of 5q spinal muscular atrophy University of Sheffield 21/06/2011
Voclosporin EU/3/12/1085 Treatment of non-infectious uveitis Granzer Regulatory Consulting & Services 06/12/2012
Volasertib EU/3/14/1255 Treatment of acute myeloid leukaemia Boehringer Ingelheim International GmbH 26/03/2014
Vosaroxin EU/3/12/990 Treatment of acute myeloid leukaemia Sunesis Europe Ltd 26/04/2012
Yttrium (90Y) antiferritin polyclonal antibodies EU/3/03/162 Treatment of Hodgkin lymphoma Mablife 02/10/2003
Yttrium (90Y) edotreotide EU/3/08/589 Treatment of gastro-entero-pancreatic neuroendocrine tumours ITG Isotope Technologies Garching GmbH 04/12/2008
Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 EU/3/08/608 Treatment of pancreatic cancer Immunomedics GmbH 06/02/2009
Yttrium (90Y)-DTPA-radiolabelled chimeric monoclonal antibody against frizzled homologue 10 EU/3/12/994 Treatment of soft tissue sarcoma Laboratoires OncoTherapy Science France, S.A.R.L 25/05/2012
Zanolimumab EU/3/07/438 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) TenX Biopharma Ltd 20/03/2007
Ziconotide (intraspinal use) EU/3/01/048 Treatment of chronic pain requiring intraspinal analgesia Eisai Limited 09/07/2001 Prialt
Zinc acetate dihydrate EU/3/01/050 Treatment of Wilson´s disease Orphan Europe S.A.R.L. 31/07/2001 Wilzin
Zoledronic acid EU/3/13/1192 Treatment of complex regional pain syndrome Axsome Therapeutics Limited 07/10/2013
Zosuquidar trihydrochloride EU/3/06/355 Treatment of acute myeloid leukaemia Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP 17/02/2006