European Commission
Public Health
Accessibility tools
Service tools
Language selector
- Current languageen
Navigation path
- European Commission
- Public health
- Reference documents
- Register
- Orphan Medicinal Products (alphab)
Community Register of medicinal products
Register of designated Orphan Medicinal Products (alphabetical)
| Product | EU Designation | Designated Orphan Indication | Sponsor | Designation date | Tradename EU Centralised Nr implemented by |
| 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene | EU/3/10/768 | Treatment of primary myelofibrosis | Voisin Consulting S.A.R.L. | 25/08/2010 | |
| 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene | EU/3/10/767 | Treatment of post-essential thrombocythaemia myelofibrosis | Voisin Consulting S.A.R.L. | 25/08/2010 | |
| 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene | EU/3/10/769 | Treatment of post-polycythaemia vera myelofibrosis | Voisin Consulting S.A.R.L. | 25/08/2010 | |
| 1,2:5,6-Dianhydrogalactitol | EU/3/12/1093 | Treatment of glioma | IDIS Ltd | 24/01/2013 | |
| 1-[2-(Benzo[1,2,5]thiadiazol-5-ylamino)-6-(2,6-dichloro-phenyl)-pyrido[2,3-d]pyrimidin-7-yl]-3-tert-butyl-urea | EU/3/10/770 | Treatment of acute myeloid leukaemia | Sanofi-Aventis groupe | 20/09/2010 | |
| 1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine | EU/3/05/332 | Treatment of acute myeloid leukaemia | Vion (UK) Limited, ℅ i3 Research | 14/12/2005 | |
| 1-[(2-Chloro-4-methoxyphenoxy)methyl]-4-[(2,6-dichlorophenoxy)methyl]benzene | EU/3/12/1021 | Prevention of poliomyelitis in patients with immunodeficiencies deemed at risk | ViroDefense Ltd | 17/07/2012 | |
| 1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride | EU/3/07/459 | Treatment of narcolepsy | Bioprojet | 10/07/2007 | |
| 1,3-Propanedisulfonic acid, disodium salt | EU/3/01/051 | Treatment of Systemic Secondary Amyloidosis | Kiacta Europe Ltd | 31/07/2001 | |
| 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4 d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one | EU/3/12/984 | Treatment of chronic lymphocytic leukaemia | Johnson & Johnson Medical Ltd | 26/04/2012 | |
| 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one | EU/3/13/1115 | Treatment of mantle cell lymphoma | Janssen Cilag International NV | 12/03/2013 | |
| 1-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl] thieno [3,2-c]pyridin-3-yl}phenyl)-3-(3-fluorophenyl)urea | EU/3/12/1001 | Treatment of ovarian cancer | AbbVie Ltd | 06/06/2012 | |
| 1-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl]thieno[3,2-c]pyridin-3-yl}phenyl)-3-(3-fluorophenyl)urea | EU/3/11/915 | Treatment of acute myeloid leukaemia | AbbVie Ltd | 27/10/2011 | |
| 16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide | EU/3/12/1016 | Treatment of neuroblastoma | Biogenera srl | 04/07/2012 | |
| 16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide | EU/3/10/789 | Treatment of medulloblastoma | Biogenera srl | 01/10/2010 | |
| 16-base single-stranded PNA oligonucleotide linked to a 7-aminoacid peptide | EU/3/09/692 | Treatment of neuroblastoma | Biogenera srl | 25/11/2009 | |
| (-)-17-(cyclopropylmethyl)-3,14 ß-dihydroxy-4,5 a-epoxy-6ß-[N-methyl-trans-3-(3-furyl) acrylamido] morphinan hydrochloride (intravenous use) | EU/3/02/115 | Treatment of uremic pruritus | Toray International U.K. Limited | 11/09/2002 | |
| 17-(Dimethylaminoethylamino)-17-demethoxygeldanamycin (after administration of adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5) | EU/3/12/1007 | Treatment of retinitis pigmentosa | Avena Therapeutics Ltd | 28/11/2012 | |
| 1-Cyclopropyl-3-[3-(5-morpholin-4-ylmethyl-1H-benzoimidazol-2-yl)-1H-pyrazol-4-yl]-urea | EU/3/09/693 | Treatment of acute myeloid leukaemia | Astex Therapeutics Limited | 26/11/2009 | |
| 1-deoxygalactonojirimycin hydrochloride | EU/3/06/368 | Treatment of Fabry disease | Glaxo Group Limited | 22/05/2006 | |
| (1-methyl-2-nitro-1H-imidazole-5-yl)methyl N,N'-bis(2-bromoethyl) diamidophosphate | EU/3/12/966 | Treatment of soft tissue sarcoma | Ockham Europe Limited | 05/03/2012 | |
| (1R, 2R)-Octanoic acid [2-(2’,3’-dihydro-benzo [1,4] dioxin-6’-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt | EU/3/07/514 | Treatment of Gaucher Disease | Genzyme Europe B.V. | 04/12/2007 | |
| (1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol | EU/3/05/314 | Treatment of tuberculosis | Janssen-Cilag International NV | 26/08/2005 | |
| (1S,3S)-3-amino-4-(difluoromethylene) cyclopentanecarboxylic acid hydrochloride | EU/3/12/953 | Treatment of West syndrome | Catalent Pharma Solutions Limited | 09/02/2012 | |
| 20-pentaerythritol poly (oxy-1,2-ethanediyl)-carboxymethyl-glycinate-7-ethyl-10-hydroxycamptothecine 10-[1,4'-bipiperidine]-1'-carboxylate | EU/3/11/900 | Treatment of ovarian cancer | Nektar Therapeutics UK Ltd | 27/09/2011 | |
| 2,2'-{2-[(1R)-1-({[(2,5-dichlorobenzoyl)amino]acetyl}amino)-3-methylbutyl]-5-oxo-1,3,2-dioxaborolane-4,4-diyl}diacetic acid | EU/3/11/899 | Treatment of multiple myeloma | Takeda Global Research and Development Centre (Europe) Ltd | 27/09/2011 | |
| 2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione | EU/3/10/802 | Treatment of idiopathic pulmonary fibrosis | GenKyoTex Innovation S.A.S | 26/11/2010 | |
| 2,2-dimethylbutyric acid, sodium salt | EU/3/09/621 | Treatment of sickle cell disease | Isabelle Ramirez | 18/03/2009 | |
| 2,2-dimethylbutyric acid, sodium salt | EU/3/09/617 | Treatment of beta-thalassaemia intermedia and major | Isabelle Ramirez | 27/02/2009 | |
| 2,3,4,5 tetrahydro-2,8-dimethyl-5-[2-(6-methyl-3-pyridyl)ethyl]-1H-pyrido[4,3-b]indole dihydrochloride | EU/3/08/597 | Treatment of Huntington´s disease | IDEA Innovative Drug European Associates Limited | 20/01/2009 | |
| 2-[[3-({4-[(5-{2-[(3-Fluorophenyl)amino]-2-oxoethyl}-1H-pyrazol-3-yl)amino]-quinazolin-7-yl}oxy)propyl](ethyl)amino]ethyl dihydrogen phosphate trihydrate | EU/3/08/590 | Treatment of acute myeloid leukaemia | AstraZeneca AB | 05/12/2008 | |
| 2',3',5'-tri-O-acetyluridine | EU/3/09/637 | Treatment of 5-fluorouracil overdose | Wellstat Therapeutics EU Limited | 15/05/2009 | |
| 2-{4-[(5,6-diphenylpyrazin-2-yl)(isopropyl)amino]butoxy}-N-(methylsulfonyl)acetamide | EU/3/05/316 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Actelion Registration Ltd | 26/08/2005 | |
| 2-[4-Methoxy-3-(2-m-tolyl-ethoxy)-benzoylamino]-indan-2-carboxylic acid | EU/3/13/1108 | Treatment of systemic sclerosis | Sanofi-Aventis groupe | 12/03/2013 | |
| 2-Allyl-1-[6-(1-hydroxy-1-methylethyl)pyridin-2-yl]-6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-1,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin-3-one | EU/3/12/989 | Treatment of ovarian cancer | Merck Sharp & Dohme Limited | 26/04/2012 | |
| ((2-aminoethyl) carbamic acid (2R,5S,8S,11S,14R,17S,19aS)-11-(4-aminobutyl)-5-benzyl-8-(4-benzyloxy benzyl)-14-(1H-indol-3-ylmethyl)-4,7,10,13,16,19-hexaoxo-17-phenyloctadecahydro-3a,6,9,12,15,18-hexaazacyclopentacyclooctadecen-2-yl ester, di[(S)-2-aminosuccinic acid] salt | EU/3/04/200 | Treatment of functional gastro-entero-pancreatic endocrine tumours | Novartis Europharm Limited | 08/06/2004 | |
| 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine | EU/3/01/082 | Treatment of acute lymphoblastic leukaemia | Genzyme Europe B.V. | 05/02/2002 | Evoltra EU/1/06/334 29/05/2006 |
| 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine. | EU/3/03/141 | Treatment of acute myeloid leukaemia | Genzyme Europe B.V. | 08/05/2003 | |
| [2-Cyano-3-cyclopropyl-3-hydroxy-N-(3-methyl-4-trifluoromethylphenyl)prop-2-enamide] | EU/3/12/1050 | Treatment of traumatic spinal cord injury | Algiax Pharmaceuticals GmbH | 10/10/2012 | |
| 2-hydroxyoleic acid | EU/3/11/916 | Treatment of glioma | Lipopharma Therapeutics SL | 27/10/2011 | |
| 2-hydroxypropyl-ß-cyclodextrin | EU/3/13/1124 | Treatment of Niemann-Pick disease, type C | International Niemann-Pick Disease Alliance (INPDA) | 26/04/2013 | |
| 2-iminobiotin | EU/3/09/701 | Treatment of perinatal asphyxia | Neurophyxia B.V. | 28/01/2010 | |
| 2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol | EU/3/04/195 | Treatment of anaplastic thyroid cancer | Diamond BioPharm Limited | 14/04/2004 | |
| 2-methoxymethyl-2-hydroxymethyl-1-azabicyclo[2,2,2]octan-3-one | EU/3/10/742 | Treatment of acute myeloid leukaemia | Aprea AB | 10/06/2010 | |
| (-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate | EU/3/08/560 | Treatment of moderate and severe closed traumatic brain injury | KeyNeurotek Pharmaceuticals AG | 05/09/2008 | |
| 2S, 4R ketoconazole | EU/3/12/1012 | Treatment of Cushing’s syndrome | Cortendo AB | 04/07/2012 | |
| (2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid | EU/3/12/1028 | Treatment of progressive familial intrahepatic cholestasis | Albireo AB | 17/07/2012 | |
| (2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid | EU/3/12/1040 | Treatment of Alagille syndrome | Albireo AB | 09/08/2012 | |
| (2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid | EU/3/12/1041 | Treatment of primary biliary cirrhosis | Albireo AB | 09/08/2012 | |
| (2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide | EU/3/05/315 | Treatment of progressive myoclonic epilepsies | UCB Pharma S.A. | 26/08/2005 | |
| 3-(4´aminoisoindoline-1´-one)-1-piperidine-2,6-dione | EU/3/04/192 | Treatment of myelodysplastic syndromes | Celgene Europe Limited | 08/03/2004 | Revlimid EU/1/07/391 14/06/2007 |
| 3-(4´aminoisoindoline-l´-one)-1-piperidine-2,6-dione | EU/3/03/177 | Treatment of multiple myeloma | Celgene Europe Limited | 12/12/2003 | Revlimid EU/1/07/391 14/06/2007 |
| 3,4-diaminopyridine phosphate | EU/3/02/124 | Treatment of Lambert-Eaton myasthenic syndrome | BioMarin Europe Ltd | 18/12/2002 | Firdapse EU/1/09/601 23/12/2009 |
| (3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid | EU/3/05/278 | Treatment of Duchenne muscular dystrophy | PTC Therapeutics, Limited | 27/05/2005 | |
| (3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid | EU/3/05/277 | Treatment of cystic fibrosis | PTC Therapeutics, Limited | 27/05/2005 | |
| 3-(6-(1-(2,2-difluorobenzo [d] [1,3] dioxol-5-yl)cyclopropanecarboxamido)-3-methylpyridin-2-yl)benzoic acid | EU/3/10/761 | Treatment of cystic fibrosis | Vertex Pharmaceuticals (U.K.) Limited | 04/08/2010 | |
| 3-methoxy-pregnenolone | EU/3/07/511 | Treatment of spinal cord injury | MAPREG SAS | 04/12/2007 | |
| (3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt | EU/3/10/787 | Treatment of mantle cell lymphoma | TESARO U.K. Limited | 01/10/2010 | |
| (3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt | EU/3/10/760 | Treatment of ovarian cancer | TESARO U.K. Limited | 04/08/2010 | |
| 4-[123I]iodo-L-phenylalanine | EU/3/06/386 | Diagnosis of glioma | Therapeia GmbH & Co. KG | 25/07/2006 | |
| 4-[131I]iodo-L-phenylalanine | EU/3/06/363 | Treatment of glioma | Therapeia GmbH & Co. KG | 11/04/2006 | |
| 4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate | EU/3/13/1120 | Treatment of glioma | Eli Lilly Nederland B.V. | 26/04/2013 | |
| 4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate | EU/3/13/1109 | Treatment of hepatocellular carcinoma | Eli Lilly Nederland B.V. | 13/03/2013 | |
| 4-(3,5-bis-(hydroxy-phenyl)-1,2,4) triazol-1-yl)-benzoic acid | EU/3/02/092 | Treatment of chronic iron overload requiring chelation therapy | Novartis Europharm Limited | 13/03/2002 | Exjade EU/1/06/356 28/08/2006 |
| 4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HCl | EU/3/05/288 | Treatment of Huntington´s disease | Teva Pharma GmbH | 20/06/2005 | |
| 4-(4-{[2-(4-chlorophenyl)-4,4-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-({3-nitro-4-[(tetrahydro-2H-pyran-4-ylmethyl)amino]phenyl}sulfonyl)-2-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)benzamide | EU/3/12/1080 | Treatment of chronic lymphocytic leukaemia | AbbVie Ltd | 06/12/2012 | |
| 4,7,10,13,16,19-docosahexaenoic acid | EU/3/06/412 | Treatment of retinitis pigmentosa | Celavista Pharmaceuticals Limited | 03/11/2006 | |
| 4-[[9-[(3S)-tetrahydro-3-furanyl]-8-[(2,4,6-trifluorophenyl)amino]-9H-purin-2-yl]amino]-trans-cyclohexanol | EU/3/11/934 | Treatment of idiopathic pulmonary fibrosis | Celgene Europe Limited | 09/12/2011 | |
| 4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-ß-D-arabinofuranosyl]-2(1H)-pyrimidinone | EU/3/07/477 | Treatment of hepatocellular carcinoma | Interface International Consultancy Limited | 14/09/2007 | |
| 4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline | EU/3/06/356 | Treatment of renal cell carcinoma | Prodimed S.A. | 16/02/2006 | |
| 4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride | EU/3/06/390 | Treatment of moderate and severe traumatic brain injury | vasopharm GmbH | 28/08/2006 | |
| 4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol | EU/3/07/487 | Treatment of chronic lymphocytic leukaemia | BlackSwan Pharma GmbH | 14/11/2007 | |
| 4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one | EU/3/05/299 | Treatment of pancreatic cancer | ICON Clinical Research (U.K.) Limited | 27/07/2005 | |
| 5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride | EU/3/11/892 | Treatment of 5q spinal muscular atrophy | Repligen Europe Limited | 30/08/2011 | |
| 5-(2,6-Difluoro-phenoxy)-3(R,S)-{2(S)-[2(S)-(3-methoxycarbonyl-2(S)-{3-methyl-2(S)-[(quinoline-2-carbonyl)-amino]-butyrylamino}-propionylamino)-3-methyl-butyrylamino]-propionylamino}-4-oxo-pentanoic acid methyl ester | EU/3/06/403 | Treatment of neonatal brain injury | Chiesi Farmaceutici S.P.A. | 23/10/2006 | |
| 5,6,7,8-Tetrahydrobiopterin | EU/3/03/163 | Treatment of hyperphenylalaninemia | Orphanetics Pharma Entwicklungs GmbH | 02/10/2003 | |
| 5-aminolevulinic acid hydrochloride | EU/3/02/121 | Intra-operative photodynamic diagnosis of residual glioma | medac Gesellschaft für klinische Spezialpräparate mbH | 13/11/2002 | Gliolan EU/1/07/413 07/09/2007 |
| 5’-CTG CCA CGT TCT CCT GC-(2’ methoxy)A-(2’ methoxy)C-(2’ methoxy)C-3’ | EU/3/04/203 | Treatment of myasthenia gravis | PPD Global Ltd | 21/06/2004 | |
| 5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole | EU/3/08/591 | Treatment of Duchenne muscular dystrophy | Summit (Oxford) Limited | 04/12/2008 | |
| 5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt | EU/3/03/182 | Treatment of aneurysmal subarachnoid haemorrhage | Axovan Europe Ltd | 12/12/2003 | |
| 5´-O-(trans-9´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine | EU/3/07/476 | Treatment of acute myleoid leukaemia | Clavis Pharma ASA | 14/09/2007 | |
| 5(S)-(2´-hydroxy ethoxy)-20(S)- camptothecin | EU/3/07/450 | Treatment of osteosarcoma | ClinTec International Ltd | 08/06/2007 | |
| 6alpha-ethyl-chenodeoxycholic acid | EU/3/10/753 | Treatment of primary biliary cirrhosis | Intercept Pharma | 27/07/2010 | |
| 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide | EU/3/09/681 | Treatment of Huntington´s disease | Siena Biotech SpA | 28/10/2009 | |
| 6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2(3H)-one | EU/3/12/970 | Treatment of amyotrophic lateral sclerosis | ICON Clinical Research (U.K.) Limited | 05/03/2012 | |
| (6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride monohydrate | EU/3/09/616 | Treatment of amyotrophic lateral sclerosis | Biogen Idec Limited | 27/02/2009 | |
| 6-thioguanine (oral liquid) | EU/3/09/694 | Treatment of acute lymphoblastic leukaemia | Only for Children Pharmaceuticals | 26/11/2009 | |
| 7-beta-hydroxycholesteryl-3-beta-oleate | EU/3/10/816 | Treatment of glioma | Intsel Chimos SA | 17/12/2010 | |
| 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-1,2,4-triazolo[3,4-f][1,6]naphthyridin-3(2H)-one mono-hydrochloride | EU/3/09/695 | Treatment of ovarian cancer | Merck Sharp & Dohme Limited | 30/11/2009 | |
| 9-cis-Retinyl acetate | EU/3/11/861 | Treatment of Leber's congenital amaurosis | QLT Ophthalmics (UK), Ltd | 13/05/2011 | |
| 9-cis-Retinyl acetate | EU/3/11/865 | Treatment of retinitis pigmentosa | QLT Ophthalmics (UK), Ltd | 13/05/2011 | |
| A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein | EU/3/05/317 | Treatment of graft-versus-host disease | Xenikos B.V. | 26/08/2005 | |
| Acadesine | EU/3/05/280 | Treatment of B-cell chronic lymphocytic leukemia (B-CLL) | Advancell - Advanced In Vitro Cell Technologies S.A. | 27/05/2005 | |
| Acadesine | EU/3/11/881 | Treatment of multiple myeloma | Advancell - Advanced In Vitro Cell Technologies S.A. | 05/08/2011 | |
| Acetylsalicylic acid | EU/3/04/208 | Treatment of polycythemia vera | Bayer HealthCare AG | 29/07/2004 | |
| Adeno associated viral vector containing the human calpain 3 gene | EU/3/06/359 | Treatment of calpainopathy | Généthon | 06/04/2006 | |
| Adeno-associated viral vector containing a modified U7-snRNA gene | EU/3/05/297 | Treatment of Duchenne muscular dystrophy | Généthon | 27/07/2005 | |
| Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene | EU/3/10/817 | Treatment of rhodopsin-linked retinitis pigmentosa | Genable Technologies Ltd | 17/12/2010 | |
| Adeno-associated viral vector containing modified U1 snRNA | EU/3/09/663 | Treatment of Duchenne muscular dystrophy | uniQure biopharma B.V. | 08/10/2009 | |
| Adeno-associated viral vector containing porphobilinogen deaminase gene | EU/3/09/632 | Treatment of acute intermittent porphyria | uniQure biopharma B.V. | 29/04/2009 | |
| Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene | EU/3/11/917 | Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) | Institut Pasteur | 27/10/2011 | |
| Adeno-associated viral vector containing the human alpha-sarcoglycan gene | EU/3/08/573 | Treatment of alpha-sarcoglycanopathy | Généthon | 07/11/2008 | |
| Adeno-associated viral vector containing the human ARSB gene | EU/3/11/864 | Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) | Fondazione Telethon | 13/05/2011 | |
| Adeno-associated viral vector containing the human factor IX gene | EU/3/11/938 | Treatment of haemophilia B | uniQure biopharma B.V. | 11/01/2012 | |
| Adeno-associated viral vector containing the human gamma-sarcoglycan gene | EU/3/04/233 | Treatment of gamma-sarcoglycanopathy | Généthon | 21/10/2004 | |
| Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene | EU/3/11/860 | Treatment of Leber´s hereditary optic neuropathy | Institut de la Vision | 13/05/2011 | |
| Adeno-associated viral vector encoding an inducible short hairpin RNA targeting claudin-5 (prior to administration of 17-dimethylaminoethylamino-17-demethoxygeldanamycin) | EU/3/12/1069 | Treatment of retinitis pigmentosa | Avena Therapeutics Ltd | 08/11/2012 | |
| Adeno-associated viral vector expressing lipoprotein lipase | EU/3/04/194 | Treatment of lipoprotein lipase deficiency | uniQure biopharma B.V. | 08/03/2004 | Glybera EU/1/12/791 25/10/2012 |
| Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene | EU/3/12/974 | Treatment of primary hyperoxaluria type 1 | uniQure biopharma B.V. | 21/03/2012 | |
| Adeno-associated viral vector serotype 5 containing the human ABCA4 gene | EU/3/08/609 | Treatment of Stargardt’s disease | Fondazione Telethon | 06/02/2009 | |
| Adeno-associated viral vector serotype 8 containing the human AIPL1 gene | EU/3/11/929 | Treatment of Leber’s congenital amaurosis type 4 | Fondazione Telethon | 09/12/2011 | |
| Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene | EU/3/12/1095 | Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) | Laboratorios del Dr. Esteve, S.A. | 24/01/2013 | |
| Adeno-associated viral vector serotype 9 containing the human sulfamidase gene | EU/3/11/877 | Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) | Laboratorios del Dr. Esteve, S.A. | 21/06/2011 | |
| Adenoviral vector containing human p53 gene | EU/3/06/404 | Treatment of Li Fraumeni Syndrome | Gendux Molecular Limited | 23/10/2006 | |
| Adenovirus associated viral vector serotype 2 containing the human RPE65 gene | EU/3/12/981 | Treatment of Leber’s congenital amaurosis | Alan Boyd Consultants Ltd | 02/04/2012 | |
| Adenovirus associated viral vector serotype 4 containing the human RPE65 gene | EU/3/07/486 | Treatment of retinitis pigmentosa | Centre Hospitalier Universitaire de Nantes | 14/11/2007 | |
| Adenovirus associated viral vector serotype 4 containing the human RPE65 gene | EU/3/07/484 | Treatment of Leber's congenital amaurosis | Centre Hospitalier Universitaire de Nantes | 22/10/2007 | |
| Adenovirus-associated vector containing human Fas-c gene | EU/3/12/1002 | Treatment of glioma | Gregory Fryer Associates Ltd | 06/06/2012 | |
| Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs | EU/3/10/772 | Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) | LYSOGENE | 20/09/2010 | |
| Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene | EU/3/01/083 | Treatment of high-grade glioma with subsequent use of ganciclovir sodium | Ark Therapeutics Ltd | 06/02/2002 | |
| Adrenomedullin | EU/3/10/744 | Treatment of acute lung injury | mondoBIOTECH Laboratories AG | 09/06/2010 | |
| Afamelanotide | EU/3/09/648 | Treatment of solar urticaria | Clinuvel (UK) Limited | 24/07/2009 | |
| Alginate oligosaccharide (G-block) fragment | EU/3/07/475 | Treatment of cystic fibrosis | AlgiPharma AS | 14/09/2007 | |
| Alicaforsen | EU/3/09/641 | Treatment of pouchitis | Atlantic Healthcare Limited | 15/05/2009 | |
| Alisertib | EU/3/12/1064 | Treatment of ovarian cancer | Takeda Global Research and Development Centre (Europe) Ltd | 08/11/2012 | |
| Alisertib | EU/3/12/1074 | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Takeda Global Research and Development Centre (Europe) Ltd | 06/12/2012 | |
| Allogeneic aortic endothelial cells cultured in a porcine gelatin matrix | EU/3/10/843 | Prevention of arteriovenous access failure in haemodialysis patients | Shire Pharmaceuticals Ireland Limited | 23/02/2011 | |
| Allogeneic bone marrow stem cells treated ex vivo with 16,16-dimethyl prostaglandin E2 | EU/3/11/866 | Treatment of acute myeloid leukaemia | Fate Therapeutics, LTD | 13/05/2011 | |
| Allogeneic ex vivo expanded umbilical cord blood cells | EU/3/09/664 | Treatment of myelodysplastic syndromes | Teva Pharma GmbH | 08/10/2009 | |
| Allogeneic ex vivo expanded umbilical cord blood cells | EU/3/09/665 | Treatment of chronic myeloid leukaemia | Teva Pharma GmbH | 08/10/2009 | |
| Allogeneic ex vivo expanded umbilical cord blood cells | EU/3/09/618 | Treatment of acute lymphoblastic leukaemia | Teva Pharma GmbH | 27/02/2009 | |
| Allogeneic ex vivo expanded umbilical cord blood cells | EU/3/09/649 | Treatment of Hodgkin lymphoma | Teva Pharma GmbH | 24/07/2009 | |
| Allogeneic ex vivo expanded umbilical cord blood cells | EU/3/09/619 | Treatment of acute myeloid leukaemia | Teva Pharma GmbH | 27/02/2009 | |
| Allogeneic human dendritic cells derived from a CD34+ progenitor cell line | EU/3/12/969 | Treatment of acute myeloid leukaemia | DCPrime BV | 22/05/2012 | |
| Allogeneic human dermal fibroblasts | EU/3/10/774 | Treatment of epidermolysis bullosa | Intercytex Ltd | 20/09/2010 | |
| Allogeneic motor neuron progenitor cells derived from human embryonic stem cells | EU/3/12/1088 | Treatment of 5q spinal muscular atrophy | California Stem Cell (UK) Ltd | 24/01/2013 | |
| Allogeneic T cells encoding an exogenous TK gene | EU/3/10/773 | Treatment of acute myeloid leukaemia | LTKFarma | 20/09/2010 | |
| Allogeneic T cells encoding an exogenous TK gene | EU/3/11/878 | Treatment of acute lymphoblastic leukaemia | LTKFarma | 21/06/2011 | |
| Allogeneic umbilical cord blood cells treated ex vivo with 16,16-dimethyl prostaglandin E2 | EU/3/11/867 | Treatment of acute myeloid leukaemia | Fate Therapeutics, LTD | 13/05/2011 | |
| Allopurinol sodium | EU/3/12/1076 | Treatment of perinatal asphyxia | Pharmathen S.A. | 06/12/2012 | |
| Alpha-1 antitrypsin (inhalation use) | EU/3/04/243 | Treatment of cystic fibrosis | The Weinberg Group Ltd | 16/11/2004 | |
| Alpha-1 antitrypsin (inhalation use) | EU/3/04/244 | Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency | The Weinberg Group Ltd | 16/11/2004 | |
| Alpha-1 proteinase inhibitor | EU/3/06/350 | Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency | Octapharma (IP) Limited | 16/02/2006 | |
| Alpha-1 proteinase inhibitor (for inhalation use) | EU/3/12/1045 | Treatment of cystic fibrosis | Grifols Deutschland GmbH | 10/10/2012 | |
| Alpha-1 proteinase inhibitor (inhalation use) | EU/3/08/546 | Treatment of congenital alpha-1 antitrypsin deficiency | Grifols Deutschland GmbH | 03/06/2008 | |
| Alpha-1 proteinase inhibitor (inhalation use) | EU/3/07/474 | Treatment of cystic fibrosis | CSL Behring GmbH | 14/09/2007 | |
| Alpha-tocotrienol quinone | EU/3/11/937 | Treatment of Leigh syndrome | Edison Orphan Pharma BV | 09/12/2011 | |
| Alvocidib | EU/3/07/485 | Treatment of chronic lymphocytic leukaemia | Sanofi-Aventis groupe | 23/10/2007 | |
| Ambrisentan | EU/3/05/273 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | European Medical Advisory Services Limited | 11/04/2005 | Volibris EU/1/08/451 21/04/2008 |
| Amikacin sulfate (liposomal) | EU/3/06/387 | Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | Insmed Limited | 25/07/2006 | |
| Ammonium tetrathiomolybdate | EU/3/08/539 | Treatment of Wilson´s disease | JJGConsultancy Ltd | 01/04/2008 | |
| Amphotericin B (for inhalation use) | EU/3/06/391 | Prevention of pulmonary fungal infection in patients deemed at risk | Kendle International Ltd | 28/08/2006 | |
| Amrubicin hydrochloride | EU/3/08/538 | Treatment of small cell lung cancer | Celgene Europe Limited | 02/04/2008 | |
| Anagrelide Hydrochloride | EU/3/00/010 | Treatment of essential thrombocythaemia | Shire Pharmaceutical Development Limited | 29/12/2000 | Xagrid EU/1/04/295 16/11/2004 |
| Anti epidermal growth factor receptor antibody h-R3 | EU/3/04/220 | Treatment of glioma | Oncoscience AG | 02/09/2004 | |
| Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody | EU/3/04/193 | Treatment of ovarian cancer | Fresenius Biotech GmbH | 08/03/2004 | |
| Antisense NF-Kß p65 Oligonucleotide | EU/3/02/106 | Treatment of active ulcerative colitis | InDex Pharmaceuticals AB | 30/07/2002 | |
| Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' | EU/3/06/416 | Treatment of acute myeloid leukaemia | EleosInc Limited | 03/11/2006 | |
| Antisense oligonucleotide targeted to the SMN2 gene | EU/3/12/976 | Treatment of 5q spinal muscular atrophy | Isis USA Ltd | 02/04/2012 | |
| Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) | EU/3/07/445 | Prevention of corneal graft rejection | Gene Signal SAS | 17/04/2007 | |
| Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) | EU/3/03/160 | Treatment of retinopathy of prematurity | Gene Signal SAS | 02/10/2003 | |
| Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) | EU/3/03/161 | Treatment of neovascular glaucoma | Gene Signal SAS | 02/10/2003 | |
| Aplidine | EU/3/04/245 | Treatment of multiple myeloma | Pharma Mar S.A. Sociedad Unipersonal | 16/11/2004 | |
| Apomorphine hydrochloride | EU/3/11/862 | Treatment of moderate and severe traumatic brain injury | Dr. Elkan Raphael Gamzu | 13/05/2011 | |
| Apomorphine hydrochloride (inhalation use) | EU/3/06/349 | Treatment of off-periods in Parkinson’s disease not responding to oral treatment | Vectura Group plc | 16/02/2006 | |
| Arimoclomol | EU/3/06/406 | Treatment of amyotrophic lateral sclerosis | Orphazyme ApS | 26/10/2006 | |
| artesunate | EU/3/07/510 | Treatment of malaria | Sigma-Tau Industrie Farmaceutiche Riunite S.p.A | 06/12/2007 | |
| artesunate | EU/3/07/430 | Treatment of malaria | Pharmaorigin ApS | 20/02/2007 | |
| Artesunate | EU/3/12/1079 | Treatment of malaria | Dafra Pharma International NV | 06/12/2012 | |
| ascorbic acid | EU/3/08/531 | Treatment of Charcot-Marie-Tooth disease type 1A | Murigenetics SAS | 01/04/2008 | |
| Asp-Arg-Val-Tyr-Ile-His-Pro | EU/3/12/1047 | Treatment of acute lung injury | Tarix Pharmaceuticals Limited | 10/10/2012 | |
| Ataluren | EU/3/12/1010 | Treatment of Becker muscular dystrophy | PTC Therapeutics, Limited | 04/07/2012 | |
| Autologous bone marrow-derived mononuclear cell fraction | EU/3/10/775 | Treatment of thromboangiitis obliterans (Buerger's disease) | t2cure GmbH | 20/09/2010 | |
| Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA | EU/3/07/446 | Treatment of metachromatic leukodystrophy | Fondazione Telethon | 13/04/2007 | |
| Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene | EU/3/12/998 | Treatment of Wiskott-Aldrich syndrome | Fondazione Telethon | 06/06/2012 | |
| Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene | EU/3/05/313 | Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency | Fondazione Telethon | 26/08/2005 | |
| Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human betaA-T87Q-globin gene | EU/3/12/1091 | Treatment of beta-thalassaemia intermedia and major | bluebird bio France | 24/01/2013 | |
| Autologous dendritic cells pulsed with autologous tumour cell lysate | EU/3/07/431 | Treatment of glioma | Northwest Biotherapeutics GmbH | 15/02/2007 | |
| Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose | EU/3/10/776 | Treatment of ovarian cancer | Prima Biomed GmbH | 20/09/2010 | |
| Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene | EU/3/12/957 | Treatment of X-linked chronic granulomatous disease | Généthon | 09/02/2012 | |
| Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene | EU/3/09/623 | Treatment of beta-thalassaemia intermedia and major | EGT San Rocco Italia SRL | 29/04/2009 | |
| Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA | EU/3/12/1003 | Treatment of adrenoleukodystrophy | bluebird bio France | 06/06/2012 | |
| Autologous renal cell tumor vaccine | EU/3/02/116 | Treatment of renal cell carcinoma | Liponova GmbH | 21/10/2002 | |
| Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex | EU/3/05/270 | Treatment of renal cell carcinoma | Antigenics Therapeutics Limited | 11/04/2005 | |
| Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin | EU/3/10/831 | Treatment of mantle cell lymphoma | Biovest Europe Limited | 23/02/2011 | |
| Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin | EU/3/06/394 | Treatment of follicular lymphoma | Biovest Europe Limited | 28/08/2006 | |
| Autologous tumour-derived gp96 heat shock protein-peptide complex | EU/3/09/624 | Treatment of glioma | Antigenics Therapeutics Limited | 29/04/2009 | |
| Avian polyclonal IgY antibody against Pseudomonas aeruginosa | EU/3/08/564 | Treatment of cystic fibrosis | Immunsystem I.M.S. AB | 23/09/2008 | |
| Aviptadil | EU/3/07/473 | Treatment of sarcoidosis | mondoBIOTECH Laboratories Anstalt | 14/09/2007 | |
| Aviptadil | EU/3/06/395 | Treatment of acute lung injury | mondoBIOTECH Laboratories Anstalt | 28/08/2006 | |
| Azacitidine | EU/3/07/509 | Treatment of acute myeloid leukaemia | Celgene Europe Limited | 29/11/2007 | Vidaza EU/1/08/488 17/12/2008 |
| Azacitidine | EU/3/01/084 | Treatment of myelodysplastic syndromes | Celgene Europe Limited | 06/02/2002 | Vidaza EU/1/08/488 17/12/2008 |
| Aztreonam lysinate (inhalation use) | EU/3/04/204 | Treatment of gram negative bacteria lung infections in cystic fibrosis | Gilead Sciences International Limited | 21/06/2004 | Cayston EU/1/09/543 05/09/2011 |
| Bacterial lipase | EU/3/05/323 | Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency | Nordmark Arzneimittel GmbH u. Co. KG | 07/11/2005 | |
| Bafetinib | EU/3/10/731 | Treatment of chronic myeloid leukaemia | Eudax Srl | 10/06/2010 | |
| Becatecarin | EU/3/06/388 | Treatment of cancers of the biliary tree | Helsinn Birex Pharmaceuticals Ltd | 25/07/2006 | |
| Beclomethasone 17, 21-dipropionate (oral use) | EU/3/02/093 | Treatment of intestinal graft-versus-host disease | Soligenix UK Ltd | 13/03/2002 | |
| Belinostat | EU/3/12/1055 | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | TopoTarget A/S | 10/10/2012 | |
| Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] | EU/3/09/715 | Treatment of acute lymphoblastic leukaemia | ARIAD Pharma Ltd | 02/02/2010 | |
| Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] | EU/3/09/716 | Treatment of chronic myeloid leukaemia | ARIAD Pharma Ltd | 02/02/2010 | |
| Benzoic acid, sodium salt | EU/3/02/111 | Treatment of non-ketotic hyperglycinaemia | Ethicare GmbH | 11/09/2002 | |
| Beraprost sodium (modified release tablet) | EU/3/08/554 | Treatment of pulmonary arterial hypertension | IDEA Innovative Drug European Associates Limited | 10/07/2008 | |
| Beta-artemether / lumefantrine (powder for oral suspension) | EU/3/09/702 | Treatment of malaria | Dafra Pharma International NV | 28/01/2010 | |
| Betaine anhydrous | EU/3/01/045 | Treatment of homocystinuria | Orphan Europe S.A.R.L. | 09/07/2001 | Cystadane EU/1/06/379 15/02/2007 |
| Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix | EU/3/06/369 | Treatment of epidermolysis bullosa | TiGenix S.A.U | 22/05/2006 | |
| Bimosiamose disodium | EU/3/05/285 | Treatment of acute lung injury | Revotar Biopharmaceuticals AG | 27/05/2005 | |
| Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium | EU/3/04/232 | Treatment of glioma | Sigma-Tau Industrie Farmaceutiche Riunite S.p.A | 20/10/2004 | |
| Blinatumomab | EU/3/09/650 | Treatment of acute lymphoblastic leukaemia | AMGEN Research (Munich) Gmbh | 24/07/2009 | |
| bosentan | EU/3/03/139 | Treatment of systemic sclerosis | Actelion Registration Ltd | 17/03/2003 | Tracleer EU/1/02/220 15/05/2002 |
| bosentan | EU/3/08/559 | Treatment of idiopathic pulmonary fibrosis | Actelion Registration Ltd | 05/09/2008 | |
| Bosutinib | EU/3/10/762 | Treatment of chronic myeloid leukaemia | Pfizer Limited | 04/08/2010 | |
| Bovine bile extract | EU/3/05/287 | Treatment of pancreatic cancer | Dr. Ulrich Granzer | 20/06/2005 | |
| Brentuximab vedotin | EU/3/11/939 | Treatment of cutaneous T-cell lymphoma | Takeda Global Research and Development Centre (Europe) Ltd | 11/01/2012 | |
| Brivudine | EU/3/09/703 | Treatment of pancreatic cancer | RESprotect GmbH | 28/01/2010 | |
| Budesonide (oral use) | EU/3/06/413 | Treatment of Graft-versus-Host disease | Dr. Falk Pharma GmbH | 03/11/2006 | |
| Busulfan (Intravenous use) | EU/3/00/011 | Busilvex followed by cyclophosphamide (BuCy2) is indicated as conditioning treatment prior to conventional haematopoietic progenitor cell transplantation (HPCT) in adult patients when the combination is considered the best available option. Busilvex followed by cyclophosphamide (BuCy4) or melphalan (BuMel) is indicated as conditioning treatment prior to conventional haematopoietic progenitor cell transplantation in paediatric patients. |
Pierre Fabre Médicament | 29/12/2000 | Busilvex EU/1/03/254 09/07/2003 |
| Caffeine citrate | EU/3/03/132 | Treatment of primary apnoea of premature newborns | Chiesi Farmaceutici S.P.A. | 17/02/2003 | Peyona EU/1/09/528 02/07/2009 |
| Canakinumab | EU/3/12/1071 | Treatment of tumour necrosis factor receptor-associated periodic syndrome | Novartis Europharm Limited | 08/11/2012 | |
| Carbetocin | EU/3/12/975 | Treatment of Prader-Willi syndrome | Ferring Pharmaceuticals A/S | 21/03/2012 | |
| Carboxypeptidase G2 | EU/3/02/128 | Adjunctive treatment in patients at risk of methotrexate toxicity | Enact Pharma PLC | 03/02/2003 | |
| Cardiotrophin-1 | EU/3/06/396 | Prevention of the ischemia/reperfusion injury associated with solid organ transplantation | Digna Biotech S.L. | 28/08/2006 | |
| Cardiotrophin-1 | EU/3/11/893 | Treatment of acute liver failure | Digna Biotech S.L. | 30/08/2011 | |
| Carfilzomib | EU/3/08/548 | Treatment of multiple myeloma | Onyx Pharmaceuticals (UK) Ltd | 03/06/2008 | |
| Carglumic acid | EU/3/08/577 | Treatment of propionic acidaemia | Orphan Europe S.A.R.L. | 07/11/2008 | Carbaglu EU/1/02/246 24/01/2003 |
| Carglumic acid | EU/3/08/576 | Treatment of methylmalonic acidaemia | Orphan Europe S.A.R.L. | 07/11/2008 | Carbaglu EU/1/02/246 24/01/2003 |
| Catumaxomab | EU/3/06/414 | Treatment of gastric cancer | Fresenius Biotech GmbH | 03/11/2006 | |
| Celecoxib | EU/3/01/070 | Treatment of Familial Adenomatous Polyposis | Pfizer Limited | 20/11/2001 | Onsenal EU/1/03/259 17/10/2003 |
| Cenersen | EU/3/08/587 | Treatment of chronic lymphocytic leukaemia | EleosInc Limited | 03/12/2008 | |
| Chimeric antibody to mesothelin | EU/3/08/536 | Treatment of pancreatic cancer | Eisai Europe Limited | 17/03/2008 | |
| Chimeric IgG monoclonal antibody cG250 | EU/3/02/094 | Treatment of renal cell carcinoma | Wilex AG | 19/03/2002 | |
| Chimeric locked nucleic acid-deoxynucleoside phosphorothioate-linked oligonucleotide directed against microRNA-451 | EU/3/11/940 | Treatment of polycythaemia vera | Miragen Therapeutics Europe Ltd | 11/01/2012 | |
| Chimeric monoclonal antibody against claudin 6 | EU/3/12/1092 | Treatment of ovarian cancer | GANYMED Pharmaceuticals AG | 24/01/2013 | |
| Chimeric monoclonal antibody against claudin-18 splice variant 2 | EU/3/10/803 | Treatment of gastric cancer | GANYMED Pharmaceuticals AG | 26/11/2010 | |
| Chimeric monoclonal antibody against GD2 | EU/3/12/1062 | Treatment of neuroblastoma | APEIRON Biologics AG | 08/11/2012 | |
| Chimeric monoclonal antibody against GD2 | EU/3/11/879 | Treatment of neuroblastoma | United Therapeutics Europe Ltd | 21/06/2011 | |
| Chimeric monoclonal antibody against kappa myeloma antigen | EU/3/12/962 | Treatment of multiple myeloma | Gregory Fryer Associates Ltd | 22/05/2012 | |
| Chimeric monoclonal antibody to shiga-toxin 1 and 2 | EU/3/05/301 | Treatment of shiga-toxin producing bacterial infection. | LFB-Biotechnologies | 26/08/2005 | |
| Chimeric-anti-interleukin-6 monoclonal antibody | EU/3/09/642 | Treatment of multiple myeloma | Janssen Biologics B.V. | 12/06/2009 | |
| Chimeric-anti-interleukin-6 monoclonal antibody | EU/3/07/508 | Treatment of Castleman’s disease | Janssen Biologics B.V. | 30/11/2007 | |
| Chlormethine | EU/3/12/963 | Treatment of cutaneous T-cell lymphoma | TMC Pharma Services Ltd. | 22/05/2012 | |
| Cholest-4-en-3-one, oxime | EU/3/05/264 | Treatment of 5q spinal muscular atrophies | Trophos SA | 10/03/2005 | |
| Cholic acid | EU/3/09/683 | Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid | FGK Representative Service GmbH | 28/10/2009 | |
| Cholic acid | EU/3/02/127 | Treatment of inborn errors in primary bile acid synthesis | Laboratoires C.T.R.S | 18/12/2002 | |
| Choline tetrathiomolybdate | EU/3/12/1089 | Treatment of Wilson’s disease | Medical Need Europe AB | 24/01/2013 | |
| Ciclosporin | EU/3/06/360 | Treatment of vernal keratoconjunctivitis | Novagali Pharma SA | 06/04/2006 | |
| Ciclosporin | EU/3/07/455 | Prevention of corneal graft rejection | Novagali Pharma SA | 22/10/2007 | |
| Ciclosporin | EU/3/10/791 | Treatment of moderate and severe closed traumatic brain injury | NeuroVive Pharmaceutical AB | 01/10/2010 | |
| Ciclosporin | EU/3/07/489 | Treatment of Herpes simplex virus stromal keratitis | Novagali Pharma SA | 29/10/2007 | |
| Ciclosporin (eye drops, solution) | EU/3/09/651 | Treatment of atopic keratoconjunctivitis | Allergan Pharmaceuticals Ireland | 24/07/2009 | |
| Ciclosporin (inhalation use) | EU/3/04/210 | Treatment of graft rejection after lung transplantation | PARI Pharma GmbH | 29/07/2004 | |
| Ciclosporin (inhalation use) | EU/3/04/209 | Prevention of graft rejection after lung transplantation | PARI Pharma GmbH | 29/07/2004 | |
| Ciclosporin (inhalation use) | EU/3/05/265 | Treatment of graft rejection after lung transplantation | Chiron Corporation Limited | 10/03/2005 | |
| Ciclosporin (inhalation use) | EU/3/05/266 | Prevention of graft rejection after lung transplantation | Chiron Corporation Limited (trading as Chiron Biopharmaceuticals) | 10/03/2005 | |
| Cilengitide | EU/3/03/184 | Treatment of glioma | Merck KGaA | 14/01/2004 | |
| Ciprofloxacin (inhalation use) | EU/3/07/469 | Treatment of cystic fibrosis | Bayer Schering Pharma AG | 03/08/2007 | |
| Ciprofloxacin (liposomal) | EU/3/09/652 | Treatment of cystic fibrosis | Interface International Consultancy Limited | 24/07/2009 | |
| Cisplatin (liposomal) | EU/3/07/451 | Treatment of pancreatic cancer | Regulon AE | 08/06/2007 | |
| Cladribine (subcutaneous use) | EU/3/01/055 | Treatment of indolent non-Hodgkin´s lymphoma | Lipomed GmbH | 18/09/2001 | Litak EU/1/04/275 14/04/2004 |
| Clonidine hydrochloride | EU/3/11/919 | Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy | BioAlliance Pharma | 27/10/2011 | |
| Covalently closed DNA plasmids coding for cytomegalovirus phosphoprotein 65 and glycoprotein B genes | EU/3/12/1042 | Prevention of cytomegalovirus disease in patients with impaired cell mediated immunity deemed at risk | Astellas Pharma Europe B.V. | 09/08/2012 | |
| Cyclic pyranopterin monophosphate | EU/3/10/777 | Treatment of molybdenum cofactor deficiency type A | Alexion Europe SAS | 20/09/2010 | |
| Cyclo-Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys | EU/3/13/1102 | Treatment of high altitude pulmonary oedema | Apeptico Forschung und Entwicklung GmbH | 08/02/2013 | |
| Cyclo(-gamma-aminobutyryl-L-phenylalanyl-L-tryptophanyl-D-tryptophanyl-L-lysyl-L-threonyl-L phenylalanyl-N-3-carboxypropyl)-glycine amide, acetate salt | EU/3/12/1075 | Treatment of acromegaly | Dr. Ulrich Granzer | 06/12/2012 | |
| Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl] acetate salt | EU/3/13/1114 | Treatment of congenital alpha-1 antitrypsin deficiency | Polyphor UK Ltd | 20/03/2013 | |
| Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt | EU/3/08/610 | Treatment of medullary thyroid carcinoma | TMC Pharma Services Ltd. | 06/02/2009 | |
| Cysteamine | EU/3/11/928 | Treatment of cystic fibrosis | NovaBiotics Ltd | 09/12/2011 | |
| Cysteamine bitartrate (gastroresistant) | EU/3/10/778 | Treatment of cystinosis | Raptor Pharmaceuticals Europe BV | 20/09/2010 | |
| Cysteamine hydrochloride | EU/3/08/578 | Treatment of cystinosis | Orphan Europe S.A.R.L. | 07/11/2008 | |
| Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate | EU/3/03/149 | Treatment of pancreatic cancer in combination with ifosfamide | Ziel Biopharma Limited | 30/06/2003 | |
| Darinaparsin | EU/3/11/850 | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Ziopharm Oncology Limited | 15/04/2011 | |
| Dasatinib | EU/3/05/338 | Treatment of acute lymphoblastic leukaemia | Bristol-Myers Squibb Pharma EEIG | 23/12/2005 | Sprycel EU/1/06/363 20/11/2006 |
| Dasatinib | EU/3/05/339 | Treatment of chronic myeloid leukaemia | Bristol-Myers Squibb Pharma EEIG | 23/12/2005 | Sprycel EU/1/06/363 20/11/2006 |
| Daunorubicin (liposomal) | EU/3/08/585 | Treatment of acute myeloid leukaemia | Diatos S. A. | 03/12/2008 | |
| Decitabine | EU/3/06/370 | Treatment of acute myeloid leukaemia | Janssen-Cilag International NV | 08/06/2006 | Dacogen EU/1/12/792 24/09/2012 |
| Decitabine | EU/3/03/135 | Treatment of myelodysplastic syndromes | Janssen-Cilag International NV | 14/02/2003 | |
| Deferiprone | EU/3/10/832 | Treatment of sickle cell disease | Apotex Europe B.V. | 23/02/2011 | |
| Defibrotide | EU/3/04/211 | Prevention of hepatic veno-occlusive disease | Gentium S.p.A. | 29/07/2004 | |
| Defibrotide | EU/3/04/212 | Treatment of hepatic veno-occlusive disease | Gentium S.p.A. | 29/07/2004 | |
| Denileukin diftitox | EU/3/01/075 | Treatment of cutaneous T-cell lymphoma | Eisai Limited | 11/12/2001 | |
| Denufosol tetrasodium | EU/3/05/342 | Treatment of cystic fibrosis | Merck Sharp & Dohme Limited | 23/12/2005 | |
| Desipramine hydrochloride | EU/3/09/643 | Treatment of Rett syndrome | Targeon SAS | 12/06/2009 | |
| Dexamethasone (40 mg tablet) | EU/3/10/745 | Treatment of multiple myeloma | Laboratoires CTRS (Cell Therapies Research & Services) | 09/06/2010 | |
| Dexamethasone phosphate (iontophoretic solution, ocular use) | EU/3/09/636 | Treatment of corneal graft rejection |
Interface International Consultancy Limited | 15/05/2009 | |
| Dexamethasone sodium phosphate encapsulated in human erythrocytes | EU/3/04/230 | Treatment of cystic fibrosis | Erydel S.p.A. | 20/10/2004 | |
| Dexrazoxane | EU/3/01/059 | Treatment of anthracycline extravasations | SpePharm Holding B.V. | 19/09/2001 | Savene EU/1/06/350 28/07/2006 |
| dimethyl sulfoxide | EU/3/05/263 | Treatment of severe closed traumatic brain injury | AOP Orphan Pharmaceuticals AG | 03/03/2005 | |
| Dinaciclib | EU/3/11/901 | Treatment of chronic lymphocytic leukaemia | Merck Sharp & Dohme Limited | 27/09/2011 | |
| Dipalmitoylphosphatidylcholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol, sodium salt, synthetic surfactant protein C analogue and synthetic surfactant protein B analogue | EU/3/12/982 | Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age | Chiesi Farmaceutici S.P.A. | 02/04/2012 | |
| Diphenylcyclopropenone | EU/3/06/379 | Treatment of alopecia totalis | Orfagen | 29/06/2006 | |
| Diphenylcyclopropenone | EU/3/06/380 | Treatment of alopecia universalis | Orfagen | 29/06/2006 | |
| Donor lymphocyte preparation depleted of functional alloreactive T-cells | EU/3/08/561 | Prevention of Graft-versus-Host disease | Kiadis Pharma Netherlands B.V. | 05/09/2008 | |
| Doxorubicin (administered after synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine) | EU/3/12/1006 | Treatment of glioma | Avena Therapeutics Ltd | 28/11/2012 | |
| Doxorubicin hydrochloride (drug eluting beads) | EU/3/07/507 | Treatment of glioma | Biocompatibles UK Limited | 29/11/2007 | |
| Doxorubicin hydrochloride (in heat-sensitive liposomes) | EU/3/10/833 | Treatment of hepatocellular carcinoma | Biological Consulting Europe Ltd | 23/02/2011 | |
| Doxorubicin hydrochloride (liposomal) | EU/3/06/410 | Treatment of soft tissue sarcoma | GP-Pharm S.A. | 27/10/2006 | |
| Doxorubicin polyisohexylcyanoacrylate nanoparticles | EU/3/04/229 | Treatment of the hepatocellular carcinoma | BioAlliance Pharma | 21/10/2004 | |
| Doxycycline hyclate | EU/3/12/955 | Treatment of familial amyloid polyneuropathy | Giampaolo Merlini | 02/04/2012 | |
| Doxycycline hyclate | EU/3/12/961 | Treatment of systemic amyloidosis caused by beta-2 microglobulin | Giampaolo Merlini | 05/03/2012 | |
| Drotrecogin alfa (activated) | EU/3/08/565 | Treatment of acute respiratory distress syndrome | Drugrecure Aps | 22/09/2008 | |
| Dry extract from birch bark (DER 0.1-0.2:1), extraction solvent n-heptane 95% (V/V) | EU/3/10/845 | Treatment of epidermolysis bullosa | Birken AG | 23/02/2011 | |
| Duramycin | EU/3/02/120 | Treatment of cystic fibrosis | AOP Orphan Pharmaceuticals AG | 13/11/2002 | |
| E. Coli heat-shock protein 70 with bovine retinal S-antigen | EU/3/05/346 | Treatment of autoimmune uveitis | Biotech Tools SA | 24/01/2006 | |
| (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone | EU/3/05/279 | Treatment of cutaneous T-cell lymphoma | Celgene Europe Limited | 27/05/2005 | |
| (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone | EU/3/05/328 | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Celgene Europe Limited | 28/10/2005 | |
| (E)-2,4,6-trimethoxystyryl-3-carboxymethylamino-4-methoxybenzyl-sulfone sodium salt | EU/3/12/987 | Treatment of myelodysplastic syndromes | JJGConsultancy Ltd | 26/04/2012 | |
| Ecopipam | EU/3/09/717 | Treatment of Lesch-Nyhan disease | Dr. Alain Munoz | 03/02/2010 | |
| Ecteinascidin 743 | EU/3/01/039 | Treatment of soft tissue sarcoma | Pharma Mar S.A. | 30/05/2001 | |
| Ecteinascidin 743 | EU/3/01/039 | Treatment of soft tissue sarcoma | Pharma Mar S.A. | 30/05/2001 | Yondelis EU/1/07/417 17/09/2007 |
| Eculizumab | EU/3/03/166 | Treatment of paroxysmal nocturnal haemoglobinuria | Alexion Europe SAS | 17/10/2003 | Soliris EU/1/07/393 20/06/2007 |
| Eculizumab | EU/3/12/1015 | Treatment of infection-associated haemolytic uraemic syndrome | Alexion Europe SAS | 04/07/2012 | |
| Eculizumab | EU/3/09/653 | Treatment of atypical haemolytic uremic syndrome | Alexion Europe SAS | 24/07/2009 | |
| Eflornithine | EU/3/11/902 | Treatment of neuroblastoma | Cancer Prevention Pharma Limited | 27/09/2011 | |
| Eflornithine | EU/3/10/779 | Treatment of familial adenomatous polyposis | Cancer Prevention Pharma Limited | 20/09/2010 | |
| Eflornithine in combination with sulindac | EU/3/12/1086 | Treatment of familial adenomatous polyposis | Cancer Prevention Pharma Limited | 24/01/2013 | |
| Eicosapentaenoic acid | EU/3/09/666 | Treatment of familial adenomatous polyposis | S.L.A. Pharma (UK) Limited | 08/10/2009 | |
| Elafin | EU/3/07/443 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Proteo Biotech AG | 20/03/2007 | |
| Elotuzumab | EU/3/12/1037 | Treatment of multiple myeloma | Bristol-Myers Squibb Pharma EEIG | 09/08/2012 | |
| Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor | EU/3/12/1098 | Treatment of retinitis pigmentosa | Enpharma Ltd | 24/01/2013 | |
| Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor | EU/3/12/1072 | Treatment of macular telangiectasia type 2 | Enpharma Ltd | 08/11/2012 | |
| Entinostat | EU/3/10/732 | Treatment of Hodgkin's lymphoma | Ockham Europe Limited | 10/06/2010 | |
| Enzastaurin hydrochloride | EU/3/07/442 | Treatment of diffuse large B cell lymphoma | Eli Lilly Nederland B.V. | 20/03/2007 | |
| Enzastaurin hydrochloride | EU/3/05/343 | Treatment of glioma | Eli Lilly Nederland B.V. | 23/12/2005 | |
| Eptacog alfa (activated) | EU/3/05/333 | Treatment of diffuse alveolar haemorrhage | Pharmaorigin ApS | 14/12/2005 | |
| Erdosteine | EU/3/12/1084 | Treatment of lead toxicity | Rafifarm SRL | 06/12/2012 | |
| Erdosteine | EU/3/12/1067 | Treatment of mercury toxicity | Rafifarm SRL | 08/11/2012 | |
| Estradiol Hemihydrate and Progesterone | EU/3/05/275 | Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age | Dr. Frank Pohlandt | 11/04/2005 | |
| Ethanol (96 per cent ) (gel for injection) | EU/3/04/191 | Treatment of congenital venous malformations | Orfagen | 08/03/2004 | |
| Ethanol (96 per cent ) (gel for injection) | EU/3/04/190 | Treatment of congenital lymphatic malformations | Orfagen | 08/03/2004 | |
| Ethyl Eicosopentaenoate | EU/3/00/013 | Treatment of Huntington´s disease | Amarin Neuroscience Limited | 29/12/2000 | |
| Etilefrin | EU/3/02/122 | Treatment of low flow priapism | Laboratoires SERB | 13/11/2002 | |
| Everolimus | EU/3/10/764 | Treatment of tuberous sclerosis | Novartis Europharm Limited | 04/08/2010 | Votubia EU/1/11/710 02/09/2011 |
| Exon 44 specific phosphorothioate oligonucleotide | EU/3/08/598 | Treatment of Duchenne muscular dystrophy | Prosensa Therapeutics B.V. | 27/02/2009 | |
| Exon 45 specific phosphorothioate oligonucleotide | EU/3/12/991 | Treatment of Duchenne muscular dystrophy | Prosensa Therapeutics B.V. | 26/04/2012 | |
| Exon 51 specific phosphorothioate oligonucleotide | EU/3/08/599 | Treatment of Duchenne muscular dystrophy | Glaxo Group Ltd | 27/02/2009 | |
| Exon 52 specific phosphorothioate oligonucleotide | EU/3/12/1077 | Treatment of Duchenne muscular dystrophy | Prosensa Therapeutics B.V. | 06/12/2012 | |
| Exon 53 specific phosphorothioate oligonucleotide | EU/3/12/992 | Treatment of Duchenne muscular dystrophy | Prosensa Therapeutics B.V. | 26/04/2012 | |
| Exon 55 specific phosphorothioate oligonucleotide | EU/3/12/1078 | Treatment of Duchenne muscular dystrophy | Prosensa Therapeutics B.V. | 06/12/2012 | |
| Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue | EU/3/09/667 | Treatment of anal fistula | TiGenix S.A.U | 08/10/2009 | |
| Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower | EU/3/05/302 | Treatment of sickle cell disease | Xechem UK Ltd | 26/08/2005 | |
| Ex-vivo cultured adult human mesenchymal stem cells | EU/3/07/432 | Treatment of Graft-versus-Host disease | Voisin Consulting S.A.R.L. | 20/02/2007 | |
| Ex-vivo expanded autologous human corneal epithelium containing stem cells | EU/3/08/579 | Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns |
Chiesi Farmaceutici S.P.A. | 07/11/2008 | |
| fampridine | EU/3/07/458 | Treatment of Guillain-Barré syndrome | Dr. Ulrich Granzer | 10/07/2007 | |
| Filgrastim | EU/3/08/580 | Treatment of spinal cord injury | Sygnis Bioscience GmbH & Co. KG | 07/11/2008 | |
| filgrastim | EU/3/08/532 | Treatment of amyotrophic lateral sclerosis | Sygnis Bioscience GmbH & Co. KG | 01/04/2008 | |
| Fingolimod | EU/3/09/718 | Treatment of chronic inflammatory demyelinating polyneuropathy | Novartis Europharm Limited | 02/02/2010 | |
| Fluocinolone acetonide (prolonged-release intravitreal implant) | EU/3/05/261 | Treatment of non-infectious uveitis affecting the posterior segment of the eye | Bausch & Lomb Ireland | 07/03/2005 | |
| Folic acid to be used with N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine | EU/3/12/1044 | Diagnosis of positive folate receptor status in ovarian cancer | Endocyte Europe B.V. | 10/09/2012 | |
| Forodesine | EU/3/10/780 | Treatment of chronic lymphocytic leukaemia | Mundipharma Research Limited | 20/09/2010 | |
| Forodesine hydrochloride | EU/3/06/421 | Treatment of acute lymphoblastic leukaemia | Napp Pharmaceuticals Research Limited | 18/12/2006 | |
| Forodesine hydrochloride | EU/3/06/428 | Treatment of cutaneous T-cell lymphoma | Napp Pharmaceuticals Research Limited | 29/01/2007 | |
| Fresolimumab | EU/3/11/882 | Treatment of focal segmental glomerulosclerosis | Genzyme Europe B.V. | 05/08/2011 | |
| Fumagillin | EU/3/01/081 | Treatment of diarrhoea associated with intestinal microsporidial infection | Sanofi-Aventis groupe | 04/02/2002 | |
| G17(9) gastrin-diphtheria toxoid conjugate | EU/3/02/129 | Treatment of pancreatic cancer | Cato Europe GmbH | 24/01/2003 | |
| G17(9) gastrin-diphtheria toxoid conjugate | EU/3/02/130 | Treatment of gastric cancer | Cato Europe GmbH | 28/01/2003 | |
| Gadodiamide (liposomal) | EU/3/08/583 | Treatment of glioma | Dr. Matthias Luz | 03/12/2008 | |
| Gallium (68Ga)-pasireotide tetraxetan | EU/3/11/920 | Diagnosis of gastro-entero-pancreatic neuroendocrine tumours | OctreoPharm Sciences GmbH | 27/10/2011 | |
| Gemtuzumab Ozogamicin | EU/3/00/005 | Treatment of acute myeloid leukaemia | Pfizer Limited | 18/10/2000 | |
| Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) | EU/3/06/405 | Treatment of renal cell carcinoma | MOLOGEN AG | 23/10/2006 | |
| Genetically modified human adenovirus encoding human PH20 hyaluronidase | EU/3/11/880 | Treatment of pancreatic cancer | VCN Biosciences S.L. | 21/06/2011 | |
| Genetically modified Lactococcus lactis bacteria containing the human trefoil factor 1 gene | EU/3/11/903 | Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy | ActoGeniX N.V. | 27/09/2011 | |
| Genistein sodium salt dihydrate | EU/3/12/980 | Treatment of mucopolysaccharidosis type III (Sanfilippo syndrome) | Axcentua Pharmaceuticals AB | 02/04/2012 | |
| Gevokizumab | EU/3/13/1111 | Treatment of chronic non-infectious uveitis | Les Laboratoires Servier | 12/03/2013 | |
| Gimatecan | EU/3/03/174 | Treatment of glioma | Sigma-Tau Industrie Farmaceutiche Riunite S.p.A | 01/12/2003 | |
| Givinostat | EU/3/09/704 | Treatment of systemic-onset juvenile idiopathic arthritis | Italfarmaco S.p.A. | 28/01/2010 | |
| Givinostat | EU/3/12/1009 | Treatment of Duchenne muscular dystrophy | Italfarmaco S.p.A. | 04/07/2012 | |
| Givinostat | EU/3/09/719 | Treatment of polycythaemia vera | Italfarmaco S.p.A. | 03/02/2010 | |
| Glucagon | EU/3/12/960 | Treatment of congenital hyperinsulinism | Biodel UK Limited | 05/03/2012 | |
| Glufosfamide | EU/3/11/851 | Treatment of pancreatic cancer | Theradex (Europe) Ltd. | 15/04/2011 | |
| Glutathione | EU/3/06/361 | Treatment of cystic fibrosis | Mukoviszidose e.V. | 11/04/2006 | |
| Glutathione-pegylated liposomal doxorubicin hydrochloride | EU/3/10/781 | Treatment of glioma | to-BBB Technologies BV | 20/09/2010 | |
| [gly2] Recombinant human glucagon-like peptide | EU/3/01/077 | Treatment of Short Bowel Syndrome | Nycomed Danmark ApS | 11/12/2001 | Revestive EU/1/12/787 30/08/2012 |
| Glyceryl tri-(4-phenylbutyrate) | EU/3/10/739 | Treatment of citrullinaemia type 2 | Hyperion Therapeutics Limited | 10/06/2010 | |
| Glyceryl tri-(4-phenylbutyrate) | EU/3/10/738 | Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) | Hyperion Therapeutics Limited | 10/06/2010 | |
| Glyceryl tri-(4-phenylbutyrate) | EU/3/10/736 | Treatment of argininosuccinic aciduria | Hyperion Therapeutics Limited | 10/06/2010 | |
| Glyceryl tri-(4-phenylbutyrate) | EU/3/10/734 | Treatment of ornithine carbamoyltransferase deficiency | Hyperion Therapeutics Limited | 10/06/2010 | |
| Glyceryl tri-(4-phenylbutyrate) | EU/3/10/737 | Treatment of hyperargininaemia | Hyperion Therapeutics Limited | 10/06/2010 | |
| Glyceryl tri-(4-phenylbutyrate) | EU/3/10/733 | Treatment of carbamoyl-phosphate synthase-1 deficiency | Hyperion Therapeutics Limited | 10/06/2010 | |
| Glyceryl tri-(4-phenylbutyrate) | EU/3/10/735 | Treatment of citrullinaemia type 1 | Hyperion Therapeutics Limited | 10/06/2010 | |
| Glycosylation independent lysosomal targeting tagged recombinant human acid alpha glucosidase | EU/3/11/921 | Treatment of glycogen storage disease type II (Pompe's disease) | BioMarin Europe Ltd | 27/10/2011 | |
| Guanabenz | EU/3/09/625 | Treatment of traumatic spinal cord injury | Acure Pharma AB | 29/04/2009 | |
| Gusperimus trihydrochloride | EU/3/01/034 | Treatment of Wegener’s granulomatosis | Nordic Group B.V. | 29/03/2001 | |
| Halofuginone Hydrobromide | EU/3/12/988 | Treatment of Duchenne muscular dystrophy | Biological Consulting Europe Ltd | 26/04/2012 | |
| Halofuginone Hydrobromide | EU/3/01/074 | Treatment of systemic sclerosis | PPD Global Ltd | 11/12/2001 | |
| H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt | EU/3/07/521 | Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients | Vaxon Biotech | 18/12/2007 | |
| H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 | EU/3/05/292 | Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) | Auris Medical Limited | 16/06/2005 | |
| Heat-killed Mycobacterium vaccae (whole cell) | EU/3/10/786 | Treatment of tuberculosis | Immodulon Therapeutics Ltd | 20/09/2010 | |
| Heparin sodium | EU/3/04/223 | Treatment of idiopathic pulmonary fibrosis | Prof. Dr. Seeger | 02/09/2004 | |
| Heparin sodium | EU/3/06/371 | Treatment of cystic fibrosis | Ockham Biotech Limited | 22/05/2006 | |
| Heparin sodium (inhalation use) | EU/3/05/337 | Treatment of cystic fibrosis | Vectura Group plc | 23/12/2005 | |
| Heparin-activated recombinant human fibroblast growth factor 1 (on a biodegradable device made from alpha-calcium sulphate hemihydrate) | EU/3/10/754 | Treatment of traumatic spinal cord injury | BioArctic Neuroscience AB | 27/07/2010 | |
| Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 | EU/3/06/407 | Prevention of necrotizing enterocolitis | Dr. Michael Moore | 31/10/2006 | |
| Hepatitis C Immunoglobulin | EU/3/05/295 | Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients | Biotest Pharma GmbH | 08/07/2005 | |
| Herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes | EU/3/03/168 | Adjunctive treatment in hematopoietic cell transplantation | MolMed S.p.A. | 20/10/2003 | |
| Herpes simplex virus lacking infected cell protein 34.5 | EU/3/03/153 | Treatment of glioma | Virttu Biologics Limited | 09/07/2003 | |
| Heterologous human adult liver derived stem cells | EU/3/07/506 | Treatment of Crigler-Najjar syndrome | Promethera Biosciences | 29/11/2007 | |
| Heterologous human adult liver derived stem cells | EU/3/08/530 | Treatment of ornithinine transcarbamylase deficiency | Promethera Biosciences | 04/02/2008 | |
| Heterologous human adult liver-derived stem cells | EU/3/11/904 | Treatment of ornithine transcarbamylase deficiency | Fresenius Medical Care Deutschland GmbH | 27/09/2011 | |
| Heterologous human adult liver-derived stem cells | EU/3/12/971 | Treatment of carbamoyl-phosphate synthase-1 deficiency | Fresenius Medical Care Deutschland GmbH | 05/03/2012 | |
| Heterologous human adult liver-derived stem cells | EU/3/12/983 | Treatment of acute liver failure | Fresenius Medical Care Deutschland GmbH | 26/04/2012 | |
| Hexasodium phytate | EU/3/12/1026 | Treatment of calciphylaxis | Sanifit Laboratoris, S.L. | 17/07/2012 | |
| Histamine dihydrochloride | EU/3/05/272 | Treatment of acute myeloid leukaemia | Meda AB | 11/04/2005 | Ceplene EU/1/08/477 07/10/2008 |
| HLA class I/II binding tumour associated peptides (ADF-APO-CCN-GUC-K67-MET- MMP-MUC-RGS) | EU/3/07/433 | Treatment of renal cell carcinoma | Immatics Biotechnologies GmbH | 15/02/2007 | |
| HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor | EU/3/04/202 | Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients | Cellcure A/S | 21/06/2004 | |
| HLA-B27 derived peptide (amino acid 125-138) | EU/3/04/219 | Treatment of autoimmune uveitis | Dr. Gerhild Wildner | 02/09/2004 | |
| Homoharringtonine | EU/3/04/228 | Treatment of acute myeloid leukaemia | Teva Pharma GmbH | 20/10/2004 | |
| Homoharringtonine | EU/3/04/224 | Treatment of chronic myeloid leukaemia | Teva Pharma GmbH | 02/09/2004 | |
| Human Alpha1-Proteinase Inhibitor (respiratory use) | EU/3/01/044 | Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency | CSL Behring GmbH | 09/07/2001 | |
| Human anthrax immunoglobulin | EU/3/09/691 | Treatment of inhalation anthrax disease | Emergent Sales and Marketing Germany GmbH | 05/11/2009 | |
| Human anthrax immunoglobulin | EU/3/09/690 | Post-exposure prophylaxis of inhalation anthrax disease | Emergent Sales and Marketing Germany GmbH | 09/11/2009 | |
| Human anthrax monoclonal antibody | EU/3/11/852 | Treatment of inhalation anthrax disease | Emergent Sales and Marketing Germany GmbH | 15/04/2011 | |
| Human anthrax monoclonal antibody | EU/3/11/891 | Post-exposure prophylaxis of inhalation anthrax disease | Emergent Sales and Marketing Germany GmbH | 05/08/2011 | |
| Human anti-intercellular adhesion molecule 1 monoclonal antibody | EU/3/08/600 | Treatment of multiple myeloma | BioInvent International AB | 20/01/2009 | |
| Human apotransferrin | EU/3/12/1027 | Treatment of congenital hypotransferrinaemia | Sanquin Blood Supply Foundation | 17/07/2012 | |
| Human autologous bone-forming cells derived from bone marrow stem cells | EU/3/07/490 | Treatment of non-traumatic osteonecrosis | Bone Therapeutics SA | 29/10/2007 | |
| Human autologous mesenchymal adult stem cells extracted from adipose tissue | EU/3/05/303 | Treatment of anal fistula | TiGenix S.A.U | 26/08/2005 | |
| Human coagulation factor X | EU/3/07/471 | Treatment of hereditary factor X deficiency | Bio Products Laboratory | 17/09/2007 | |
| Human cytomegalovirus immunoglobulin | EU/3/06/408 | Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection | Biotest Pharma GmbH | 31/10/2006 | |
| Human dermal fibroblasts cultured on a bioresorbable polyglactin mesh | EU/3/11/873 | Treatment of epidermolysis bullosa | Shire Pharmaceuticals Ireland Limited | 21/06/2011 | |
| Human embryonic stem-cell-derived retinal pigment epithelial cells | EU/3/11/874 | Treatment of Stargardt’s disease | TMC Pharma Services Ltd. | 21/06/2011 | |
| Human erythrocytes encapsulating inositol hexaphosphate | EU/3/12/1008 | Treatment of sickle cell disease | ERYtech Pharma S.A. | 04/07/2012 | |
| Human haptoglobin | EU/3/11/936 | Treatment of sickle cell disease | Bio Products Laboratory Ltd | 09/12/2011 | |
| Human heterologous liver cells (for infusion) | EU/3/10/819 | Treatment of hyperargininaemia | Cytonet GmbH & Co. KG | 17/12/2010 | |
| Human heterologous liver cells (for infusion) | EU/3/10/820 | Treatment of argininosuccinic aciduria | Cytonet GmbH & Co. KG | 17/12/2010 | |
| Human heterologous liver cells (for infusion) | EU/3/10/818 | Treatment of citrullinaemia type 1 | Cytonet GmbH & Co. KG | 17/12/2010 | |
| Human heterologous liver cells (for infusion) | EU/3/07/470 | Treatment of ornithine-transcarbamylase deficiency | Cytonet GmbH & Co. KG | 14/09/2007 | |
| Human heterologous liver cells (for infusion) | EU/3/10/821 | Treatment of carbamoyl-phosphate synthase-1 deficiency | Cytonet GmbH & Co. KG | 17/12/2010 | |
| Human heterologous liver cells (for infusion) | EU/3/06/362 | Treatment of acute liver failure | Cytonet GmbH & Co. KG | 11/04/2006 | |
| Human immunoglobulin | EU/3/03/170 | Treatment of polymyositis | Orfagen | 24/10/2003 | |
| Human immunoglobulin | EU/3/03/169 | Treatment of dermatomyositis | Orfagen | 20/10/2003 | |
| Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein | EU/3/05/334 | Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) | Edimer Ltd | 14/12/2005 | |
| Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) | EU/3/06/417 | Treatment of renal cell carcinoma | Immunservice GmbH | 27/10/2006 | |
| Human MHC non-restricted cytotoxic T-cell line | EU/3/09/696 | Treatment of ovarian cancer | Galileo Research S.r.l. | 30/11/2009 | |
| Human monoclonal antibody against CD4 | EU/3/04/198 | Treatment of cutaneous T-cell lymphoma | Genmab A/S | 14/04/2004 | |
| Human monoclonal antibody against Fas ligand | EU/3/12/956 | Treatment of pemphigus | PinCell s.r.l. | 09/02/2012 | |
| Human monoclonal antibody against Pseudomonas aeruginosa IATS-O1 | EU/3/09/705 | Treatment of pneumonia caused by serotype O1 Pseudomonas aeruginosa | Envestia Limited | 28/01/2010 | |
| Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 | EU/3/06/381 | Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa | Voisin Consulting S.A.R.L. | 29/06/2006 | |
| Human monoclonal antibody targeting Staphylococcus aureus alpha-toxin | EU/3/12/968 | Treatment of pneumonia caused by Staphylococcus aureus | Envestia Limited | 05/03/2012 | |
| Human papilloma virus type 16 E6/E7 synthetic long peptides | EU/3/07/520 | Treatment of epithelial neoplasia of the vulva positive for human papilloma virus | ISA Therapeutics B.V. | 20/12/2007 | |
| Human plasmin | EU/3/10/834 | Treatment of acute peripheral arterial occlusion | Grifols Deutschland GmbH | 23/02/2011 | |
| Human plasminogen | EU/3/07/461 | Treatment of ligneous conjunctivitis | Kedrion S.p.A. | 03/08/2007 | |
| Human platelet antigen-1a immunoglobulin | EU/3/11/922 | Prevention of fetal and neonatal alloimmune thrombocytopenia due to human platelet antigen-1a incompatibility | Prophylix Pharma AS | 27/10/2011 | |
| Human Staphylococcus aureus immunoglobulin | EU/3/05/319 | Treatment of Staphylococcus aureus bacteremia | Biotest Pharma GmbH | 28/10/2005 | |
| Human telomerase reverse transcriptase peptide (611-626) | EU/3/06/384 | Treatment of pancreatic cancer | Gemvax A/S | 25/07/2006 | |
| Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys | EU/3/09/677 | Treatment of acute lung injury | Apeptico Forschung und Entwicklung GmbH | 08/10/2009 | |
| Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein | EU/3/05/290 | Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck | Viventia Biotech (EU) Limited | 20/06/2005 | |
| Humanised IgG1 kappa antibody against serum amyloid A and AL amyloid | EU/3/13/1100 | Treatment of amyloid light-chain amyloidosis | Onclave Therapeutics Limited | 08/02/2013 | |
| Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 | EU/3/09/638 | Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation | Opsona Therapeutics Limited | 15/05/2009 | |
| Humanised monoclonal antibody against epidermal growth factor receptor | EU/3/12/1029 | Treatment of glioma | AbbVie Ltd | 09/08/2012 | |
| Humanised monoclonal antibody against myostatin | EU/3/13/1105 | Treatment of Duchenne muscular dystrophy | Pfizer Limited | 08/02/2013 | |
| Humanised monoclonal antibody against P-selectin | EU/3/12/1034 | Treatment of sickle cell disease | Quintiles Ireland Ltd | 09/08/2012 | |
| Humanised monoclonal antibody to the folate receptor alpha | EU/3/08/535 | Treatment of ovarian cancer | Eisai Europe Limited | 01/04/2008 | |
| Humanised monoclonal IgG4 antibody against tissue factor pathway inhibitor | EU/3/12/1052 | Treatment of haemophilia A | Novo Nordisk A/S | 10/10/2012 | |
| Humanised single chain monoclonal antibody against CD37 | EU/3/12/1083 | Treatment of chronic lymphocytic leukaemia | Emergent Product Development UK Limited | 06/12/2012 | |
| Humanized Agonistic Anti-CD28 Monoclonal Antibody | EU/3/05/276 | Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) | TeGenero AG | 11/04/2005 | |
| Hydrocortisone (modified release tablet) | EU/3/07/441 | Treatment of adrenal insufficiency | Diurnal Limited | 20/03/2007 | |
| Hydrocortisone (modified release tablet) | EU/3/05/296 | Treatment of congenital adrenal hyperplasia | Diurnal Limited | 27/07/2005 | |
| Hydrocortisone (modified release tablet) | EU/3/06/372 | Treatment of adrenal insufficiency | ViroPharma SPRL-BVBA | 22/05/2006 | Plenadren EU/1/11/715 03/11/2011 |
| Hydroxy-propyl-beta-cyclodextrin | EU/3/11/895 | Treatment of Niemann-Pick disease, type C | Susan French | 30/08/2011 | |
| Hydroxyurea | EU/3/03/154 | Treatment of sickle cell syndrome | Addmedica SAS | 09/07/2003 | Siklos EU/1/07/397 29/06/2007 |
| Hypothiocyanite / lactoferrin | EU/3/09/654 | Treatment of cystic fibrosis | Alaxia | 24/07/2009 | |
| Ibuprofen | EU/3/01/020 | Treatment of patent ductus arteriosus | Orphan Europe S.A.R.L. | 14/02/2001 | Pedea EU/1/04/284 29/07/2004 |
| Icatibant acetate | EU/3/03/133 | treatment of angioedema | Jerini AG | 17/02/2003 | Firazyr EU/1/08/461 11/07/2008 |
| Idebenone | EU/3/07/437 | Treatment of Duchenne muscular dystrophy | Santhera Pharmaceuticals (Deutschland) GmbH | 20/03/2007 | |
| Idebenone | EU/3/07/434 | Treatment of Leber's hereditary optic neuropathy | Santhera Pharmaceuticals (Deutschland) GmbH | 15/02/2007 | |
| Idebenone | EU/3/01/062 | Treatment of Friedreich’s ataxia | Laboratoires Takeda | 20/11/2001 | |
| Idebenone | EU/3/04/189 | Treatment of Friedreich’s ataxia | Santhera Pharmaceuticals (Deutschland) GmbH | 08/03/2004 | |
| Iduronate-2-sulfatase | EU/3/01/078 | Treatment of Mucopolysaccharidosis, type II (Hunter Syndrome) | Shire Human Genetic Therapies AB | 11/12/2001 | Elaprase EU/1/06/365 08/01/2007 |
| IL-12-secreting dendritic cells, loaded with autologous tumour lysate | EU/3/12/1058 | Treatment of glioma | Activartis Biotech GmbH | 08/11/2012 | |
| Iloprost | EU/3/00/014 | Treatment of primary and of the following forms of secondary pulmonary hypertension: connective tissue disease pulmonary hypertension, drug-induced pulmonary hypertension, portopulmonary hypertension, pulmonary hypertension associated with congenital heart disease, chronic thromboembolic pulmonary hypertension | Bayer Schering Pharma AG | 29/12/2000 | Ventavis EU/1/03/255 16/09/2003 |
| Imexon | EU/3/05/341 | Treatment of ovarian cancer | ICON Clinical Research (U.K.) Limited | 23/12/2005 | |
| Inolimomab | EU/3/01/028 | Treatment of Graft versus Host Disease | EUSA Pharma SAS | 05/03/2001 | |
| Interferon beta | EU/3/07/505 | Treatment of acute lung injury | Faron Pharmaceuticals Limited | 29/11/2007 | |
| Interferon gamma | EU/3/07/491 | Treatment of idiopathic pulmonary fibrosis | mondoBIOTECH Laboratories AG | 29/10/2007 | |
| Interferon gamma | EU/3/11/935 | Treatment of Friedreich's ataxia | Prof. Roberto Testi | 09/12/2011 | |
| Iodine (123I) Serum Amyloid P | EU/3/03/134 | Diagnosis of the extent of histologically proven amyloidosis | Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. | 14/02/2003 | |
| Iodine (131I) anti-tenascin monoclonal antibody 81C6 | EU/3/06/418 | Treatment of glioma | The Weinberg Group Ltd | 30/10/2006 | |
| Iodine (131I) chimeric IgG monoclonal antibody cG250 | EU/3/02/095 | Treatment of renal cell carcinoma | Wilex AG | 19/03/2002 | |
| Iodine (131I) chlorotoxin | EU/3/07/492 | Treatment of glioma | The Weinberg Group Ltd | 22/10/2007 | |
| Iodine (131I) iobenguane | EU/3/07/525 | Treatment of neuroblastoma | Molecular Insight Limited | 31/01/2008 | |
| Iodine (¹³¹I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody | EU/3/02/119 | Treatment of glioma | Interface International Consultancy Limited | 13/11/2002 | |
| Iodine (¹³¹I) tositumomab | EU/3/03/136 | Treatment of follicular lymphoma | GlaxoSmithKline Research & Development Limited | 14/02/2003 | |
| Irinotecan hydrochloride (drug eluting beads) | EU/3/07/504 | Treatment of glioma | Biocompatibles UK Limited | 29/11/2007 | |
| Isofagomine tartrate | EU/3/07/493 | Treatment of Gaucher Disease | Amicus Therapeutics UK Limited | 23/10/2007 | |
| Ixazomib | EU/3/12/1060 | Treatment of systemic light chain amyloidosis | Takeda Global Research and Development Centre (Europe) Ltd | 08/11/2012 | |
| Ketoconazole | EU/3/12/1031 | Treatment of Cushing’s syndrome | Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare | 09/08/2012 | |
| Ketoconazole | EU/3/12/965 | Treatment of Cushing’s syndrome | Laboratoire HRA Pharma | 23/04/2012 | |
| Kifunensine | EU/3/11/908 | Treatment of gamma-sarcoglycanopathy | Généthon | 27/09/2011 | |
| Kifunensine | EU/3/11/907 | Treatment of delta-sarcoglycanopathy | Généthon | 27/09/2011 | |
| Kifunensine | EU/3/11/905 | Treatment of alpha-sarcoglycanopathy | Généthon | 27/09/2011 | |
| Kifunensine | EU/3/11/906 | Treatment of beta-sarcoglycanopathy | Généthon | 27/09/2011 | |
| l, 1´-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane | EU/3/04/227 | Treatment to mobilize progenitor cells prior to stem cell transplantation | Genzyme Europe B.V. | 20/10/2004 | Mozobil EU/1/09/537 31/07/2009 |
| Laronidase | EU/3/01/022 | Treatment of Mucopolysaccharidosis, type I | Genzyme Europe B.V. | 14/02/2001 | Aldurazyme EU/1/03/253 10/06/2003 |
| L-Asparaginase | EU/3/04/258 | Treatment of acute lymphoblastic leukaemia | medac Gesellschaft für klinische Spezialpräparate mbH | 26/01/2005 | |
| L-asparaginase encapsulated in erythrocytes | EU/3/06/409 | Treatment of acute lymphoblastic leukaemia | ERYtech Pharma S.A. | 27/10/2006 | |
| L-asparaginase encapsulated in erythrocytes | EU/3/13/1106 | Treatment of acute myeloid leukaemia | ERYtech Pharma S.A. | 08/02/2013 | |
| L-asparaginase encapsulated in erythrocytes | EU/3/09/633 | Treatment of pancreatic cancer | ERYtech Pharma S.A. | 15/05/2009 | |
| L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-, complex with keyhole limpet haemocyanin | EU/3/11/923 | Treatment of glioma | Orphix Consulting GmbH | 27/10/2011 | |
| Lenalidomide | EU/3/11/924 | Treatment of mantle cell lymphoma | Celgene Europe Limited | 27/10/2011 | |
| Lenalidomide | EU/3/12/1097 | Treatment of follicular lymphoma | Celgene Europe Limited | 24/01/2013 | |
| Lenalidomide | EU/3/11/868 | Treatment of diffuse large B-cell lymphoma | Celgene Europe Limited | 13/05/2011 | |
| Lenalidomide | EU/3/07/494 | Treatment of chronic lymphocytic leukaemia | Celgene Europe Limited | 19/11/2007 | |
| Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene | EU/3/10/822 | Treatment of Fanconi anaemia type A | Center for Biomedical Network Research on Rare Diseases (CIBERER) | 17/12/2010 | |
| Lentiviral vector containing the human ABCA4 gene | EU/3/09/720 | Treatment of Stargardt´s disease | Oxford Biomedica (UK) Ltd | 02/02/2010 | |
| Lentiviral vector containing the human MYO7A gene | EU/3/10/727 | Treatment of retinitis pigmentosa in Usher syndrome 1B | Oxford Biomedica (UK) Ltd | 23/03/2010 | |
| Lentiviral vector containing the human Wiskott Aldrich syndrome protein gene | EU/3/05/345 | Treatment of Wiskott-Aldrich syndrome | Généthon | 24/01/2006 | |
| Lenvatinib | EU/3/13/1121 | Treatment of papillary thyroid cancer | Eisai Europe Limited | 26/04/2013 | |
| Lenvatinib | EU/3/13/1119 | Treatment of follicular thyroid cancer | Eisai Europe Limited | 26/04/2013 | |
| Lestaurtinib | EU/3/06/389 | Treatment of acute myeloid leukaemia | Cephalon Europe | 25/07/2006 | |
| Letermovir | EU/3/12/999 | Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity | Menarini Ricerche S.p.A. | 06/06/2012 | |
| Levamisol hydrochloride | EU/3/05/324 | Treatment of nephrotic syndrome | Addmedica SAS | 28/10/2005 | |
| Levodopa and Carbidopa (Gastroenteral use) | EU/3/01/035 | Treatment of advanced idiopathic Parkinson´s disease with severe motor fluctuations and not responding to oral treatment | AbbVie Ltd | 10/05/2001 | |
| Levofloxacin hemihydrate | EU/3/08/566 | Treatment of cystic fibrosis | Mpex London Ltd | 23/09/2008 | |
| Levoglutamide | EU/3/12/1011 | Treatment of sickle cell disease | Emmaus Medical Europe Limited | 04/07/2012 | |
| Liarozole | EU/3/03/144 | Treatment of congenital ichthyoses | Stiefel Laboratories (U.K.) Limited | 10/06/2003 | |
| Lipopolysaccharide of Ochrobactrum intermedium | EU/3/11/941 | Prevention of sepsis in at-risk premature infants of less than or equal to 32 weeks of gestational age | Diomune S.L. | 11/01/2012 | |
| Liposomal combination of cytarabine and daunorubicin | EU/3/11/942 | Treatment of acute myeloid leukaemia | Celator (UK) Ltd | 11/01/2012 | |
| Liposomal daunorubicin | EU/3/12/1056 | Treatment of acute myeloid leukaemia | Galen limited | 10/10/2012 | |
| Lisuride hydrogen maleate | EU/3/11/869 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Sinoxa Pharma GmbH | 13/05/2011 | |
| Lithium citrate tetrahydrate (in reverse-micelle formulation) | EU/3/09/706 | Treatment of Huntington´s disease | Medesis Pharma | 28/01/2010 | |
| L-Lysine-N-acetyl-L-cysteinate | EU/3/01/026 | Treatment of cystic fibrosis | LABORATOIRES SMB SA | 14/02/2001 | |
| Lomitapide | EU/3/10/823 | Treatment of familial chylomicronaemia | Aegerion Pharmaceuticals | 17/12/2010 | |
| Low molecular weight dextran sulfate | EU/3/09/669 | Prevention of graft rejection during pancreatic islet transplantation | TikoMed AB | 09/10/2009 | |
| Low molecular weight dextran sulfate | EU/3/11/883 | Treatment for mobilisation of progenitor cells prior to stem cell transplantation | TikoMed AB | 05/08/2011 | |
| L-threo-3,4-dihydroxyphenylserine | EU/3/07/466 | Treatment of orthostatic hypotension in patients with multiple system atrophy | The Weinberg Group Ltd | 02/08/2007 | |
| L-threo-3,4-dihydroxyphenylserine | EU/3/07/465 | Treatment of orthostatic hypotension in patients with pure autonomic failure | The Weinberg Group Ltd | 02/08/2007 | |
| Lurbinectedin | EU/3/12/1053 | Treatment of ovarian cancer | Pharma Mar S.A. Sociedad Unipersonal | 10/10/2012 | |
| Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide | EU/3/07/523 | Treatment of gastro-entero-pancreatic neuroendocrine tumours | Advanced Accelerator Applications | 31/01/2008 | |
| Macitentan | EU/3/11/909 | Treatment of pulmonary arterial hypertension | Actelion Registration Ltd | 27/09/2011 | |
| Macitentan | EU/3/09/707 | Treatment of idiopathic pulmonary fibrosis | Actelion Registration Ltd | 28/01/2010 | |
| (manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21°-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) | EU/3/07/522 | Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy | Celtic Bio-Pharma Services Ltd | 31/01/2008 | |
| Mannitolum | EU/3/05/325 | Treatment of cystic fibrosis | Pharmaxis Pharmaceuticals Limited | 07/11/2005 | Bronchitol EU/1/12/760 13/04/2012 |
| Maribavir | EU/3/07/519 | Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk | ViroPharma SPRL-BVBA | 18/12/2007 | |
| Masitinib mesilate | EU/3/09/684 | Treatment of pancreatic cancer | AB Science S.A. | 28/10/2009 | |
| Mavoglurant | EU/3/12/1046 | Treatment of fragile X syndrome | Novartis Europharm Limited | 10/10/2012 | |
| Maytansinoid-conjugated human monoclonal antibody against mesothelin | EU/3/12/1073 | Treatment of malignant mesothelioma | Bayer Pharma AG | 06/12/2012 | |
| Maytansinoid-conjugated humanised monoclonal antibody against CD56 | EU/3/10/792 | Treatment of small cell lung cancer | ImmunoGen Europe Limited | 01/10/2010 | |
| Maytansinoid-conjugated humanised monoclonal antibody against CD56 | EU/3/10/835 | Treatment of multiple myeloma | ImmunoGen Europe Limited | 23/02/2011 | |
| Maytansinoid-conjugated humanised monoclonal antibody against CD56 | EU/3/10/746 | Treatment of Merkel cell carcinoma | ImmunoGen Europe Limited | 09/06/2010 | |
| Mecasermin | EU/3/05/307 | Treatment of primary growth hormone insensitivity syndrome | Ipsen Pharma | 26/08/2005 | |
| Mecasermin | EU/3/06/373 | Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects | Ipsen Pharma | 22/05/2006 | INCRELEX EU/1/07/402 03/08/2007 |
| Mecasermin rinfabate | EU/3/06/399 | Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age | Premacure AB | 28/08/2006 | |
| Melarsoprol | EU/3/12/1068 | Treatment of African trypanosomiasis | Pr. Peter Kennedy | 08/11/2012 | |
| Melatonin | EU/3/12/978 | Treatment of perinatal asphyxia | Dr. Nicola J. Robertson | 02/04/2012 | |
| Melatonin | EU/3/05/274 | Non-24-Hour Sleep-Wake Disorder in blind people with no light perception | ICON Clinical Research (U.K.) Limited | 11/04/2005 | |
| Mepolizumab | EU/3/13/1116 | Treatment of Churg-Strauss Syndrome | Glaxo Group Limited | 12/03/2013 | |
| Mepolizumab | EU/3/04/213 | Treatment of hypereosinophilic syndrome | Glaxo Group Limited | 29/07/2004 | |
| Mercaptopurine (oral liquid) | EU/3/07/496 | Treatment of acute lymphoblastic leukaemia | Only for Children Pharmaceuticals | 22/10/2007 | |
| Mercaptopurine (oral suspension) | EU/3/09/628 | Treatment of acute lymphoblastic leukaemia | Nova Laboratories Limited | 30/04/2009 | Xaluprine EU/1/11/727 09/03/2012 |
| Metastable technetium 99 [99mTc] demogastrin 2 | EU/3/06/400 | Diagnosis of medullary thyroid carcinoma | Biomedica Life Sciences SA | 28/08/2006 | |
| Methotrexate (oral liquid) | EU/3/07/495 | Treatment of acute lymphoblastic leukaemia | Only for Children Pharmaceuticals | 24/10/2007 | |
| Methoxsalen | EU/3/06/374 | Treatment of Graft-versus-Host disease | Johnson & Johnson Medical Ltd | 22/05/2006 | |
| Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate | EU/3/07/518 | Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension | Bayer Schering Pharma AG | 20/12/2007 | |
| Methyl O-4-O-[2-[2-[2-[2-[[N-[(1R)-1-[[4-(aminoiminomethyl)phenyl]methyl]-2-oxo-2-(1-piperidinyl)ethyl]-N2-[(4-methoxy-2,3,6-trimethylphenyl)sulfonyl]-L-a-asparaginyl-4-aminobutanoyl-N6-[5-[(3aS,4S,6aR)-hexahydro-2-oxo-1H-thieno[3,4-d]imidazol-4-yl]-1-oxopentyl]-L-lysyl]amino]ethoxy]ethoxy]ethoxy]ethyl]-2,3-di-O-methyl-6-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-ß-D-glucopyranuronosyl-(1->4)-O-2,3,6-tri-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-a-L-idopyranuronosyl-(1->4)-3-O-methyl-a-D-glucopyranoside 2,6-bis(hydrogen sulfate) octasodium salt | EU/3/11/884 | Prevention of ischaemia/reperfusion injury associated with solid organ transplantation | Endotis Pharma | 05/08/2011 | |
| Methylthioninium | EU/3/10/807 | Treatment of frontotemporal dementia with parkinsonism-17 | Prof. Claude Wischik | 26/11/2010 | |
| Methylthioninium | EU/3/10/805 | Treatment of behavioural variant frontotemporal dementia | Prof. Claude Wischik | 26/11/2010 | |
| Methylthioninium | EU/3/10/804 | Treatment of progressive supranuclear palsy | Prof. Claude Wischik | 26/11/2010 | |
| Methylthioninium | EU/3/10/806 | Treatment of progressive non-fluent aphasia | Prof. Claude Wischik | 26/11/2010 | |
| Metreleptin | EU/3/12/1022 | Treatment of Familial Partial Lipodystrophy | Aptiv Solutions (UK) Limited | 17/07/2012 | |
| Metreleptin | EU/3/12/1024 | Treatment of Lawrence syndrome | Aptiv Solutions (UK) Limited | 17/07/2012 | |
| Metreleptin | EU/3/12/1023 | Treatment of Barraquer-Simons syndrome | Aptiv Solutions (UK) Limited | 17/07/2012 | |
| Metreleptin | EU/3/12/1025 | Treatment of Berardinelli-Seip syndrome | Aptiv Solutions (UK) Limited | 17/07/2012 | |
| Metronidazole | EU/3/11/875 | Treatment of pouchitis | FORMAC Pharmaceuticals NV | 21/06/2011 | |
| Midostaurin | EU/3/04/214 | Treatment of acute myeloid leukaemia | Novartis Europharm Limited | 29/07/2004 | |
| Midostaurin | EU/3/10/765 | Treatment of mastocytosis | Novartis Europharm Limited | 04/08/2010 | |
| Mifepristone | EU/3/11/925 | Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin | Dr. Ulrich Granzer | 27/10/2011 | |
| Mifepristone | EU/3/09/614 | Treatment of hypercortisolism (Cushing´s syndrome) of endogenous origin | EXELGYN | 27/02/2009 | |
| Miglustat | EU/3/06/351 | Treatment of Niemann-Pick disease, type C | Actelion Registration Ltd | 16/02/2006 | Zavesca EU/1/02/238 20/11/2002 |
| Milatuzumab | EU/3/08/602 | Treatment of chronic lymphocytic leukaemia | Immunomedics GmbH | 19/01/2009 | |
| Milatuzumab | EU/3/08/601 | Treatment of multiple myeloma | Immunomedics GmbH | 19/01/2009 | |
| Milciclib maleate | EU/3/12/1059 | Treatment of malignant thymoma | Nerviano Medical Sciences Srl | 08/11/2012 | |
| Miltefosine | EU/3/08/567 | Treatment of cutaneous T-cell lymphoma | ExperGen Drug Development GmbH | 22/09/2008 | |
| Miltefosine | EU/3/05/282 | Treatment of Acanthamoeba keratitis | Orphanidis Pharma Research GmbH | 27/05/2005 | |
| Miltefosine | EU/3/02/104 | Treatment of visceral leishmaniasis | Zentaris GmbH | 12/06/2002 | |
| Mitotane | EU/3/02/102 | Treatment of adrenal cortical carcinoma | Laboratoire HRA Pharma | 12/06/2002 | Lysodren EU/1/04/273 28/04/2004 |
| Mixture of seven synthetic fragments consisting of p21 RAS peptides | EU/3/11/885 | Treatment of pancreatic cancer | Targovax AS | 05/08/2011 | |
| Mixture of two allogeneic human pancreatic cancer cell lines stably transduced with a retroviral vector encoding the murine alpha-(1,3)-galactosyltransferase gene | EU/3/12/1048 | Treatment of pancreatic cancer | European Medical Advisory Services Limited | 10/10/2012 | |
| Modified recombinant human C-type natriuretic peptide | EU/3/12/1094 | Treatment of achondroplasia | BioMarin Europe Ltd | 24/01/2013 | |
| Mogamulizumab | EU/3/11/943 | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | ProStrakan Limited | 11/01/2012 | |
| Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E | EU/3/08/595 | Treatment of anaplastic large cell lymphoma | Seattle Genetics UK Limited | 15/01/2009 | Adcetris EU/1/12/794 25/10/2012 |
| Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E | EU/3/08/596 | Treatment of Hodgkin lymphoma | Seattle Genetics UK Limited | 15/01/2009 | Adcetris EU/1/12/794 25/10/2012 |
| Multilamellar microvesicle comprising phosphatidylcholine, sphingomyelin, phosphatidylethanolamine, phosphatidylserine, phospatidylinositol and cholesterol | EU/3/11/896 | Treatment of cystic fibrosis | Lamellar Biomedical Ltd | 30/08/2011 | |
| Muramyl tripeptide phosphatidyl ethanolamine | EU/3/04/206 | Treatment of osteosarcoma | IDM Pharma S.A. | 21/06/2004 | Mepact EU/1/08/502 06/03/2009 |
| Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 | EU/3/08/592 | Treatment of hairy cell leukaemia | MedImmune Ltd | 04/12/2008 | |
| Murine IgM monoclonal antibody binding to alpha beta T-cell receptor | EU/3/13/1113 | Prevention of graft rejection following solid organ transplantation | CTI Clinical Trial and Consulting Services | 12/03/2013 | |
| Murine monoclonal antibody against CD26 | EU/3/10/808 | Treatment of graft-versus-host disease | ADIENNE S.r.l. | 26/11/2010 | |
| Mycophenolate mofetil | EU/3/05/298 | Treatment of Cushing’s syndrome secondary to ectopic ACTH secretion | Laboratoire HRA Pharma | 27/07/2005 | |
| N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide | EU/3/07/526 | Treatment of acute myeloid leukaemia | CanReg (Europe) Limited | 31/01/2008 | |
| N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide | EU/3/07/478 | Treatment of Hodgkin lymphoma | CanReg (Europe) Limited | 14/09/2007 | |
| N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide | EU/3/08/556 | Treatment of cystic fibrosis | Vertex Pharmaceuticals (U.K.) Limited | 08/07/2008 | Kalydeco EU/1/12/782 23/07/2012 |
| N-{2-Chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N´-(5-methyl-3-isoxazolyl) urea hydrochloride monohydrate | EU/3/10/747 | Treatment of renal cell carcinoma | Astellas Pharma Europe B.V. | 09/06/2010 | |
| N2´-Deacetyl-N2´-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody | EU/3/08/593 | Treatment of multiple myeloma | Biotest AG | 03/12/2008 | |
| N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl) amino] isonicotinamide hydrochloride | EU/3/10/824 | Treatment of acute myeloid leukaemia | Merck KGaA | 17/12/2010 | |
| N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride | EU/3/09/685 | Treatment of pancreatic cancer | Merck KGaA | 09/11/2009 | |
| [N-((2S,3R,3aS,3´R,4a´R,6S,6a´R,6b´S,7aR,12a´S,12b´S,Z)-3,6,11´,12b´-tetramethyl-2´,3a,3´,4,4´,4a´,5,5´,6,6´,6a´,6b´,7,7a,7´,8´,10´,12´,12a´,12b´-icosahydro-1´H,3H-spiro[furo[3,2-b]pyridine-2,9´-naphtho[2,1-a]azulene]-3´-yl)methanesulfonamide hydrochloride] | EU/3/11/859 | Treatment of chondrosarcoma | Voisin Consulting S.A.R.L. | 13/05/2011 | |
| N-3[[4(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl) oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) | EU/3/04/188 | Treatment of moderate and severe traumatic brain injury | Xytis Pharmaceuticals Limited | 23/02/2004 | |
| N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine to be used with folic acid | EU/3/12/1043 | Diagnosis of positive folate receptor status in ovarian cancer | Endocyte Europe B.V. | 10/09/2012 | |
| N-[4-(3-amino-1H-indazol-4-yl)phenyl]-N´-(2-fluoro-5-methylphenyl) urea | EU/3/07/517 | Treatment of hepatocellular carcinoma | AbbVie Ltd | 20/12/2007 | |
| N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide | EU/3/08/568 | Treatment of partial deep dermal and full thickness burn wounds | Creative Antibiotics Sweden AB | 22/09/2008 | |
| N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide | EU/3/11/897 | Treatment of tuberculosis | Pfizer Limited | 30/08/2011 | |
| N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt | EU/3/09/622 | Treatment of acute myeloid leukaemia | Ambit Europe Limited | 23/03/2009 | |
| N-(6-(2-aminophenylamino)-6-oxohexyl)-4-methylbenzamide | EU/3/10/793 | Treatment of Friedreich's ataxia | Repligen Europe Limited | 01/10/2010 | |
| N-acetylgalactosamine-4-sulfatase | EU/3/01/025 | Treatment of Mucopolysaccharidosis, type VI (Maroteaux-Lamy Syndrome) | BioMarin Europe Ltd | 14/02/2001 | Naglazyme EU/1/05/324 24/01/2006 |
| N-adamantanyl-N'-geranyl-ethylenediamine | EU/3/07/479 | Treatment of tuberculosis | RLM Consulting | 14/09/2007 | |
| Nafamostat mesilate | EU/3/10/782 | Treatment of cystic fibrosis | Mucokinetica Ltd | 20/09/2010 | |
| Naloxone hydrochloride dihydrate | EU/3/12/1057 | Treatment of cutaneous T-cell lymphoma | Winston Laboratories Ltd | 08/11/2012 | |
| Nanobody directed towards the human A1 domain of von Willebrand factor | EU/3/09/629 | Treatment of thrombotic thrombocytopenic purpura | Ablynx N.V. | 30/04/2009 | |
| Nanoliposomal irinotecan | EU/3/11/933 | Treatment of pancreatic cancer | Merrimack Pharmaceuticals UK Limited | 09/12/2011 | |
| Naptumomab estafenatox | EU/3/07/480 | Treatment of renal cell carcinoma | Active Biotech AB | 14/09/2007 | |
| N-Butyldeoxygalactonojirimycin | EU/3/12/1033 | Treatment of Fabry disease | Actelion Registration Ltd | 09/08/2012 | |
| N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt | EU/3/11/886 | Treatment of post-polycythaemia vera myelofibrosis | Gilead Sciences International Ltd | 05/08/2011 | |
| N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt | EU/3/11/887 | Treatment of post-essential thrombocythaemia myelofibrosis | Gilead Sciences International Ltd | 05/08/2011 | |
| N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt | EU/3/11/888 | Treatment of primary myelofibrosis | Gilead Sciences International Limited | 05/08/2011 | |
| nelarabine | EU/3/05/293 | Treatment of acute lymphoblastic leukaemia | Glaxo Group Limited | 16/06/2005 | Atriance EU/1/07/403 22/08/2007 |
| Nemorubicin hydrochloride | EU/3/05/300 | Treatment of hepatocellular carcinoma | Nerviano Medical Sciences Srl | 28/07/2005 | |
| NGR-human tumour necrosis factor | EU/3/08/549 | Treatment of malignant mesothelioma | MolMed S.p.A. | 03/06/2008 | |
| NGR-human tumour necrosis factor | EU/3/09/686 | Treatment of hepatocellular carcinoma | MolMed S.p.A. | 09/11/2009 | |
| NH2-Cys-Ser-Ser-Val-Thr-Ala-Trp-Thr-Thr-Gly-Cys-Gly-CONH2 | EU/3/11/910 | Treatment of traumatic spinal cord injury | PHARMAXON | 27/09/2011 | |
| N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide | EU/3/12/997 | Treatment of schwannoma | Sirius Regulatory Consulting Limited | 06/06/2012 | |
| N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide | EU/3/12/996 | Treatment of meningioma | Sirius Regulatory Consulting Limited | 06/06/2012 | |
| N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide | EU/3/12/993 | Treatment of neurofibromatosis type 2 | Sirius Regulatory Consulting Limited | 26/04/2012 | |
| Nilotinib | EU/3/06/375 | Treatment of chronic myeloid leukaemia | Novartis Europharm Limited | 22/05/2006 | Tasigna EU/1/07/422 19/11/2007 |
| Nimorazole | EU/3/10/842 | Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy | Azanta A/S | 23/02/2011 | |
| Nimorazole maleate | EU/3/12/952 | Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy | Conventia Medical LLP | 09/02/2012 | |
| Nimotuzumab | EU/3/08/550 | Treatment of pancreatic cancer | Oncoscience AG | 03/06/2008 | |
| Nintedanib | EU/3/13/1123 | Treatment of idiopathic pulmonary fibrosis | Boehringer Ingelheim International GmbH | 26/04/2013 | |
| Nitisinone | EU/3/00/012 | Treatment of tyrosinaemia type I | Swedish Orphan International AB | 29/12/2000 | Orfadin EU/1/04/303 21/02/2005 |
| Nitisinone | EU/3/02/096 | Treatment of alkaptonuria | Swedish Orphan International AB | 13/03/2002 | |
| [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone | EU/3/08/541 | Treatment of erythropoietic protoporphyria | Clinuvel (UK) Limited | 08/05/2008 | |
| [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone | EU/3/08/545 | Treatment of congenital erythropoietic porphyria | Clinuvel (UK) Limited | 08/05/2008 | |
| N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate | EU/3/06/401 | Treatment of familial amyloid polyneuropathy | Pfizer Limited | 28/08/2006 | Vyndaqel EU/1/11/717 16/11/2011 |
| N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole | EU/3/05/286 | Treatment of multiple myeloma | Dr. Geoffrey Allan | 20/06/2005 | |
| N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole | EU/3/04/242 | Treatment of mastocytosis | OxThera AB | 16/11/2004 | |
| N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole | EU/3/04/251 | Treatment of malignant gastro intestinal stromal tumours | AB Science S.A. | 21/12/2004 | |
| N,N'-bis(2-mercaptoethyl)isophthalamide | EU/3/11/944 | Treatment of mercury toxicity | CTI Science Limited | 11/01/2012 | |
| N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase | EU/3/09/615 | Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) | Dr. Ulrich Granzer | 27/02/2009 | |
| N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate | EU/3/10/811 | Treatment of post-polycythaemia vera myelofibrosis | Sanofi-Aventis groupe | 26/11/2010 | |
| N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate | EU/3/10/794 | Treatment of primary myelofibrosis | Sanofi-Aventis groupe | 01/10/2010 | |
| N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate | EU/3/10/810 | Treatment of post-essential thrombocythaemia myelofibrosis | Sanofi-Aventis groupe | 26/11/2010 | |
| Obinutuzumab | EU/3/12/1054 | Treatment of chronic lymphocytic leukaemia | Roche Registration Limited | 10/10/2012 | |
| Octenidine dihydrochloride | EU/3/10/755 | Prevention of late-onset sepsis in premature infants of less than or equal to 32 weeks of gestational age | Schülke & Mayr GmbH | 27/07/2010 | |
| Octocog alpha (liposomal) | EU/3/09/655 | Treatment of haemophilia A | Bayer Schering Pharma AG | 24/07/2009 | |
| Octreotide chloride (lipid depot solution) | EU/3/09/645 | Treatment of acromegaly | Camurus AB | 12/06/2009 | |
| Ofatumumab | EU/3/08/581 | Treatment of chronic lymphocytic leukaemia | Glaxo Group Limited | 07/11/2008 | Arzerra EU/1/10/625 19/04/2010 |
| Olaparib | EU/3/07/501 | Treatment of ovarian cancer | AstraZeneca AB | 06/12/2007 | |
| Oleylphosphocholine | EU/3/12/964 | Treatment of leishmaniasis | Dafra Pharma International NV | 23/04/2012 | |
| Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt | EU/3/05/327 | Treatment of glioma | Oligovax | 28/10/2005 | |
| Ombrabulin | EU/3/11/853 | Treatment of soft tissue sarcoma | Sanofi-Aventis groupe | 15/04/2011 | |
| Omigapil maleate | EU/3/08/544 | Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency | Santhera Pharmaceuticals (Deutschland) GmbH | 08/05/2008 | |
| Omigapil maleate | EU/3/08/540 | Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). | Santhera Pharmaceuticals (Deutschland) GmbH | 08/05/2008 | |
| Oregovomab | EU/3/02/109 | Treatment of ovarian cancer | ViRexx International Corp. Limited | 30/07/2002 | |
| Ornithine phenylacetate | EU/3/11/945 | Treatment of acute liver failure | Dr. Ulrich Granzer | 11/01/2012 | |
| Ovine anti-colchicine polyclonal antibody fragments | EU/3/10/825 | Treatment of colchicine poisoning | Laboratoires SERB | 17/12/2010 | |
| Oxalobacter formigenes strain HC-1 | EU/3/06/354 | Treatment of primary hyperoxaluria | OxThera AB | 17/02/2006 | |
| Paclitaxel (aqueous gel) | EU/3/10/846 | Treatment of oesophagus carcinoma | BTG plc | 23/02/2011 | |
| Paclitaxel (liposomal) | EU/3/06/419 | Treatment of pancreatic cancer | MediGene AG | 31/10/2006 | |
| Paclitaxel (micellar) | EU/3/06/422 | Treatment of ovarian cancer | Oasmia Pharmaceutical AB | 18/12/2006 | |
| Palifosfamide | EU/3/08/584 | Treatment of soft tissue sarcoma | Ziopharm Oncology Limited | 03/12/2008 | |
| Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) | EU/3/04/222 | Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency | Eli Lilly Nederland B.V. | 02/09/2004 | |
| Panobinostat | EU/3/12/1063 | Treatment of multiple myeloma | Novartis Europharm Limited | 08/11/2012 | |
| Paquinimod | EU/3/10/836 | Treatment of systemic sclerosis | Active Biotech AB | 23/02/2011 | |
| Para-aminosalicylic acid | EU/3/10/826 | Treatment of tuberculosis | Lucane Pharma SA | 17/12/2010 | |
| Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex | EU/3/06/367 | Treatment of solitary bone cysts | Kuros Biosurgery International AG | 11/04/2006 | |
| pasireotide | EU/3/09/670 | Treatment of acromegaly | Novartis Europharm Limited | 08/10/2009 | |
| pasireotide | EU/3/09/671 | Treatment of Cushing's disease | Novartis Europharm Limited | 08/10/2009 | Signifor EU/1/12/753 24/04/2012 |
| Pegylated arginine deiminase | EU/3/05/289 | Treatment of hepatocellular carcinoma | Dr. Francesco Izzo | 20/06/2005 | |
| Pegylated B-domain-deleted sequence-modified recombinant human factor VIII | EU/3/10/847 | Treatment of haemophilia A | Bayer Schering Pharma AG | 23/02/2011 | |
| Pegylated carboxyhaemoglobin | EU/3/09/698 | Treatment of sickle cell disease | Voisin Consulting S.A.R.L. | 26/11/2009 | |
| Pegylated L-asparaginase | EU/3/08/569 | Treatment of acute lymphoblastic leukaemia | Sigma-Tau Rare Diseases, S.A. | 22/09/2008 | |
| Pegylated proline-interferon alpha-2b | EU/3/11/932 | Treatment of polycythaemia vera | AOP Orphan Pharmaceuticals AG | 09/12/2011 | |
| Pegylated recombinant Erwinia chrysanthemi L-asparaginase | EU/3/11/889 | Treatment of acute lymphoblastic leukaemia | EUSA Pharma SAS | 05/08/2011 | |
| Pegylated recombinant factor VIIa | EU/3/08/551 | Treatment of haemophilia A | Novo Nordisk A/S | 04/06/2008 | |
| Pegylated recombinant factor VIIa | EU/3/08/552 | Treatment of haemophilia B | Novo Nordisk A/S | 03/06/2008 | |
| Pegylated recombinant factor VIII | EU/3/12/995 | Treatment of haemophilia A | Novo Nordisk A/S | 26/04/2012 | |
| Pegylated recombinant human factor IX | EU/3/09/640 | Treatment of haemophilia B | Novo Nordisk A/S | 15/05/2009 | |
| Pegylated recombinant phenylalanine ammonia lyase | EU/3/09/708 | Treatment of hyperphenylalaninaemia | BioMarin Europe Ltd | 28/01/2010 | |
| Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) | EU/3/05/329 | Treatment of the localised scleroderma | Digna Biotech S.L. | 28/10/2005 | |
| Peptide 144 TGF- ß1 inhibitor (TSLDASIIWAMMQN) | EU/3/05/326 | Treatment of systemic sclerosis | Digna Biotech S.L. | 28/10/2005 | |
| Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis | EU/3/09/689 | Treatment of myasthenia gravis | CuraVac Europe SPRL | 09/11/2009 | |
| Peretinoin | EU/3/11/890 | Treatment of hepatocellular carcinoma | Kowa Pharmaceutical Europe Co. Ltd. | 05/08/2011 | |
| Perifosine | EU/3/10/740 | Treatment of multiple myeloma | Æterna Zentaris GmbH | 10/06/2010 | |
| Phenylephrine Hydrochloride | EU/3/01/069 | Treatment of ileal pouch anal anastomosis related faecal incontinence | S.L.A. Pharma (UK) Limited | 20/11/2001 | |
| Picoplatin | EU/3/07/502 | Treatment of small cell lung cancer | Kendle International Ltd | 06/12/2007 | |
| Pirfenidone | EU/3/04/241 | Treatment of idiopathic pulmonary fibrosis | InterMune UK Limited | 16/11/2004 | Esbriet EU/1/11/667 28/02/2011 |
| Plerixafor | EU/3/11/931 | Adjunctive treatment to cytotoxic therapy in acute myeloid leukaemia | Genzyme Europe B.V. | 09/12/2011 | |
| Polihexanide | EU/3/07/498 | Treatment of Acanthamoeba keratitis | S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. | 14/11/2007 | |
| Poloxamer 188 | EU/3/13/1112 | Treatment of sickle cell disease | Theradex (Europe) Ltd. | 12/03/2013 | |
| Polyinosine-polycytidylic acid coupled with the polycationic polyethyleneimine | EU/3/12/1000 | Treatment of pancreatic cancer | Bioncotech Therapeutics S.L. | 06/06/2012 | |
| Pomalidomide | EU/3/12/986 | Treatment of systemic sclerosis | Celgene Europe Limited | 26/04/2012 | |
| Pomalidomide | EU/3/09/672 | Treatment of multiple myeloma | Celgene Europe Limited | 08/10/2009 | |
| Pomalidomide | EU/3/10/758 | Treatment of post-polycythaemia vera myelofibrosis | Celgene Europe Limited | 27/07/2010 | |
| Pomalidomide | EU/3/10/759 | Treatment of post-essential thrombocythaemia myelofibrosis | Celgene Europe Limited | 27/07/2010 | |
| Pomalidomide | EU/3/10/757 | Treatment of primary myelofibrosis | Celgene Europe Limited | 27/07/2010 | |
| Pralatrexate | EU/3/08/603 | Treatment of non-papillary transitional cell carcinoma of the urinary bladder | Allos Therapeutics Limited | 19/01/2009 | |
| Pralatrexate | EU/3/07/444 | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Allos Therapeutics Limited | 13/04/2007 | |
| Pralatrexate | EU/3/10/795 | Treatment of Hodgkin's lymphoma | Allos Therapeutics Limited | 01/10/2010 | |
| Pralatrexate | EU/3/10/741 | Treatment of cutaneous T-cell lymphoma | Choice Pharma Limited | 10/06/2010 | |
| Prasterone | EU/3/03/156 | Treatment of adrenal insufficiency | Medicom Healthcare BV | 28/07/2003 | |
| Pravastatin / zoledronic acid | EU/3/10/748 | Treatment of Hutchinson-Gilford progeria | Prenyl BIO SAS | 09/06/2010 | |
| Progesterone | EU/3/13/1101 | Treatment of moderate and severe traumatic brain injury | BHR Pharma Belgium | 08/02/2013 | |
| Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein | EU/3/02/101 | Treatment of glioma | EUDRAC Limited | 30/04/2002 | |
| Purified bromelain | EU/3/02/107 | Treatment of partial deep dermal and full thickness burns | Teva Pharma GmbH | 30/07/2002 | NexoBrid EU/1/12/803 18/12/2012 |
| Pyr-His-Trp-Ser-Tyr-D-Lys(doxorubicinylglutarate)-Leu-Arg-Pro-Gly-NH2, acetate salt | EU/3/10/766 | Treatment of ovarian cancer | Æterna Zentaris GmbH | 04/08/2010 | |
| Pyridoxalated haemoglobin polyoxyethylene | EU/3/07/463 | Treatment of cardiogenic shock | Curacyte AG | 02/08/2007 | |
| R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H -1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea | EU/3/07/452 | Treatment of gastric carcinoid | Trio Medicines Ltd | 14/06/2007 | |
| (R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole | EU/3/07/524 | Treatment of tuberculosis | Otsuka Novel Products GmbH | 01/02/2008 | |
| (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate | EU/3/08/572 | Treatment of chronic idiopathic myelofibrosis | Novartis Europharm Limited | 07/11/2008 | Jakavi EU/1/12/773 23/08/2012 |
| (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate | EU/3/09/620 | Treatment of myelofibrosis secondary to polycythemia vera or essential thrombocythemia | Incyte Corporation Ltd | 03/04/2009 | Jakavi EU/1/12/773 23/08/2012 |
| Raloxifene hydrochloride | EU/3/10/730 | Treatment of hereditary haemorrhagic telangiectasia | Consejo Superior de Investigaciones Cientificas (CSIC) | 10/06/2010 | |
| Ramiprilat | EU/3/13/1117 | Treatment of Stargardt’s disease | Iris Pharma | 12/03/2013 | |
| Ramoplanin | EU/3/01/049 | Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection | Vicuron Pharmaceuticals Italy srl, | 09/07/2001 | |
| Ramucirumab | EU/3/12/1019 | Treatment of hepatocellular carcinoma | Eli Lilly Nederland B.V. | 04/07/2012 | |
| Ramucirumab | EU/3/12/1004 | Treatment of gastric cancer | Eli Lilly Nederland B.V. | 04/07/2012 | |
| R-baclofen | EU/3/11/858 | Treatment of fragile X syndrome | Lakeside Regulatory Consulting Services Ltd | 15/04/2011 | |
| Recombinant adeno-associated viral vector containing human acid alfa-glucosidase-gene | EU/3/12/1018 | Treatment of glycogen storage disease type II (Pompe's disease) | TMC Pharma Services Ltd. | 04/07/2012 | |
| Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene | EU/3/07/440 | Treatment of congenital alpha-1 antitrypsin deficiency | TMC Pharma Services Ltd. | 20/03/2007 | |
| Recombinant adeno-associated viral vector containing the human CNGB3 gene | EU/3/13/1099 | Treatment of achromatopsia caused by mutations in the CNGB3 gene | TMC Pharma Services Ltd. | 08/02/2013 | |
| Recombinant antibody construct against human CD30 and CD16A | EU/3/09/673 | Treatment of Hodgkin lymphoma | Affimed Therapeutics AG | 09/10/2009 | |
| Recombinant antibody derivative against human CD19 and CD3 | EU/3/03/176 | Treatment of chronic lymphocytic leukaemia | AMGEN Research (Munich) Gmbh | 01/12/2003 | |
| Recombinant antibody derivative against human CD19 and CD3 | EU/3/03/175 | Treatment of mantle cell lymphoma | AMGEN Research (Munich) Gmbh | 01/12/2003 | |
| Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein | EU/3/12/1038 | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | AOP Orphan Pharmaceuticals AG | 09/08/2012 | |
| Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein | EU/3/12/1039 | Treatment of cutaneous T-cell lymphoma | AOP Orphan Pharmaceuticals AG | 09/08/2012 | |
| Recombinant chimeric monoclonal antibody against CD20 | EU/3/09/699 | Treatment of chronic lymphocytic leukaemia | LFB-Biotechnologies | 26/11/2009 | |
| Recombinant derivative of C3 transferase | EU/3/08/563 | Treatment of traumatic spinal cord injury | Triskel EU Services | 05/09/2008 | |
| Recombinant dog gastric lipase | EU/3/03/157 | Treatment of cystic fibrosis | Meristem Therapeutics S.A. | 09/07/2003 | |
| Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 | EU/3/07/453 | Treatment of haemophilia B (congenital factor IX deficiency) | Biogen Idec Limited | 08/06/2007 | |
| Recombinant fusion protein consisting of human coagulation factor VIII attached to the Fc domain of human IgG1 | EU/3/10/783 | Treatment of haemophilia A | Biogen Idec Limited | 20/09/2010 | |
| Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule | EU/3/09/709 | Treatment of glioma | Apogenix GmbH | 28/01/2010 | |
| Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule | EU/3/06/411 | Prevention of Graft-versus-Host disease | Apogenix GmbH | 31/10/2006 | |
| Recombinant fusion protein consisting of the extracellular portion of human activin receptor IIB linked to the human IgG1 Fc domain | EU/3/10/812 | Treatment of Duchenne muscular dystrophy | Shire Pharmaceuticals Ireland Limited | 26/11/2010 | |
| Recombinant fusion protein linking human coagulation factor IX with human albumin | EU/3/09/723 | Treatment of haemophilia B | CSL Behring GmbH | 04/02/2010 | |
| Recombinant fusion protein linking human coagulation factor VIIa with human albumin | EU/3/11/863 | Treatment of haemophilia B | CSL Behring GmbH | 13/05/2011 | |
| Recombinant fusion protein linking human coagulation factor VIIa with human albumin | EU/3/11/855 | Treatment of haemophilia A | CSL Behring GmbH | 15/04/2011 | |
| Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] | EU/3/08/553 | Treatment of glioma | Gregory Fryer Associates Ltd | 03/06/2008 | |
| Recombinant glycoprotein gp350 of Epstein-Barr virus | EU/3/02/118 | Prevention of post transplantation lympho-proliferative disorders | Henogen S.A. | 22/10/2002 | |
| Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors | EU/3/04/250 | Treatment of mantle cell lymphoma | CellGenix GmbH | 21/12/2004 | |
| Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors | EU/3/04/248 | Treatment of multiple myeloma | CellGenix GmbH | 21/12/2004 | |
| Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors | EU/3/04/249 | Treatment of follicular lymphoma | CellGenix GmbH | 23/12/2004 | |
| Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors | EU/3/09/656 | Treatment of diffuse large B-cell lymphoma | CellGenix GmbH | 24/07/2009 | |
| Recombinant homodimer of the human annexin V | EU/3/11/946 | Prevention of ischaemia/reperfusion injury associated with solid organ transplantation | Astellas Pharma Europe B.V. | 11/01/2012 | |
| Recombinant human acid alpha-glucosidase | EU/3/00/018 | Treatment of Glycogen Storage Disease type II (Pompe´s disease) | Genzyme Europe B.V. | 14/02/2001 | Myozyme EU/1/06/333 29/03/2006 |
| Recombinant human acid sphingomyelinase | EU/3/01/056 | Treatment of Niemann-Pick Disease, type B | Genzyme Europe B.V. | 19/09/2001 | |
| Recombinant human ADAMTS-13 | EU/3/08/588 | Treatment of thrombotic thrombocytopenic purpura | Baxter AG | 03/12/2008 | |
| Recombinant human alpha-Mannosidase | EU/3/04/260 | Treatment of alpha-Mannosidosis | Zymenex A/S | 26/01/2005 | |
| Recombinant human anti-interferon gamma monoclonal antibody | EU/3/10/749 | Treatment of haemophagocytic lymphohistiocytosis | NovImmune B.V. | 09/06/2010 | |
| Recombinant human arylsulfatase A | EU/3/10/813 | Treatment of metachromatic leukodystrophy | Shire Pharmaceuticals Ireland Limited | 26/11/2010 | |
| Recombinant human beta-glucuronidase | EU/3/12/973 | Treatment of mucopolysaccharidosis type VII (Sly syndrome) | NDA Regulatory Science Ltd | 21/03/2012 | |
| Recombinant human bile salt-stimulated lipase | EU/3/04/257 | Treatment of cystic fibrosis | Arexis AB | 26/01/2005 | |
| Recombinant human C1-inhibitor | EU/3/07/435 | Prevention of delayed graft function after solid organ transplantation | Pharming Group N.V. | 20/02/2007 | |
| Recombinant human CXCL8 mutant | EU/3/08/570 | Prevention of delayed graft function after solid organ transplantation | ProtAffin Biotechnologie AG | 22/09/2008 | |
| Recombinant human dyskerin | EU/3/12/1070 | Treatment of dyskeratosis congenita | Advanced Medical Projects | 08/11/2012 | |
| Recombinant human elafin | EU/3/09/710 | Treatment of oesophagus carcinoma | Proteo Biotech AG | 28/01/2010 | |
| Recombinant human galactocerebrosidase | EU/3/11/911 | Treatment of globoid cell leukodystrophy (Krabbe disease) | ACE BioSciences A/S | 27/09/2011 | |
| Recombinant human heat shock protein 70 | EU/3/13/1110 | Treatment of Niemann-Pick disease, type C | Orphazyme ApS | 12/03/2013 | |
| Recombinant human heparan N-sulfatase | EU/3/08/582 | Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) | Shire Pharmaceutical Development Limited | 07/11/2008 | |
| Recombinant human hepatitis C monoclonal antibody against C4 region of E1 | EU/3/07/503 | Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients | GENimmune N.V | 06/12/2007 | |
| Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein | EU/3/08/611 | Treatment of acute liver failure | Alfact Innovation SAS | 11/02/2009 | |
| Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 | EU/3/07/516 | Treatment of acute myeloid leukaemia | Xenetic Biosciences Plc | 20/12/2007 | |
| Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 | EU/3/10/840 | Treatment of acute lymphoblastic leukaemia | SymbioTec GmbH | 23/02/2011 | |
| Recombinant human interleukin-21 | EU/3/04/226 | Treatment of renal cell carcinoma | Bristol-Myers Squibb International Corporation | 02/09/2004 | |
| Recombinant human interleukin-7 | EU/3/12/1013 | Treatment of progressive multifocal leukoencephalopathy | CYTHERIS SA | 04/07/2012 | |
| Recombinant human lecithin cholesterol acyltransferase | EU/3/12/1051 | Treatment of lecithin cholesterol acyltransferase deficiency | Alphacore Pharma Limited | 10/10/2012 | |
| Recombinant human lysosomal acid lipase | EU/3/10/827 | Treatment of lysosomal acid lipase deficiency | Synageva BioPharma Ltd. | 17/12/2010 | |
| Recombinant human methionine proinsulin | EU/3/12/985 | Treatment of retinitis pigmentosa | ProRetina Therapeutics S.L. | 26/04/2012 | |
| Recombinant human minibody against complement component C5 | EU/3/08/571 | Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system | ADIENNE S.r.l. | 22/09/2008 | |
| Recombinant human minibody against complement component C5 | EU/3/11/926 | Treatment of primary membranoproliferative glomerulonephritis | ADIENNE S.r.l. | 27/10/2011 | |
| Recombinant Human minibody against complement component C5 fused with RGD-motif | EU/3/08/604 | Prevention of the ischemia/reperfusion injury associated with solid organ transplantation | ADIENNE S.r.l. | 20/01/2009 | |
| Recombinant human monoclonal antibody against activin receptor type IIB | EU/3/12/1035 | Treatment of inclusion body myositis | Novartis Europharm Limited | 09/08/2012 | |
| Recombinant human monoclonal antibody against transforming growth factor beta-1, 2 and 3 | EU/3/08/533 | Treatment of idiopathic pulmonary fibrosis | Genzyme Europe B.V. | 01/04/2008 | |
| Recombinant human monoclonal antibody of the IgG1 kappa class against prostate stem cell antigen | EU/3/12/1090 | Treatment of pancreatic cancer | Astellas Pharma Europe B.V. | 24/01/2013 | |
| Recombinant human monoclonal antibody to human interleukin (IL)-17A of the IgG1/k class | EU/3/09/724 | Treatment of chronic non-infectious uveitis | Novartis Europharm Limited | 02/02/2010 | |
| Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class | EU/3/08/605 | Treatment of spinal cord injury | Novartis Europharm Limited | 19/01/2009 | |
| Recombinant human N-acetylgalactosamine-6-sulfatase | EU/3/09/657 | Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) | BioMarin Europe Ltd | 24/07/2009 | |
| Recombinant human pentraxin-2 | EU/3/12/1020 | Treatment of idiopathic pulmonary fibrosis | Appletree Europe S.à.r.l. | 17/07/2012 | |
| Recombinant Human Porphobilinogen Deaminase | EU/3/02/103 | Treatment of acute intermittent porphyria | Zymenex A/S | 12/06/2002 | |
| Recombinant human proinsulin | EU/3/08/612 | Treatment of retinitis pigmentosa | ProRetina Therapeutics S.L. | 11/02/2009 | |
| Recombinant human rod-derived cone viability factor | EU/3/07/500 | Treatment of retinitis pigmentosa | Fovea Pharmaceuticals SA | 29/11/2007 | |
| Recombinant human serum amyloid P | EU/3/09/674 | Prevention of scarring post glaucoma filtration surgery | Appletree Europe S.à.r.l. | 09/10/2009 | |
| Recombinant human soluble Fc-gamma receptor Iib | EU/3/07/462 | Treatment of idiopathic thrombocytopenic purpura | SuppreMol GmbH | 02/08/2007 | |
| Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein | EU/3/08/594 | Treatment of hypophosphatasia | Alexion Europe SAS | 03/12/2008 | |
| Recombinant human tripeptidyl-peptidase 1 | EU/3/13/1118 | Treatment of neuronal ceroid lipofuscinosis type 2 | BioMarin Europe Ltd | 12/03/2013 | |
| Recombinant human vascular endothelial growth factor | EU/3/09/711 | Treatment of amyotrophic lateral sclerosis | NeuroNova AB | 29/01/2010 | |
| Recombinant human von Willebrand factor | EU/3/10/814 | Treatment of von Willebrand disease | Baxter Innovations GmbH | 26/11/2010 | |
| Recombinant humanised anti-human interleukin-1 beta monoclonal antibody | EU/3/10/796 | Treatment of Behçet's disease | Les Laboratoires Servier | 01/10/2010 | |
| Recombinant humanised monoclonal antibody to human Nogo-A protein of the IgG1/kappa class | EU/3/10/797 | Treatment of amyotrophic lateral sclerosis | Glaxo Group Limited | 01/10/2010 | |
| Recombinant inhibitor of human plasma kallikrein | EU/3/02/126 | treatment of angioedema | Dyax s.a. | 18/12/2002 | |
| Recombinant kallikrein inhibitor | EU/3/09/712 | Treatment of Netherton syndrome | Dermadis S.A.S. | 29/01/2010 | |
| Recombinant megakaryopoeisis-stimulating protein | EU/3/05/283 | Treatment of idiopathic thrombocytopenic purpura | Amgen Europe B.V. | 27/05/2005 | Nplate EU/1/08/497 04/02/2009 |
| Recombinant modified human growth hormone | EU/3/12/1087 | Treatment of growth hormone deficiency | Richardson Associates Regulatory Affairs Ltd | 24/01/2013 | |
| Recombinant modified vaccinia Ankara expressing human 5T4 | EU/3/06/429 | Treatment of renal cell carcinoma | Oxford Biomedica (UK) Ltd | 26/01/2007 | |
| Recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A | EU/3/05/318 | Prevention of tuberculosis disease in BCG vaccinated individuals | Emergent Product Development UK Limited | 28/10/2005 | |
| Recombinant porcine factor VIII (B domain deleted) | EU/3/10/784 | Treatment of haemophilia A | Inspiration Biopharmaceuticals EU Limited | 20/09/2010 | |
| Recombinant protein consisting of modified human growth hormone releasing hormone and the translocation and endopeptidase domains of botulinum toxin serotype D | EU/3/11/947 | Treatment of acromegaly | Syntaxin Limited | 11/01/2012 | |
| Recombinant P-selectin glycoprotein immunoglobulin | EU/3/06/376 | Prevention of post transplantation graft dysfunction | RJM Consultancy Ltd | 22/05/2006 | |
| Recombinant thymidine phosphorylase encapsulated in autologous erythrocytes | EU/3/11/856 | Treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) due to thymidine phosphorylase deficiency | St George's University of London | 15/04/2011 | |
| Reparixin | EU/3/11/912 | Prevention of graft rejection in pancreatic islet transplantation | Dompé S.p.A. | 27/09/2011 | |
| Repertaxin L-lysine salt | EU/3/01/058 | Prevention of delayed graft function in organ transplant | Dompé S.p.A. | 19/09/2001 | |
| Resminostat | EU/3/11/913 | Treatment of hepatocellular carcinoma | 4SC AG | 27/09/2011 | |
| Resminostat | EU/3/11/930 | Treatment of Hodgkin's lymphoma | 4SC AG | 09/12/2011 | |
| Retroviral gamma-c cDNA containing vector | EU/3/01/038 | Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease | GENOPOIETIC S.A.S. | 30/05/2001 | |
| Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide | EU/3/08/542 | Treatment of acute myeloid leukaemia | Dr. Ulrich Granzer | 08/05/2008 | |
| Rifapentine | EU/3/10/750 | Treatment of tuberculosis | Sanofi-Aventis groupe | 09/06/2010 | |
| Rilonacept | EU/3/07/456 | Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA) | Regeneron UK Limited | 10/07/2007 | Rilonacept Regeneron EU/1/09/582 23/10/2009 |
| RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´ [2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride | EU/3/08/586 | Treatment of Duchenne muscular dystrophy | AVI BioPharma International Ltd | 03/12/2008 | |
| RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a?5´) (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5´ [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3´ [2´a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-ß-alanyl-L-arginyl-6-aminohexanoyl-ß-alanyl], octahydrochloride | EU/3/09/725 | Treatment of Duchenne muscular dystrophy | AVI BioPharma International Ltd | 02/02/2010 | |
| R-salbutamol sulphate | EU/3/07/481 | Treatment of cutaneous forms of lupus erythematosus | Astion Pharma A/S | 14/09/2007 | |
| R,S-O-(3-piperidino-2-hydroxy-1-propyl)-nicotinic acid amidoxime dihydrochloride | EU/3/13/1122 | Treatment of Duchenne muscular dystrophy | N-GENE Kutatási és Fejlesztési Kft | 26/04/2013 | |
| Rubitecan | EU/3/03/145 | Treatment of pancreatic cancer | Eurogen Pharmaceuticals Limited | 10/06/2003 | |
| Rucaparib | EU/3/12/1049 | Treatment of ovarian cancer | Clovis Oncology UK Limited | 10/10/2012 | |
| Rufinamide | EU/3/04/240 | Treatment of Lennox-Gastaut syndrome | Eisai Limited | 20/10/2004 | Inovelon EU/1/06/378 16/01/2007 |
| S[+] apomorphine | EU/3/12/954 | Treatment of amyotrophic lateral sclerosis | University of Sheffield | 09/02/2012 | |
| (S)-10-[(dimethylamino)methyl]-4-ethyl-9-hydroxy-4-O-[alpha-(2´´, 4´´, 5´´, 7´´-tetranitro-9´´-fluorenylideneaminooxy)propionyl]-1H-pyrano[3´, 4´, 6´, 7´]indolizino[1,2-beta]-quinoline-3, 14-(4H), 12H)-dione, hydrochloride | EU/3/10/788 | Treatment of hepatocellular carcinoma | TLC Biopharmaceuticals B.V. | 01/10/2010 | |
| S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK | EU/3/09/634 | Treatment of pancreatic cancer | MBiotec GmbH | 15/05/2009 | |
| (S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine | EU/3/07/513 | Treatment of tuberculosis | Dr. Ulrich Granzer | 29/11/2007 | |
| (S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one | EU/3/13/1125 | Treatment of chronic lymphocytic leukaemia/small lymphocytic lymphoma | Voisin Consulting S.A.R.L. | 26/04/2013 | |
| (S)-3´-(OH)-desazadesferrithiocin-polyether, magnesium salt | EU/3/09/647 | Treatment of chronic iron overload requiring chelation therapy | Shire Pharmaceutical Development Limited | 24/07/2009 | |
| (S)-{8-fluoro-2-2[4-(3-methoxyphenyl)-1-piperazinyl]-3-[2-methoxy-5-(trifluoromethyl)-phenyl]-3,4-dihydro-4-quinazolinyl} acetic acid | EU/3/11/849 | Prevention of cytomegalovirus disease in patients with impaired cell-mediated immunity deemed at risk | Merck Sharp & Dohme Limited | 15/04/2011 | |
| Salirasib | EU/3/11/871 | Treatment of pancreatic cancer | Johnson & Johnson Medical Ltd | 21/06/2011 | |
| Sapacitabine | EU/3/08/558 | Treatment of acute myeloid leukaemia | Cyclacel Limited | 10/07/2008 | |
| Sapacitabine | EU/3/08/557 | Treatment of myelodysplastic syndromes | Cyclacel Limited | 08/07/2008 | |
| Sequence-modified recombinant human factor VIIa | EU/3/09/675 | Treatment of haemophilia A | Bayer Schering Pharma AG | 09/10/2009 | |
| Sequence-modified recombinant human factor VIIa | EU/3/09/676 | Treatment of haemophilia B | Bayer Schering Pharma AG | 08/10/2009 | |
| (S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate | EU/3/09/661 | Treatment of carcinoid tumours | Lexicon Celtic Limited | 08/10/2009 | |
| Sialic acid | EU/3/12/972 | Treatment of hereditary inclusion body myopathy | NDA Regulatory Science Ltd | 05/03/2012 | |
| Sildenafil citrate | EU/3/03/178 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Pfizer Limited | 12/12/2003 | Revatio EU/1/05/318 28/10/2005 |
| Sildenafil citrate | EU/3/10/815 | Treatment of postcardiotomy right ventricular failure | Pfizer Limited | 26/11/2010 | |
| Silibinin-C-2',3-dihydrogensuccinate, disodium salt | EU/3/10/828 | Prevention of recurrent hepatitis C in liver transplant recipients | Rottapharm S.p.A | 17/12/2010 | |
| Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid | EU/3/04/217 | Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age | Pharm Research Associates (UK) Limited | 29/07/2004 | |
| Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid | EU/3/04/216 | Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age | Pharm Research Associates (UK) Limited | 29/07/2004 | |
| Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid | EU/3/01/079 | Treatment of acute lung injury | Pharm Research Associates (UK) Limited | 04/02/2002 | |
| Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol, sodium salt and palmitic acid | EU/3/11/927 | Treatment of cystic fibrosis | Pharm Research Associates (UK) Limited | 27/10/2011 | |
| Sirolimus | EU/3/11/898 | Treatment of chronic non-infectious uveitis | Santen Oy | 30/08/2011 | |
| Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector | EU/3/09/630 | Treatment of dystrophic epidermolysis bullosa | Prof. Alain Hovnanian | 30/04/2009 | |
| Smilagenin | EU/3/11/914 | Treatment of amyotrophic lateral sclerosis | Phytopharm plc | 27/09/2011 | |
| S-nitrosoglutathione | EU/3/11/870 | Treatment of pre-eclampsia | Salupont Consulting Ltd | 13/05/2011 | |
| Sodium butyrate (rectal use) | EU/3/05/284 | Prevention of radiation proctitis | Promefarm srl | 27/05/2005 | |
| Sodium nitrite | EU/3/12/967 | Treatment of pulmonary arterial hypertension | FGK Representative Service GmbH | 05/03/2012 | |
| Sodium phenylbutyrate | EU/3/11/948 | Treatment of 5q spinal muscular atrophy | GMP-Orphan SAS | 11/01/2012 | |
| Sodium phenylbutyrate | EU/3/12/949 | Treatment of citrullinaemia type 1 | Lucane Pharma SA | 09/02/2012 | |
| Sodium phenylbutyrate | EU/3/12/951 | Treatment of carbamoyl-phosphate synthase-1 deficiency | Lucane Pharma SA | 09/02/2012 | |
| Sodium phenylbutyrate | EU/3/12/950 | Treatment of ornithine transcarbamylase deficiency | Lucane Pharma SA | 09/02/2012 | |
| Sodium thiosulfate | EU/3/10/848 | Treatment of calciphylaxis | Dr. Franz Köhler Chemie GmbH | 23/02/2011 | |
| Sodium thiosulfate | EU/3/12/979 | Treatment of calciphylaxis | Aptiv Solutions (UK) Limited | 02/04/2012 | |
| Soluble yeast beta-1,3/1,6-glucan | EU/3/05/294 | Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy | Biotec Pharmacon ASA | 16/06/2005 | |
| Somatropin | EU/3/00/001 | AIDS wasting | Merck Serono Europe Limited | 08/08/2000 | |
| Sorafenib tosylate | EU/3/06/364 | Treatment of hepatocellular carcinoma | Bayer Schering Pharma AG | 11/04/2006 | Nexavar EU/1/06/342 19/07/2006 |
| Sorafenib tosylate | EU/3/04/207 | Treatment of renal cell carcinoma | Bayer Schering Pharma AG | 29/07/2004 | Nexavar EU/1/06/342 19/07/2006 |
| Stiripentol | EU/3/01/071 | Treatment of severe myoclonic epilepsy in infancy | Biocodex | 05/12/2001 | Diacomit EU/1/06/367 04/01/2007 |
| Sulfonated monophosphorylated mannose oligosaccharide | EU/3/11/872 | Treatment of hepatocellular carcinoma | S-cubed Ltd | 21/06/2011 | |
| Synthetic double-stranded short interfering RNA oligonucleotide directed against proopiomelanocortin | EU/3/10/798 | Treatment of adrenocorticotropin-dependent Cushing´s syndrome | The University of Sheffield | 01/10/2010 | |
| Synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine (prior to administration of doxorubicin) | EU/3/12/1065 | Treatment of glioma | Avena Therapeutics Ltd | 08/11/2012 | |
| Synthetic double-stranded siRNA oligonucleotide directed against p53 mRNA | EU/3/10/751 | Prevention of delayed graft function after renal transplantation | ProductLife Limited | 09/06/2010 | |
| Synthetic double-stranded siRNA oligonucleotide directed against transthyretin mRNA | EU/3/11/857 | Treatment of familial amyloid polyneuropathy | Voisin Consulting S.A.R.L. | 15/04/2011 | |
| tafamidis | EU/3/12/1066 | Treatment of senile systemic amyloidosis | Pfizer Limited | 08/11/2012 | |
| Talactoferrinum alfa | EU/3/07/448 | Treatment of renal cell carcinoma | Agennix Limited | 05/06/2007 | |
| Talarozole | EU/3/12/1017 | Treatment of recessive X-linked ichthyosis | Stiefel Laboratories (U.K.) Limited | 05/07/2012 | |
| Talarozole | EU/3/12/1014 | Treatment of keratinopathic ichthyosis | Stiefel Laboratories (U.K.) Limited | 04/07/2012 | |
| Talarozole | EU/3/12/1005 | Treatment of autosomal recessive congenital ichthyosis | Stiefel Laboratories (U.K.) Limited | 04/07/2012 | |
| Taliglucerase alfa | EU/3/10/726 | Treatment of Gaucher Disease | Protalix B.V | 23/03/2010 | |
| Tamibarotene | EU/3/09/658 | Treatment of acute promyelocytic leukaemia | Eudax Srl | 24/07/2009 | |
| Tasimelteon | EU/3/10/841 | Treatment of non-24-hour sleep-wake disorders in blind people with no light perception | Vanda Pharmaceuticals Limited | 23/02/2011 | |
| Tazarotene | EU/3/06/423 | Treatment of congenital ichthyoses | Orfagen | 18/12/2006 | |
| Temocillin sodium | EU/3/03/183 | Treatment of Burkholderia cepacia lung infection in cystic fibrosis | Belpharma N.V. | 14/01/2004 | |
| Temsirolimus | EU/3/06/365 | Treatment of renal cell carcinoma | Pfizer Limited | 06/04/2006 | Torisel EU/1/07/424 19/11/2007 |
| Temsirolimus | EU/3/06/420 | Treatment of mantle cell lymphoma | Pfizer Limited | 06/11/2006 | Torisel EU/1/07/424 19/11/2007 |
| Terguride | EU/3/12/1096 | Treatment of systemic sclerosis | Serodapharm GmbH | 24/01/2013 | |
| Terguride | EU/3/07/499 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Ergonex Licensing and Regulatory Services AG | 29/11/2007 | |
| Terguride | EU/3/13/1104 | Treatment of systemic sclerosis | High Tech Participations GmbH | 08/02/2013 | |
| Tesetaxel | EU/3/10/829 | Treatment of gastric cancer | Genta Development Limited | 17/12/2010 | |
| Tetrahydrobiopterin | EU/3/04/199 | Treatment of hyperphenylalaninemia | Merck Serono Europe Limited | 08/06/2004 | Kuvan EU/1/08/481 02/12/2008 |
| TGF-beta2 specific phosphorothioate antisense oligodeoxynucleotide | EU/3/02/091 | Treatment of high-grade glioma | Antisense Pharma GmbH | 22/03/2002 | |
| Thalidomide | EU/3/01/067 | Treatment of multiple myeloma | Celgene Europe Limited | 20/11/2001 | Thalidomide Celgene EU/1/08/443 16/04/2008 |
| Thiotepa | EU/3/06/424 | Conditioning treatment prior to haematopoietic progenitor cell transplantation | ADIENNE S.r.l. | 29/01/2007 | Tepadina EU/1/10/622 15/03/2010 |
| Thymalfasin | EU/3/02/110 | Treatment of hepatocellular carcinoma | SciClone Pharmaceuticals Italy S.r.l | 30/07/2002 | |
| Tipifarnib | EU/3/05/269 | Treatment of acute myeloid leukaemia | Janssen-Cilag International NV | 10/03/2005 | |
| Titanium dioxide and bisoctrizole | EU/3/05/262 | Treatment of UV-A and visible light-induced photosensitivity disorders (chronic actinic dermatitis, cutaneous porphyrias, actinic prurigo and solar urticaria) | Orfagen | 03/03/2005 | |
| Tobramycin (inhalation powder) | EU/3/03/140 | Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | Chiron Corporation Ltd | 17/03/2003 | TOBI Podhaler EU/1/10/652 20/07/2011 |
| Tobramycin (inhalation use) | EU/3/09/613 | Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | PARI Pharma GmbH | 27/02/2009 | |
| Topotecan hydrochloride (liposomal) | EU/3/08/562 | Treatment of glioma | Dr. Matthias Luz | 05/09/2008 | |
| Tosedostat | EU/3/09/659 | Treatment of acute myeloid leukaemia | Chroma Therapeutics Ltd | 24/07/2009 | |
| Tositumomab | EU/3/03/137 | Treatment of follicular lymphoma | GlaxoSmithKline Research & Development Limited | 14/02/2003 | |
| Trabectedin | EU/3/03/171 | Treatment of ovarian cancer | Pharma Mar S.A. Sociedad Unipersonal | 17/10/2003 | Yondelis EU/1/07/417 17/09/2007 |
| Trabedersen | EU/3/09/660 | Treatment of pancreatic cancer | Antisense Pharma GmbH | 24/07/2009 | |
| Tralokinumab | EU/3/12/1061 | Treatment of idiopathic pulmonary fibrosis | MedImmune Ltd | 08/11/2012 | |
| Tranilast | EU/3/10/756 | Prevention of scarring post glaucoma filtration surgery | Altacor Ltd | 27/07/2010 | |
| Trans-4-[4-[5-[[6-(trifluoromethyl)-3-pyridinyl]amino]-2-pyridinyl]phenyl] cyclohexane acetic acid sodium salt | EU/3/12/1036 | Treatment of familial chylomicronaemia syndrome (type I hyperlipoproteinaemia) | Novartis Europharm Limited | 14/09/2012 | |
| Treosulfan | EU/3/04/186 | Conditioning treatment prior to haematopoietic progenitor cell transplantation | medac Gesellschaft für klinische Spezialpräparate mbH | 23/02/2004 | |
| Treprostinil diethanolamine | EU/3/09/635 | Treatment of systemic sclerosis | United Therapeutics Europe Ltd | 15/05/2009 | |
| Treprostinil diethanolamine (oral use) | EU/3/05/310 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | United Therapeutics Europe Ltd | 26/08/2005 | |
| Treprostinil sodium | EU/3/13/1103 | Treatment of chronic thromboembolic pulmonary hypertension | SciPharm S.a.r.L | 08/02/2013 | |
| Treprostinil sodium (inhalation use) | EU/3/04/197 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | United Therapeutics Europe Ltd | 14/04/2004 | |
| Tretazicar | EU/3/08/529 | Treatment of visceral leishmaniasis | Morvus Technology Limited | 04/02/2008 | |
| Trientine dihydrochloride | EU/3/03/172 | Treatment of Wilson´s disease | Univar Limited | 24/10/2003 | |
| Triheptanoin | EU/3/12/1081 | Treatment of very-long-chain-acyl-CoA dehydrogenase deficiency | B. Braun Melsungen AG | 06/12/2012 | |
| Triheptanoin | EU/3/12/1082 | Treatment of long-chain L-3-hydroxyacyl-CoA-dehydrogenase deficiency | B. Braun Melsungen AG | 06/12/2012 | |
| Type I native bovine skin collagen | EU/3/08/607 | Treatment of systemic sclerosis | arGentis Autoimmune Europe Limited | 09/02/2009 | |
| Vaccinia GM-CSF/TK-deactivated virus | EU/3/09/700 | Treatment of hepatocellular carcinoma | Transgene S.A. | 26/11/2009 | |
| Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar | EU/3/04/201 | Prevention of stenosis in synthetic grafts used in haemodialysis | Ark Therapeutics Ltd | 08/06/2004 | |
| Vasoactive Intestinal Peptide | EU/3/03/173 | Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | mondoBIOTECH Laboratories AG | 22/12/2003 | |
| Vatreptacog alfa (activated) | EU/3/12/1032 | Treatment of haemophilia B | Novo Nordisk A/S | 09/08/2012 | |
| Vatreptacog alfa (activated) | EU/3/12/1030 | Treatment of haemophilia A | Novo Nordisk A/S | 09/08/2012 | |
| Velaglucerase alfa | EU/3/10/752 | Treatment of Gaucher disease | Shire Pharmaceuticals Ireland Limited | 09/06/2010 | VPRIV EU/1/10/646 26/08/2010 |
| Veliparib | EU/3/10/830 | Treatment of ovarian cancer | AbbVie Ltd | 17/12/2010 | |
| Veltuzumab | EU/3/09/713 | Treatment of chronic lymphocytic leukaemia | Immunomedics GmbH | 29/01/2010 | |
| vildagliptin | EU/3/08/575 | Treatment of isovaleric acidaemia | Orphan Europe S.A.R.L. | 07/11/2008 | Carbaglu EU/1/02/246 24/01/2003 |
| Vincaleukoblastin-23-oic acid, O4-deacetyl-2-[(2-mercaptoethoxy)carbonyl]hydrazide, disulfide with N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-L-gamma-glutamyl-L-alpha-aspartyl-L-arginyl-L-alpha-aspartyl-L-alpha-aspartyl-L-cysteine | EU/3/12/959 | Treatment of ovarian cancer | Endocyte Europe B.V. | 09/02/2012 | |
| Vincristine sulphate liposomes | EU/3/08/555 | Treatment of acute lymphoblastic leukaemia | NDA Regulatory Science Ltd | 08/07/2008 | |
| Viral vector containing DNA encoding the human SMN protein | EU/3/11/876 | Treatment of 5q spinal muscular atrophy | University of Sheffield | 21/06/2011 | |
| Voclosporin | EU/3/12/1085 | Treatment of non-infectious uveitis | Granzer Regulatory Consulting & Services | 06/12/2012 | |
| Vosaroxin | EU/3/12/990 | Treatment of acute myeloid leukaemia | Sunesis Europe Ltd | 26/04/2012 | |
| Yttrium (90Y) antiferritin polyclonal antibodies | EU/3/03/162 | Treatment of Hodgkin lymphoma | Mablife | 02/10/2003 | |
| Yttrium (90Y) edotreotide | EU/3/08/589 | Treatment of gastro-entero-pancreatic neuroendocrine tumours | Molecular Insight Limited | 04/12/2008 | |
| Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 | EU/3/08/608 | Treatment of pancreatic cancer | Immunomedics GmbH | 06/02/2009 | |
| Yttrium (90Y)-DTPA-radiolabelled chimeric monoclonal antibody against frizzled homologue 10 | EU/3/12/994 | Treatment of soft tissue sarcoma | Laboratoires OncoTherapy Science France, S.A.R.L | 25/05/2012 | |
| Zanolimumab | EU/3/07/438 | Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Genmab A/S | 20/03/2007 | |
| Ziconotide (intraspinal use) | EU/3/01/048 | Treatment of chronic pain requiring intraspinal analgesia | Eisai Limited | 09/07/2001 | Prialt EU/1/04/302 21/02/2005 |
| Zinc acetate dihydrate | EU/3/01/050 | Treatment of Wilson´s disease | Orphan Europe S.A.R.L. | 31/07/2001 | Wilzin EU/1/04/286 13/10/2004 |
| Zosuquidar trihydrochloride | EU/3/06/355 | Treatment of acute myeloid leukaemia | Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP | 17/02/2006 |