Navigation path

Pharmaceuticals - Community Register

  

Register of designated Orphan Medicinal Products (alphabetical)

Product EU Designation Designated Orphan Indication Sponsor Designation date Tradename
EU Centralised Nr
Implemented on
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/767 Treatment of post-essential thrombocythaemia myelofibrosis CTI Life Sciences Ltd 25/08/2010
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/768 Treatment of primary myelofibrosis CTI Life Sciences Ltd 25/08/2010
11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)] heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene EU/3/10/769 Treatment of post-polycythaemia vera myelofibrosis CTI Life Sciences Ltd 25/08/2010
11-(4-Dimethylamino-3-hydroxy-6-methyl-tetrahydro-pyran-2-yloxy)-2-ethyl-3,4,10-trihydroxy-3,5,6,8,10,12,14-heptamethyl-1-oxa-6-aza-cyclopentadecane-13,15-dione EU/3/14/1239 Treatment of cystic fibrosis Synovo GmbH 19/02/2014
1-(2,2-difluoro-1,3-benzodioxol-5-yl)-N-{1-[(2R)-2,3-dihydroxypropyl]-6-fluoro-2-(1-hydroxy-2-methylpropan-2-yl)-1H-indol-5-yl}cyclopropanecarboxamide EU/3/14/1281 Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 04/07/2014
1-(2,2-difluoro-2H-1,3-benzodioxol-5-yl)-N-{1-[(2R)-2,3-dihydroxypropyl]-6-fluoro-2-(1-hydroxy-2-methylpropan-2-yl)-1H-indol-5-yl}cyclopropane-1-carboxamide and ivacaftor EU/3/17/1828 Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 27/02/2017
1,2:5,6-Dianhydrogalactitol EU/3/12/1093 Treatment of glioma IDIS Ltd 24/01/2013
1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine EU/3/05/332 Treatment of acute myeloid leukaemia Vion (UK) Limited, ℅ i3 Research 14/12/2005
1-[(2-Chloro-4-methoxyphenoxy)methyl]-4-[(2,6-dichlorophenoxy)methyl]benzene EU/3/12/1021 Prevention of poliomyelitis in patients with immunodeficiencies deemed at risk ViroDefense Ltd 17/07/2012
1-(2-isopropoxyethyl)-2-thioxo-1,2,3,5-tetrahydro-pyrrolo[3,2-d]pyrimidin-4-one EU/3/14/1404 Treatment of multiple system atrophy AstraZeneca AB 16/12/2014
1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride EU/3/07/459 Treatment of narcolepsy Bioprojet Pharma 10/07/2007 Wakix
EU/1/15/1068
04/04/2016
1,3-Propanedisulfonic acid, disodium salt EU/3/01/051 Treatment of Systemic Secondary Amyloidosis C.T. Phinco S.à.r.l. 31/07/2001
1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4 d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one EU/3/12/984 Treatment of chronic lymphocytic leukaemia Janssen-Cilag International NV 26/04/2012 IMBRUVICA
EU/1/14/945
23/10/2014
1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl]-1-piperidinyl]-2-propen-1-one EU/3/13/1115 Treatment of mantle cell lymphoma Janssen-Cilag International NV 12/03/2013 IMBRUVICA
EU/1/14/945
23/10/2014
1-(4-(N-glycylamido)phenyl)-3-trifluoromethyl-5-(phenanthren-2-yl)-pyrazole-hydrochloride EU/3/15/1475 Treatment of cryptococcosis Arno Therapeutics UK, Limited 24/04/2015
1-(4-(N-glycylamido)phenyl)-3-trifluoromethyl-5-(phenanthren-2-yl)-pyrazole-hydrochloride EU/3/15/1476 Treatment of tularaemia Arno Therapeutics UK, Limited 24/04/2015
16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide EU/3/10/789 Treatment of medulloblastoma Biogenera SpA 01/10/2010
16-base single-stranded peptide nucleic acid oligonucleotide linked to 7-amino acid peptide EU/3/12/1016 Treatment of neuroblastoma Biogenera SpA 04/07/2012
16-base single-stranded peptide nucleic acid oligonucleotide linked to a 7 aminoacid peptide EU/3/16/1690 Treatment of soft tissue sarcoma Biogenera SpA 14/07/2016
16-base single-stranded PNA oligonucleotide linked to a 7-aminoacid peptide EU/3/09/692 Treatment of neuroblastoma Biogenera SpA 25/11/2009
1-(6-benzothiazolylsulfonyl)-5-chloro-1H-indole-2-butanoic acid EU/3/14/1361 Treatment of systemic sclerosis Inventiva 19/11/2014
1-(6-benzothiazolylsulfonyl)-5-chloro-1H-indole-2-butanoic acid EU/3/14/1362 Treatment of idiopathic pulmonary fibrosis Inventiva 19/11/2014
177Lu-tetraxetan-tetulomab EU/3/14/1271 Treatment of follicular lymphoma Nordic Nanovector AS 04/06/2014
(-)-17-(cyclopropylmethyl)-3,14 -dihydroxy-4,5 a-epoxy-6-[N-methyl-trans-3-(3-furyl) acrylamido] morphinan hydrochloride EU/3/02/115 Treatment of uremic pruritus Toray International Europe GmbH 11/09/2002
17a,21-dihydroxy-16a-methyl-pregna-1,4,9(11)-triene-3,20-dione EU/3/14/1309 Treatment of Duchenne muscular dystrophy ReveraGen BioPharma Limited 22/08/2014
1-Cyclopropyl-3-[3-(5-morpholin-4-ylmethyl-1H-benzoimidazol-2-yl)-1H-pyrazol-4-yl]-urea EU/3/09/693 Treatment of acute myeloid leukaemia Astex Therapeutics Limited 26/11/2009
1-deoxygalactonojirimycin hydrochloride EU/3/06/368 Treatment of Fabry disease Amicus Therapeutics UK Ltd 22/05/2006 Galafold
EU/1/15/1082
31/05/2016
(1E,6E)-1,7-bis(3,4-dimethoxyphenyl)-4-cyclobutylmethyl-1,6-heptadiene-3,5-dione EU/3/16/1639 Treatment of X-linked spinal and bulbar muscular atrophy (Kennedy's disease) Coté Orphan Consulting UK Limited 28/04/2016
(1R, 2R)-Octanoic acid [2-(2,3-dihydro-benzo [1,4] dioxin-6-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt EU/3/07/514 Treatment of Gaucher Disease Genzyme Europe B.V. 04/12/2007 Cerdelga
EU/1/14/974
21/01/2015
(1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol EU/3/05/314 Treatment of tuberculosis Janssen-Cilag International NV 26/08/2005 Sirturo
EU/1/13/901
07/03/2014
(1R,3R,4R,5S)-3-O-[2-O-benzoyl-3-O-(sodium(2S)-3-cyclohexyl-propanoate-2-yl)--D-galactopyranosyl]-4-O-(a-L-fucopyranosyl)-5-orothylamido-cyclohexane-1-carboxylic acid ethyl-2-amidyl-ethyloxy-2-acetyl-(8-amino-1,3,6-naphthalene-tris sodium sulfonate) amide EU/3/13/1184 Treatment of sickle cell disease Pfizer Limited 05/08/2013
(1S,3S)-3-amino-4-(difluoromethylene) cyclopentanecarboxylic acid hydrochloride EU/3/12/953 Treatment of West syndrome Catalent Pharma Solutions Limited 09/02/2012
(1S,4R,5R,7S)-3,4-dibenzyl-2-oxo-6,8-dioxa-3-azabyciclo[3.2.1]octane-7-carboxylic acid-L-lysine EU/3/14/1400 Treatment of neurotrophic keratitis MIMETECH S.r.l. 16/12/2014
20-pentaerythritol poly (oxy-1,2-ethanediyl)-carboxymethyl-glycinate-7-ethyl-10-hydroxycamptothecine 10-[1,4'-bipiperidine]-1'-carboxylate EU/3/11/900 Treatment of ovarian cancer Nektar Therapeutics UK Ltd 27/09/2011
2-(1,5-dimethyl-3-phenyl-1H-pyrrol-2-yl)-N-{4-[4-(5-fluoro-pyrimidin-2-yl)piperazin-1-yl]-phenyl}-2-oxo-acetamide EU/3/16/1713 Treatment of scedosporiosis F2G Ltd 29/08/2016
2-(1,5-dimethyl-3-phenyl-1H-pyrrol-2-yl)-N-{4-[4-(5-fluoro-pyrimidin-2-yl)piperazin-1-yl]-phenyl}-2-oxo-acetamide EU/3/16/1738 Treatment of invasive aspergillosis F2G Ltd 14/10/2016
2,2'-{2-[(1R)-1-({[(2,5-dichlorobenzoyl)amino]acetyl}amino)-3-methylbutyl]-5-oxo-1,3,2-dioxaborolane-4,4-diyl}diacetic acid EU/3/11/899 Treatment of multiple myeloma Takeda Pharma A/S 27/09/2011 Ninlaro
EU/1/16/1094
23/11/2016
225Ac-lintuzumab EU/3/17/1871 Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 22/05/2017
2-(2-chlorobenzylidene)hydrazinecarboximidamide acetate EU/3/15/1598 Treatment of Charcot-Marie-Tooth disease Inflectis Bioscience 14/12/2015
2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione EU/3/10/802 Treatment of idiopathic pulmonary fibrosis GenKyoTex Innovation S.A.S 26/11/2010
2-(2-chlorophenyl)-4-[3-(dimethylamino)phenyl]-5-methyl-1H-pyrazolo[4,3-C]pyridine-3,6(2H,5H)-dione EU/3/15/1559 Treatment of systemic sclerosis GenKyoTex Innovation S.A.S 09/10/2015
2,2-dimethylbutyric acid, sodium salt EU/3/09/617 Treatment of beta-thalassaemia intermedia and major Isabelle Ramirez 27/02/2009
2,2-dimethylbutyric acid, sodium salt EU/3/09/621 Treatment of sickle cell disease Isabelle Ramirez 18/03/2009
2-((2-ethyl-6-(4-(2-(3-hydroxyazetidin-1-yl)-2-oxoethyl)-piperazin-1-yl)-8-methylimidazo[1,2-alpha]pyridin-3-yl)-(methyl)amino)-4-(4-fluorophenyl)-thiazole-5-carbonitrile EU/3/16/1712 Treatment of idiopathic pulmonary fibrosis Galapagos NV 29/08/2016
2-(2-methyl-5-nitro-1H-imidazol-1-yl)ethylsulfamide EU/3/14/1324 Treatment of small cell lung cancer DualTpharma B.V. 22/08/2014
2-(2-phenylvinyl)-4-[4-methylpiperazin-1-yl)]-6-(5-methyl-2H-pyrazol-3-yl-amino)-pyrimidine L(+) tartrate salt EU/3/15/1544 Treatment of hepatocellular carcinoma Dr Ulrich Granzer 10/08/2015
2-((3-((4-((3-aminopropyl)amino)butyl)amino)propyl)amino)-N-((5S,5aS,8aR,9R)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5,5a,6,8,8a,9-hexahydrofuro[3',4':6,7]naphtho[2,3-d][1,3]dioxol-5-yl)acetamide, tetrahydrochloride EU/3/15/1517 Treatment of acute myeloid leukaemia Pierre Fabre Médicament 28/07/2015
2',3',5'-tri-O-acetyluridine EU/3/09/637 Treatment of 5-fluorouracil overdose Wellstat Therapeutics EU Limited 15/05/2009
2-[4-(1-methyl-4-pyridin-4-yl-1H-pyrazol-3-yl)-phenoxymethyl]-quinoline succinic acid EU/3/16/1691 Treatment of Huntington's disease Pfizer Limited 14/07/2016
2-[4-Methoxy-3-(2-m-tolyl-ethoxy)-benzoylamino]-indan-2-carboxylic acid EU/3/13/1108 Treatment of systemic sclerosis Sanofi-Aventis groupe 12/03/2013
26 base synthetic single-stranded fully phosphorothioated 2'-O-methyl-RNA and DNA mixmer oligonucleotide-based compound EU/3/17/1829 Treatment of Dravet syndrome Eirgen Pharma Limited 27/02/2017
2-(7-ethoxy-4-(3-fluorophenyl)-1-oxophthalazin-2(1H)-yl)-N-methyl-N-(2-methylbenzo[d]oxazol-6-yl)acetamide EU/3/15/1498 Treatment of cystic fibrosis Clinical Network Services (UK) Ltd 21/05/2015
2-Allyl-1-[6-(1-hydroxy-1-methylethyl)pyridin-2-yl]-6-{[4-(4-methylpiperazin-1-yl)phenyl]amino}-1,2-dihydro-3H-pyrazolo[3,4-d]pyrimidin-3-one EU/3/12/989 Treatment of ovarian cancer AstraZeneca UK Limited 26/04/2012
2-amino-2-[2-[2-chloro-4-[[3-(phenylmethoxy)phenyl]thio]phenyl]ethyl]-1,3-propanediol hydrochloride EU/3/15/1583 Prevention of graft-versus-host disease Novartis Europharm Limited 14/12/2015
2-chloro-N6-(3-iodobenzyl)adenosine-5'-N-methyluronamide EU/3/15/1565 Treatment of hepatocellular carcinoma PBS Regulatory Consulting Group Limited 09/10/2015
[2-Cyano-3-cyclopropyl-3-hydroxy-N-(3-methyl-4-trifluoromethylphenyl)prop-2-enamide] EU/3/12/1050 Treatment of traumatic spinal cord injury Algiax Pharmaceuticals GmbH 10/10/2012
2-ethylbutyl (2S)-2-{[(S)-{[(2R,3S,4R,5R)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-5-cyano-3,4-dihydroxytetrahydrofuran-2-yl]methoxy}(phenoxy)phosphoryl]amino}propanoate EU/3/16/1615 Treatment of Ebola virus disease Gilead Sciences International Ltd 17/02/2016
2-hydroxy-6-((2-(1-isopropyl-1H-pyrazol-5-yl)pyridin-3-yl)methoxy)benzaldehyde EU/3/16/1769 Treatment of sickle cell disease SynteractHCR Deutschland GmbH 18/11/2016
2-hydroxymethyl-2-methoxymethyl-1-azabicyclo[2,2,2]octan-3-one EU/3/14/1386 Treatment of ovarian cancer Aprea Therapeutics AB 16/12/2014
2-hydroxyoleic acid EU/3/11/916 Treatment of glioma Lipopharma Therapeutics SL 27/10/2011
2-hydroxypropyl--cyclodextrin EU/3/13/1124 Treatment of Niemann-Pick disease, type C Vtesse Europe Limited 26/04/2013
2-iminobiotin EU/3/09/701 Treatment of perinatal asphyxia Neurophyxia B.V. 28/01/2010
2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol EU/3/04/195 Treatment of anaplastic thyroid cancer Diamond BioPharm Limited 14/04/2004
2-methoxymethyl-2-hydroxymethyl-1-azabicyclo[2,2,2]octan-3-one EU/3/10/742 Treatment of acute myeloid leukaemia Aprea Therapeutics AB 10/06/2010
2-methyl-1-[(4-[6-(trifluoromethyl)pyridin-2-yl]-6-{[2-(trifluoromethyl)pyridin-4-yl]amino}-1,3,5-triazin-2-yl)amino]propan-2-ol methanesulfonate EU/3/16/1640 Treatment of acute myeloid leukaemia Celgene Europe Limited 28/04/2016
2-[N-(2-hydroxyethyl)]-N-(4-methoxybenzenesulfonyl)]amino-N-(4-chlorocinnamyl)-N-methylbenzylamine EU/3/17/1915 Treatment of Charcot-Marie-Tooth disease Repositioning SAS 16/10/2017
2'-O-(2-methoxyethyl)phosphorothioate antisense oligonucleotide targeting the growth hormone receptor EU/3/16/1671 Treatment of acromegaly Coté Orphan Consulting UK Limited 27/06/2016
2'-O-methyl phosphorothioate RNA oligonucleotide, 5'-m5CUGm5CUGm5CUGm5CUGm5CUGm5CUGm5CUG-3' EU/3/15/1432 Treatment of Huntington's disease BioMarin International Limited 18/02/2015
(-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate EU/3/08/560 Treatment of moderate and severe closed traumatic brain injury KeyNeurotek Pharmaceuticals AG 05/09/2008
(2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl) amino)methyl)tetrahydrofuran-3,4-diol EU/3/13/1230 Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 16/01/2014
(2R,3R,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-((((1r,3S)-3-(2-(5-(tert-butyl)-1H-benzo[d]imidazol-2-yl)ethyl)cyclobutyl)(isopropyl) amino)methyl)tetrahydrofuran-3,4-diol EU/3/13/1231 Treatment of acute lymphoblastic leukaemia Voisin Consulting S.A.R.L. 16/01/2014
(2R,3S)-2-(4-cyclopentylaminophenyl)-1-(2-fluoro-6-methylbenzoyl)piperidine-3-carboxylic acid(4-methyl-3-trifluoromethylphenyl)amide EU/3/14/1372 Treatment of microscopic polyangiitis ChemoCentryx Limited 19/11/2014
(2R,3S)-2-(4-cyclopentylaminophenyl)-1-(2-fluoro-6-methylbenzoyl)piperidine-3-carboxylic acid(4-methyl-3-trifluoromethylphenyl)amide EU/3/14/1373 Treatment of granulomatosis with polyangiitis ChemoCentryx Limited 19/11/2014
2S, 4R ketoconazole EU/3/12/1012 Treatment of Cushing’s syndrome Cortendo AB 04/07/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1028 Treatment of progressive familial intrahepatic cholestasis Albireo AB 17/07/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1040 Treatment of Alagille syndrome Albireo AB 09/08/2012
(2S)-2-{[(2R)-2-[({[3,3-dibutyl-7-(methylthio)-1,1-dioxido-5-phenyl-2,3,4,5-tetrahydro- 1,2,5-benzothiadiazepin-8-yl]oxy}acetyl)amino]-2-(4-hydroxyphenyl)acetyl]amino}butanoic acid EU/3/12/1041 Treatment of primary biliary cirrhosis Albireo AB 09/08/2012
(2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide EU/3/05/315 Treatment of progressive myoclonic epilepsies UCB Pharma S.A. 26/08/2005
3-{[2,3,5,6-tetrafluoro-3'-(trifluoromethoxy)biphenyl-4-yl]carbamoyl}thiophene-2-carboxylic acid EU/3/15/1507 Treatment of non-infectious uveitis Panoptes Pharma Ges.m.b.H 19/06/2015
3-[4-(1H-imidazol-1-ylmethyl)phenyl]-5-(2-methylpropyl)thiophene-2-[(N-butyloxylcarbamate)-sulphonamide] sodium salt EU/3/16/1692 Treatment of idiopathic pulmonary fibrosis Vicore Pharma AB 14/07/2016
3-(4'aminoisoindoline-1'-one)-1-piperidine-2,6-dione EU/3/04/192 Treatment of myelodysplastic syndromes Celgene Europe Limited 08/03/2004 Revlimid
EU/1/07/391
17/06/2013
3,4-diaminopyridine phosphate EU/3/02/124 Treatment of Lambert-Eaton myasthenic syndrome BioMarin Europe Ltd. 18/12/2002 Firdapse
EU/1/09/601
28/12/2009
(3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid EU/3/05/278 Treatment of Duchenne muscular dystrophy PTC Therapeutics International Limited 27/05/2005 Translarna
EU/1/13/902
05/08/2014
3-(5-amino-2-methyl-4-oxoquinazolin-3(4H)-yl)piperidine-2,6-dione hydrochloride EU/3/16/1672 Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 27/06/2016
3,5-diiodothyropropionic acid EU/3/13/1193 Treatment of Allan-Herndon-Dudley syndrome CATS Consultants GmbH 07/10/2013
3-Chloro-4-fluorophenyl-[4-fluoro-4-{[(5-methylpyrimidin-2-ylmethyl) amino]methyl}piperidin-1-yl]methanone EU/3/14/1242 Treatment of Rett syndrome Neurolixis UK Ltd. 19/02/2014
3-methoxy-pregnenolone EU/3/07/511 Treatment of spinal cord injury MAPREG SAS 04/12/2007
3-pentylbenzeneacetic acid sodium salt EU/3/15/1550 Treatment of idiopathic pulmonary fibrosis ProMetic Pharma SMT Limited 09/10/2015
3-pentylbenzeneacetic acid sodium salt EU/3/16/1810 Treatment of Alström syndrome ProMetic Pharma SMT Limited 12/01/2017
(3'R,4'S,5'R)-N-[(3R,6S)-6-carbamoyltetrahydro-2H-pyran-3-yl]-6''-chloro-4'-(2-chloro-3-fluoropyridin-4-yl)-4,4-dimethyl-2''-oxo-1'',2''-dihydrodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indole]-5'-carboxamide mono(4-methylbenzenesulfonate) monohydrate EU/3/17/1847 Treatment of soft tissue sarcoma Daiichi Sankyo Europe GmbH 20/03/2017
(3S)-(+)-(5-chloro-2-methoxyphenyl)-1,3-dihydro-3-fluoro-6-(trifluoromethyl)-2H-indol-2-one EU/3/14/1334 Treatment of fragile X syndrome Centre National de la Recherche Scientifique (CNRS) 15/10/2014
(3S)-1-azabicyclo[2.2.2]oct-3-yl{2-[2-(4-fluorophenyl)-1,3-thiazol-4-yl]propan-2-yl}carbamate EU/3/14/1310 Treatment of Fabry disease Genzyme Europe B.V. 22/08/2014
(3S)-1-azabicyclo[2.2.2]oct-3-yl{2-[2-(4-fluorophenyl)-1,3-thiazol-4-yl]propan-2-yl}carbamate EU/3/14/1374 Treatment of Gaucher disease Genzyme Europe B.V. 19/11/2014
(3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt EU/3/10/760 Treatment of ovarian cancer TESARO UK LIMITED 04/08/2010
(3S)-3-{4-[7-(aminocarbonyl)-2H-indazol-2-yl] phenyl} piperidine tosylate monohydrate salt EU/3/10/787 Treatment of mantle cell lymphoma TESARO U.K. Limited 01/10/2010
4-[123I]iodo-L-phenylalanine EU/3/06/386 Diagnosis of glioma Therapeia GmbH & Co. KG 25/07/2006
4-[131I]iodo-L-phenylalanine EU/3/06/363 Treatment of glioma Therapeia GmbH & Co. KG 11/04/2006
4-[[(1S,4S)-5-[[4-[4-(oxazol-2-yl)phenoxy]phenyl]methyl]-2,5-diazabicyclo[2.2.1]hept-2-yl]methyl]benzoic acid EU/3/14/1363 Treatment of cystic fibrosis Coté Orphan Consulting UK Limited 19/11/2014
4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate EU/3/13/1109 Treatment of hepatocellular carcinoma Eli Lilly Nederland B.V. 13/03/2013
4-[2-(6-methylpyridin-2-yl)-5,6-dihydro-4H-pyrrolo[1,2-b]pyrazol-3-yl]-quinoline-6-carboxamide monohydrate EU/3/13/1120 Treatment of glioma Eli Lilly Nederland B.V. 26/04/2013
4-[(2-butyl-4-oxo-1,3-diazaspiro[4.4]non-1-en-3-yl)methyl]-N-(4,5-dimethyl-3-isoxazolyl)-2-(ethoxymethyl)-[1,1-biphenyl]-2-sulfonamide EU/3/15/1574 Treatment of focal segmental glomerulosclerosis Retrophin Europe Limited 11/11/2015
4-{[(2R,3S,4R,5S)-4-(4-chloro-2-fluoro-phenyl)-3-(3-chloro-2-fluoro-phenyl)-4-cyano-5-(2,2-dimethyl-propyl)-pyrrolidine-2-carbonyl]-amino}-3-methoxy-benzoic acid EU/3/14/1328 Treatment of acute myeloid leukaemia Roche Registration Limited 22/08/2014
4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HCl EU/3/05/288 Treatment of Huntington's disease Teva GmbH 20/06/2005
4-(4-{[2-(4-chlorophenyl)-4,4-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-({3-nitro-4-[(tetrahydro-2H-pyran-4-ylmethyl)amino]phenyl}sulfonyl)-2-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)benzamide EU/3/12/1080 Treatment of chronic lymphocytic leukaemia AbbVie Ltd 06/12/2012 Venclyxto
EU/1/16/1138
07/12/2016
4-(4-Methoxy-phenylamino)-6-methylcarbamyl-quinoline-3-carboxylic acid EU/3/14/1279 Prevention of scarring post glaucoma filtration surgery Clanotech AB 04/06/2014
4,6,4trimethylangelicin EU/3/13/1137 Treatment of cystic fibrosis Rare Partners srl Impresa Sociale 19/06/2013
4,7,10,13,16,19-docosahexaenoic acid EU/3/06/412 Treatment of retinitis pigmentosa Natac Pharma S.L. 03/11/2006
4-[[9-[(3S)-tetrahydro-3-furanyl]-8-[(2,4,6-trifluorophenyl)amino]-9H-purin-2-yl]amino]-trans-cyclohexanol EU/3/11/934 Treatment of idiopathic pulmonary fibrosis Celgene Europe Limited 09/12/2011
4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]--D-arabinofuranosyl]-2(1H)-pyrimidinone EU/3/07/477 Treatment of hepatocellular carcinoma Interface International Consultancy Limited 14/09/2007
4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline EU/3/06/356 Treatment of renal cell carcinoma Prodimed S.A. 16/02/2006
4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride EU/3/06/390 Treatment of moderate and severe traumatic brain injury vasopharm GmbH 28/08/2006
[4-aminobutanoic acid-glycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-L-aspartyl](cyclo 1-Dgamma17) EU/3/15/1592 Treatment of pseudohypoaldosteronism type 1B Apeptico Forschung und Entwicklung GmbH 14/12/2015
4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol EU/3/07/487 Treatment of chronic lymphocytic leukaemia BlackSwan Pharma GmbH 14/11/2007
4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one EU/3/05/299 Treatment of pancreatic cancer ICON Clinical Research (U.K.) Limited 27/07/2005
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1214 Treatment of Alagille syndrome Shire Pharmaceutical Ireland limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1215 Treatment of primary biliary cirrhosis Shire Pharmaceutical Ireland limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1216 Treatment of progressive familial intrahepatic cholestasis Shire Pharmaceutical Ireland limited 18/12/2013
(4R,5R)-1-[[4-[[4-[3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl]phenoxy]methyl]phenyl]methyl]-4-aza-1-azoniabicyclo[2.2.2]octane chloride EU/3/13/1217 Treatment of primary sclerosing cholangitis Shire Pharmaceutical Ireland limited 18/12/2013
505 amino acid protein, corresponding to amino acids 2-506 of the wild type human histidyl-tRNA synthetase EU/3/15/1448 Treatment of facioscapulohumeral muscular dystrophy Voisin Consulting S.A.R.L. 12/02/2015
505 amino acid protein, corresponding to amino acids 2-506 of the wild-type human histidyl-tRNA synthetase EU/3/17/1831 Treatment of limb-girdle muscular dystrophy Voisin Consulting S.A.R.L. 27/02/2017
5,10,15,20-tetrakis(2,6-difluoro-3-N-methylsulfamoylphenyl)bacteriochlorin EU/3/15/1470 Treatment of biliary tract cancer Luzitin S.A 19/03/2015
[5,10,15,20-tetrakis(4-carboxyphenyl)-21H,23H-porphine]manganese(III) chloride EU/3/16/1809 Treatment of Cockayne syndrome Institut Pasteur 12/01/2017
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride EU/3/11/892 Treatment of 5q spinal muscular atrophy Repligen Europe Limited 30/08/2011
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride EU/3/13/1136 Treatment of 5q spinal muscular atrophy Sirius Regulatory Consulting Limited 07/06/2013
5-[4-[2-(5-(1-hydroxyethyl)-2-pyridinyl)ethoxy]benzyl]-2,4-thiazolidinedione hydrochloride EU/3/16/1770 Treatment of adrenoleukodystrophy Minoryx Therapeutics S.L. 18/11/2016
5-(4,6-dimorpholino-1,3,5-triazin-2-yl)-4-(trifluoromethyl)pyridin-2-amine EU/3/17/1830 Treatment of diffuse large B-cell lymphoma Voisin Consulting S.A.R.L. 27/02/2017
5,5'-(4-(trifluromethyl)benzylazanediyl)bis(methylene)diquinolin-8-ol EU/3/14/1408 Treatment of glioma Prof. Olivier Blin 16/12/2014
[5-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-pyridin-2-yl]-(6-trifluoromethyl-pyridin-3-ylmethyl)-amine hydrochloride EU/3/15/1457 Treatment of tenosynovial giant cell tumour, localised and diffuse type Daiichi Sankyo Europe GmbH 19/03/2015
5,6,7,8-Tetrahydrobiopterin EU/3/03/163 Treatment of hyperphenylalaninemia Orphanetics Pharma Entwicklungs GmbH 02/10/2003
5,7-dichloro-2-dimethylaminomethyl-8-hydroxyquinoline hydrochloride EU/3/15/1497 Treatment of Huntington’s disease Prana Biotechnology UK Limited 21/05/2015
5'-ASCSASTSCSASGSTSCSTSGSASUSASASGSCSTSA-3' EU/3/15/1451 Treatment of Alport syndrome CTI Clinical Trial and Consulting Services Europe GmbH 19/03/2015
5-amino-1-(2-methyl-1H-benzo[d]imidazol-5-yl)-1H-pyrazol-4-yl 1H-indol-2-yl ketone mono[(S)-2-hydroxysuccinate] EU/3/17/1916 Treatment of biliary tract cancer Voisin Consulting S.A.R.L. 16/10/2017
[5-amino-1-(4-fluoro-phenyl)-1H-pyrazol-4-yl]-[3-(2,3-dihydroxy-propoxy)-phenyl]-methanone EU/3/14/1323 Treatment of pancreatic cancer Synovo GmbH 22/08/2014
5-aminolevulinic acid EU/3/16/1811 Treatment of glioma Centre Hospitalier Universitaire de Lille 12/01/2017
5-bromo-N-(prop-2-yn-1-yl)-2-(1H-1,2,4-triazol-1-yl)pyrimidine-4,6-diamine EU/3/14/1392 Treatment of Huntington’s disease Palobiofarma S.L. 16/12/2014
5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole EU/3/08/591 Treatment of Duchenne muscular dystrophy Summit (Oxford) Limited 04/12/2008
5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt EU/3/03/182 Treatment of aneurysmal subarachnoid haemorrhage Idorsia Pharmaceuticals Deutschland GmbH 12/12/2003
5'-O-(trans-9'-octadecenoyl)-1--D-arabinofuranosyl cytosine EU/3/07/476 Treatment of acute myleoid leukaemia Aqualis ASA 14/09/2007
(5R,5aR,8aR,9S)-9-[[4,6-O-[(R)-Ethylidene]--D-glucopyranosyl]-oxy]-5-(4-({[(2,2-dimethyl-1,3-dioxolan-4-yl)methoxy]carbonyl}oxy)-3,5-dimethoxyphenyl)-5,8,8a,9-tetrahydroisobenzofuro[5,6-f][1,3]benzodioxol-6(5aH)-one EU/3/14/1270 Treatment of biliary tract cancer Mundipharma Corporation Limited 04/06/2014
(5S,8S,10aR)-N-benzhydryl-5-((S)-2-(methylamino)propanamido)-3-(3-methylbutanoyl)-6-oxodecahydropyrrolo[1,2-a][1,5]diazocine-8-carboxamide EU/3/15/1576 Treatment of ovarian cancer ASPHALION, SL 11/11/2015
68Ga-2,2'-(7-(4-((S)-1-((4S,7S,10S,13R,16S,19R)-4-((R)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-ylcarbamoyl)-10-(4-aminobutyl)-16-(4-((S)-2,6-dioxohexahydropyrimidine-4-carboxamido)benzyl)-7-((R)-1-hydroxyethyl)-6,9,12,15,18-pentaoxo-13-(4-ureidobenzyl)-1,2-dithia-5,8,11,14,17-pentaazacycloicosan-19-ylamino)-3-(4-chlorophenyl)-1-oxopropan-2-ylamino)-1-carboxy-4-oxobutyl)-1,4,7-triazonane-1,4-diyl)diacetic acid EU/3/14/1246 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Ipsen Pharma 19/02/2014
68Ga-DOTA-pABzA-DIG-dPhe-Gln-Trp-Ala-Val-Gly-His-NHCH[(CH2-CH(CH3)2]2 EU/3/16/1794 Diagnosis of gastrointestinal stromal tumours Advanced Accelerator Applications 12/12/2016
6alpha-ethyl-chenodeoxycholic acid EU/3/10/753 Treatment of primary biliary cirrhosis Intercept Pharma Ltd 27/07/2010 OCALIVA
EU/1/16/1139
15/12/2016
(6aR, 10aR)-3-(1',1'-dimethylheptyl)-delta-8-tetrahydro-cannabinol-9-carboxylic acid EU/3/16/1808 Treatment of systemic sclerosis TMC Pharma Services Ltd 12/01/2017
(6aR,10aR)-3-(1',1'-dimethylheptyl)-delta-8-tetrahydrocannabinol-9-carboxylic acid EU/3/16/1736 Treatment of cystic fibrosis TMC Pharma Services Ltd 14/10/2016
(6aS)-1,10-dimethoxy-6-methyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinoline-2,9-diol EU/3/13/1226 Treatment of dystrophic myotonia Valentia BioPharma S.L 16/01/2014
6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide EU/3/09/681 Treatment of Huntington's disease Siena Biotech SpA 28/10/2009
6-ethoxy-7-methoxy-2-(2-methylsulfanylphenyl)-3,1-benzoxazin-4-one EU/3/15/1454 Treatment of Netherton syndrome Sixera Pharma AB 19/03/2015
6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2(3H)-one EU/3/12/970 Treatment of amyotrophic lateral sclerosis Pharma Gateway AB 05/03/2012
(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride monohydrate EU/3/09/616 Treatment of amyotrophic lateral sclerosis Knopp Neurosciences Sub Ltd 27/02/2009
6'-(R)-methyl-5-O-(5-amino-5,6-dideoxy-a-L-talofuranosyl)-paromamine sulfate EU/3/16/1714 Treatment of mucopolysaccharidosis type I Coté Orphan Consulting UK Limited 29/08/2016
6-thioguanine (oral liquid) EU/3/09/694 Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 26/11/2009
7-beta-hydroxycholesteryl-3-beta-oleate EU/3/10/816 Treatment of glioma Intsel Chimos SA 17/12/2010
8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-1,2,4-triazolo[3,4-f][1,6]naphthyridin-3(2H)-one mono-hydrochloride EU/3/09/695 Treatment of ovarian cancer Merck Sharp & Dohme Limited 30/11/2009
9-cis-Retinyl acetate EU/3/11/861 Treatment of Leber's congenital amaurosis QLT Ophthalmics (UK), Ltd 13/05/2011
9-cis-Retinyl acetate EU/3/11/865 Treatment of retinitis pigmentosa QLT Ophthalmics (UK), Ltd 13/05/2011
A combination of H-Lys-Lys-Gly-Pro-Arg-Cys(SH)-Leu-Thr-Arg-Tyr-Tyr-Ser-Ser-Phe-Val-Asn-Met-Glu-Gly-Lys-Lys-OH and H-Lys-Lys-Gly-Asp-Asn-Ile-Met-Val-Thr-Phe-Arg-Asn-Gln-Ala-Ser-Arg-Pro-Tyr-Gly-Lys-Lys-OH EU/3/14/1360 Treatment of haemophilia A Apitope International NV 19/11/2014
A highly purified formulation of Staphylococcus aureus protein A EU/3/15/1562 Treatment of immune thrombocytopenia Coté Orphan Consulting UK Limited 09/10/2015
A lentiviral vector pseudotyped by the Indiana serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins EU/3/14/1417 Treatment of adult T-cell leukaemia/lymphoma THERAVECTYS 15/01/2015
A lentiviral vector pseudotyped by the New-Jersey serotype of the vesicular stomatitis virus G protein encoding an antigen derived from the Tax, HBZ, p12I and p30II HTLV-1 proteins EU/3/14/1418 Treatment of adult T-cell leukaemia/lymphoma THERAVECTYS 15/01/2015
A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein EU/3/05/317 Treatment of graft-versus-host disease Xenikos B.V. 26/08/2005
A non-covalent trimer of tumour necrosis factor fused to an antibody specific to the extra-domain B of fibronectin in single-chain variable fragment format EU/3/16/1739 Treatment of soft tissue sarcoma Philogen S.p.A. 14/10/2016
AASSGVSTPGSAGHDIITEQPRS EU/3/15/1492 Treatment of Huntington’s disease Centre National de la Recherche Scientifique (CNRS) 21/05/2015
Acadesine EU/3/05/280 Treatment of B-cell chronic lymphocytic leukemia (B-CLL) Advancell - Advanced In Vitro Cell Technologies S.A. 27/05/2005
Acadesine EU/3/11/881 Treatment of multiple myeloma Advancell - Advanced In Vitro Cell Technologies S.A. 05/08/2011
Acalabrutinib EU/3/16/1624 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Acerta Pharma, BV 21/03/2016
Acalabrutinib EU/3/16/1625 Treatment of mantle cell lymphoma Acerta Pharma, BV 21/03/2016
Acalabrutinib EU/3/16/1626 Treatment of lymphoplasmacytic lymphoma Acerta Pharma, BV 21/03/2016
Acamprosate calcium EU/3/14/1337 Treatment of fragile X syndrome Real Regulatory Limited 15/10/2014
Acebutolol hydrochloride EU/3/16/1742 Treatment of Smith-Magenis syndrome Therapicon Srl 14/10/2016
Acetylleucine EU/3/17/1848 Treatment of Niemann-Pick disease IntraBio Ltd 20/03/2017
Acetylsalicylic acid EU/3/04/208 Treatment of polycythemia vera Bayer HealthCare AG 29/07/2004
Adeno-associated viral vector containing a modified U7-snRNA gene EU/3/05/297 Treatment of Duchenne muscular dystrophy Généthon 27/07/2005
Adeno-associated viral vector containing DNA encoding an RNAi targeting rhodopsin / adeno-associated viral vector containing a rhodopsin gene EU/3/10/817 Treatment of rhodopsin-linked retinitis pigmentosa Spark Therapeutics Ireland Ltd 17/12/2010
Adeno-associated viral vector containing modified U1 snRNA EU/3/09/663 Treatment of Duchenne muscular dystrophy uniQure Biopharma B.V. 08/10/2009
Adeno-associated viral vector containing porphobilinogen deaminase gene EU/3/09/632 Treatment of acute intermittent porphyria uniQure Biopharma B.V. 29/04/2009
Adeno-associated viral vector containing the human alpha-N-acetylglucosaminidase gene EU/3/11/917 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Institut Pasteur 27/10/2011
Adeno-associated viral vector containing the human ARSB gene EU/3/11/864 Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Fondazione Telethon 13/05/2011
Adeno-associated viral vector containing the human factor IX gene EU/3/11/938 Treatment of haemophilia B uniQure Biopharma B.V. 11/01/2012
Adeno-associated viral vector containing the human NADH dehydrogenase 4 gene EU/3/11/860 Treatment of Leber's hereditary optic neuropathy GenSight- Biologics 13/05/2011
Adeno-associated viral vector expressing lipoprotein lipase EU/3/04/194 Treatment of lipoprotein lipase deficiency uniQure Biopharma B.V. 08/03/2004 Glybera
EU/1/12/791
29/10/2012
Adeno-associated viral vector of serotype 5 containing the human alanine-glyoxylate aminotransferase gene EU/3/12/974 Treatment of primary hyperoxaluria type 1 uniQure Biopharma B.V. 21/03/2012
Adeno-associated viral vector serotype 2/2 containing a gene encoding the channelrhodopsin-2 protein EU/3/16/1740 Treatment of retinitis pigmentosa Allergan Pharmaceuticals International Limited 14/10/2016
Adeno-associated viral vector serotype 2 containing the human CHM gene encoding human Rab escort protein 1 EU/3/14/1278 Treatment of choroideremia Alan Boyd Consultants Ltd 04/06/2014
Adeno-associated viral vector serotype 2 containing the human REP1 gene EU/3/14/1290 Treatment of choroideremia NightstaRx Ltd. 04/07/2014
Adeno-associated viral vector serotype 2.7m8 containing the ChrimsonR-tdTomato gene EU/3/16/1693 Treatment of retinitis pigmentosa GenSight- Biologics 14/07/2016
Adeno-associated viral vector serotype 5 containing a B-domain deleted variant of human coagulation factor VIII gene EU/3/16/1622 Treatment of haemophilia A BioMarin Europe Ltd 21/03/2016
Adeno-associated viral vector serotype 5 containing the human CHM gene EU/3/15/1482 Treatment of choroideremia Inserm-Transfert SA 24/04/2015
Adeno-associated viral vector serotype 5 containing the human RLBP1 gene EU/3/16/1741 Treatment of retinitis pigmentosa HORAMA SA 14/10/2016
Adeno-associated viral vector serotype 8 containing the human alpha-galactosidase A gene EU/3/17/1849 Treatment of Fabry disease Freeline Therapeutics Ltd 20/03/2017
Adeno-associated viral vector serotype 8 containing the human CNGA3 gene under the control of a cone arrestin promoter EU/3/16/1795 Treatment of achromatopsia caused by mutations in the CNGA3 gene Universitätsklinikum Tübingen (UKT) 12/12/2016
Adeno-associated viral vector serotype 8 containing the human factor VII gene EU/3/14/1430 Treatment of congenital factor VII deficiency Professor Edward G. Tuddenham 15/01/2015
Adeno-associated viral vector serotype 8 containing the human glucose-6-phosphatase gene EU/3/16/1771 Treatment of glycogen storage disease type Ia Pharma Gateway AB 18/11/2016
Adeno-associated viral vector serotype 8 containing the human GUCY2D gene EU/3/14/1256 Treatment of Leber's congenital amaurosis Fondazione Telethon 26/03/2014
Adeno-associated viral vector serotype 8 containing the human MD1 gene EU/3/14/1381 Treatment of Duchenne muscular dystrophy Généthon 19/11/2014
Adeno-associated viral vector serotype 8 containing the human MTM1 gene EU/3/15/1539 Treatment of X-linked myotubular myopathy Audentes Therapeutics UK Limited 10/08/2015
Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene EU/3/14/1321 Treatment of Crigler-Najjar syndrome Fondazione Telethon 22/08/2014
Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene EU/3/14/1338 Treatment of Crigler-Najjar syndrome Généthon 15/10/2014
Adeno-associated viral vector serotype 8 containing the human UGT1A1 gene EU/3/16/1772 Treatment of Crigler-Najjar syndrome Audentes Therapeutics UK Limited 18/11/2016
Adeno-associated viral vector serotype 8 encoding engineered rhodopsin DNA-binding repressor and human rhodopsin expression cassettes EU/3/16/1796 Treatment of retinitis pigmentosa Fondazione Telethon 12/12/2016
Adeno-associated viral vector serotype 8 encoding human ornithine transcarbamylase EU/3/16/1623 Treatment of ornithine transcarbamylase deficiency Pharma Gateway AB 21/03/2016
Adeno-associated viral vector serotype 8 encoding the human ATP7B gene under the control of the human alpha-1 antitrypsin promoter EU/3/15/1573 Treatment of Wilson's disease Aligen Therapeutics S.L. 11/11/2015
Adeno-associated viral vector serotype 9 containing the human cardiac calsequestrin gene EU/3/14/1296 Treatment of catecholaminergic polymorphic ventricular tachycardia Audentes Therapeutics UK Limited 29/07/2014
Adeno-associated viral vector serotype 9 containing the human glucocerebrosidase gene EU/3/15/1468 Treatment of Gaucher disease Gauchers Association 19/03/2015
Adeno-associated viral vector serotype 9 containing the human HGSNAT gene EU/3/15/1491 Treatment of mucopolysaccharidosis IIIC (Sanfilippo C syndrome) Cochamo Systems Ltd 21/05/2015
Adeno-associated viral vector serotype 9 containing the human iduronate-2-sulfatase gene EU/3/15/1540 Treatment of mucopolysaccharidosis type II (Hunter's syndrome) Laboratorios del Dr Esteve, S.A. 10/08/2015
Adeno-associated viral vector serotype 9 containing the human mini-dystrophin gene EU/3/16/1716 Treatment of Duchenne muscular dystrophy Pfizer Limited 29/08/2016
Adeno-associated viral vector serotype 9 containing the human N-acetylglucosaminidase alpha gene EU/3/12/1095 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Laboratorios del Dr Esteve, S.A. 24/01/2013
Adeno-associated viral vector serotype 9 containing the human SMN gene EU/3/15/1509 Treatment of spinal muscular atrophy AveXis EU, Ltd 19/06/2015
Adeno-associated viral vector serotype 9 containing the human sulfamidase gene EU/3/11/877 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Laboratorios del Dr Esteve, S.A. 21/06/2011
Adeno-associated viral vector serotype Anc80 containing the truncated human ATP7B gene under the control of the human alpha-1 antitrypsin promoter EU/3/17/1898 Treatment of Wilson's disease Vivet Therapeutics SAS 23/08/2017
Adeno-associated viral vector serotype LK03 encoding human ornithine transcarbamylase EU/3/17/1850 Treatment of ornithine transcarbamylase deficiency Dr Julien Baruteau 20/03/2017
Adeno-associated viral vector serotype rh.10 carrying the human N-sulfoglucosamine sulfohydrolase cDNA EU/3/14/1389 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) LYSOGENE 16/12/2014
Adeno-associated viral vector serotype rh10 containing the human factor IX gene EU/3/15/1599 Treatment of haemophilia B Pharma Gateway AB 14/12/2015
Adeno-associated viral vector serotype rh.10 expressing beta-galactosidase EU/3/17/1851 Treatment of GM1 gangliosidosis LYSOGENE 20/03/2017
Adenoviral vector containing human p53 gene EU/3/06/404 Treatment of Li Fraumeni Syndrome Gendux Molecular Limited 23/10/2006
Adenoviral vector of serotype 5 modified to contain a chimeric sequence consisting of a minimal urokinase-type plasminogen activator receptor promoter preceded by three Notch-responsive elements, and coated with oligopeptide end-modified poly (beta-amino) esters EU/3/17/1917 Treatment of pancreatic cancer Sagetis Biotech, S.L. 16/10/2017
Adenoviral vector serotype 5 containing the vascular endothelial growth factor D isoform (preprocessed short form) from a CMV promoter EU/3/14/1415 Treatment of placental insufficiency Magnus Invention Management Ltd 15/01/2015
Adenovirus associated viral vector serotype 2 containing the human RPE65 gene EU/3/12/981 Treatment of Leber’s congenital amaurosis Spark Therapeutics Ireland Ltd 02/04/2012
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/484 Treatment of Leber's congenital amaurosis HORAMA SA 22/10/2007
Adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/486 Treatment of retinitis pigmentosa HORAMA SA 14/11/2007
Adenovirus associated viral vector serotype 5 containing the human pde6 gene EU/3/13/1142 Treatment of retinitis pigmentosa HORAMA SA 19/06/2013
Adenovirus associated viral vector serotype 5 containing the human RPE65 gene EU/3/15/1577 Treatment of Leber’s congenital amaurosis MeiraGTx UK II Limited 11/11/2015
Adenovirus associated viral vector serotype 5 containing the human RPGR gene EU/3/16/1715 Treatment of retinitis pigmentosa MeiraGTx UK II Limited 29/08/2016
Adenovirus associated viral vector serotype 8 containing the human CNGB3 gene EU/3/15/1578 Treatment of achromatopsia caused by mutations in the CNGB3 MeiraGTx UK II Limited 11/11/2015
Adenovirus serotype 5 containing partial E1A deletion and an integrin-binding domain EU/3/14/1396 Treatment of glioma Alan Boyd Consultants Ltd 16/12/2014
Adenovirus-associated vector containing human Fas-c gene EU/3/12/1002 Treatment of glioma Envigo Pharma Consulting Ltd 06/06/2012
Adenovirus-associated viral vector serotype 10 carrying the human N-sulfoglucosamine sulfohydrolase and sulfatase modifying factor 1 cDNAs EU/3/10/772 Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) LYSOGENE 20/09/2010
Adenovirus-associated viral vector serotype 2 containing the human RPE65 gene EU/3/15/1518 Treatment of retinitis pigmentosa Spark Therapeutics Ireland Ltd 28/07/2015
Adenovirus-mediated Herpes simplex Virus-thymidine kinase gene EU/3/01/083 Treatment of high-grade glioma with subsequent use of ganciclovir sodium Gliotherapy Limited 06/02/2002
Adenovirus-specific T-cells derived from allogeneic donor leukocytes, expanded ex vivo EU/3/13/1227 Treatment of adenovirus infection in allogeneic haematopoietic stem-cell transplant recipients Cell Medica Ltd 16/01/2014
Adrenomedullin EU/3/10/744 Treatment of acute lung injury mondoBIOTECH Laboratories AG 09/06/2010
Adult human bone-marrow-derived, ex-vivo-expanded, pooled allogeneic mesenchymal stromal cells EU/3/15/1499 Treatment of thromboangiitis obliterans (Buerger's disease) Regulatory Resources Group Ltd 21/05/2015
Afamelanotide EU/3/09/648 Treatment of solar urticaria Clinuvel UK Limited 24/07/2009
Afamelanotide EU/3/14/1285 Treatment of familial benign chronic pemphigus (Hailey-Hailey disease) Clinuvel UK Limited 04/07/2014
Aganirsen EU/3/14/1275 Treatment of central retinal vein occlusion Gene Signal SAS 10/06/2014
Alginate oligosaccharide (G-block) fragment EU/3/07/475 Treatment of cystic fibrosis AlgiPharma AS 14/09/2007
Alicaforsen EU/3/09/641 Treatment of pouchitis Atlantic Healthcare plc 15/05/2009
Allantoin EU/3/13/1232 Treatment of epidermolysis bullosa Amicus Therapeutics UK Ltd 16/01/2014
Allogeneic adipose-derived adult mesenchymal stem cells contained in a fibrin-based bioengineered dermis EU/3/14/1407 Treatment of epidermolysis bullosa Biodan Yelah S.L. 16/12/2014
Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma EU/3/13/1211 Treatment of glioma ERC Belgium 18/12/2013
Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media EU/3/13/1129 Treatment of graft-versus-host disease Cell2B Advanced Therapeutics, SA 07/06/2013
Allogeneic bone marrow derived mesenchymal cells expanded ex vivo in synthetic media EU/3/14/1388 Prevention of graft-versus-host disease Cell2B Advanced Therapeutics, SA 16/12/2014
Allogeneic bone-marrow derived ex-vivo expanded multipotent adult progenitor cells EU/3/13/1233 Prevention of graft-versus-host disease ReGenesys BVBA 16/01/2014
Allogeneic CD34+ cells expanded ex vivo with an aryl hydrocarbon receptor antagonist EU/3/14/1382 Treatment of acute lymphoblastic leukaemia Novartis Europharm Limited 16/12/2014
Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus EU/3/15/1438 Treatment of adenovirus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 19/03/2015
Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus EU/3/15/1439 Treatment of cytomegalovirus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 12/02/2015
Allogeneic CD4+ and CD8+ T lymphocytes ex vivo incubated with synthetic peptides of the viral antigens of cytomegalovirus, adenovirus and Epstein-Barr virus EU/3/15/1440 Treatment of Epstein-Barr virus infection following haematopoietic stem cell transplantation Miltenyi Biotec GmbH 19/03/2015
Allogeneic cytomegalovirus-specific cytotoxic T lymphocytes EU/3/16/1773 Treatment of cytomegalovirus infection in patients with impaired cell-mediated immunity Atara Biotherapeutics Ireland Limited 18/11/2016
Allogeneic donor-derived ex-vivo expanded T lymphocytes transduced with a retroviral vector containing inducible caspase 9 and truncated CD19 EU/3/16/1674 Treatment in haematopoietic stem cell transplantation Bellicum Pharma Limited 27/06/2016
Allogeneic Epstein-Barr virus specific cytotoxic T lymphocytes EU/3/16/1627 Treatment of post-transplant lymphoproliferative disorder Atara Biotherapeutics Ireland Limited 21/03/2016
Allogeneic ex vivo-generated natural killer cells from CD34+ umbilical cord blood progenitor cells EU/3/14/1395 Treatment of acute myeloid leukaemia IPD - Therapeutics BV 16/12/2014
Allogeneic ex-vivo-expanded human umbilical cord blood-derived mesenchymal stem cells EU/3/15/1503 Prevention of bronchopulmonary dysplasia PSR Group B.V. 19/06/2015
Allogeneic ex-vivo-expanded umbilical cord blood-derived hematopoietic CD34+ progenitor cells and allogeneic non-expanded umbilical cord blood-derived hematopoietic mature myeloid and lymphoid cells EU/3/17/1852 Treatment in haematopoietic stem cell transplantation Regulatory Resources Group Ltd 20/03/2017
Allogeneic fetal human retinal progenitor cells expanded ex vivo EU/3/16/1620 Treatment of retinitis pigmentosa Voisin Consulting S.A.R.L. 17/02/2016
Allogeneic human adult stem cells, isolated from skeletal muscle and expanded ex vivo EU/3/15/1519 Treatment of Duchenne muscular dystrophy Karl Rouger 28/07/2015
Allogeneic human dendritic cells derived from a CD34+ progenitor cell line EU/3/12/969 Treatment of acute myeloid leukaemia DCPrime BV 22/05/2012
Allogeneic human dermal fibroblasts EU/3/10/774 Treatment of epidermolysis bullosa Intercytex Ltd 20/09/2010
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells EU/3/12/1088 Treatment of 5q spinal muscular atrophy California Stem Cell (UK) Ltd 24/01/2013
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells EU/3/13/1155 Treatment of amyotrophic lateral sclerosis California Stem Cell (UK) Ltd 17/07/2013
Allogeneic peripheral blood mononuclear cells incubated ex vivo with 16, 16-dimethyl prostaglandin E2 and dexamethasone EU/3/16/1774 Treatment in haematopoietic stem cell transplantation Fate Therapeutics Ltd 18/11/2016
Allogeneic peripheral blood mononuclear cells induced to an early apoptotic state EU/3/14/1426 Prevention of graft-versus-host disease Richardson Associates Regulatory Affairs Ltd 15/01/2015
Allogeneic T cells encoding an exogenous TK gene EU/3/10/773 Treatment of acute myeloid leukaemia LTKFarma 20/09/2010
Allogeneic T cells encoding an exogenous TK gene EU/3/11/878 Treatment of acute lymphoblastic leukaemia LTKFarma 21/06/2011
Allogeneic, umbilical cord blood-derived, ex vivo-expanded, haematopoietic CD133+ cells / allogeneic, umbilical cord blood-derived, non-expanded, haematopoietic CD133- cells EU/3/14/1413 Treatment of acute myeloid leukaemia Regulatory Resources Group Ltd 15/01/2015
Allopurinol sodium EU/3/12/1076 Treatment of perinatal asphyxia Pharmathen S.A. 06/12/2012
Allopurinol sodium EU/3/15/1493 Treatment of perinatal asphyxia ACE Pharmaceuticals BV 21/05/2015
Alpha-1 antitrypsin (inhalation use) EU/3/04/243 Treatment of cystic fibrosis Triskel EU Services Ltd 16/11/2004
Alpha-1 antitrypsin (inhalation use) EU/3/04/244 Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Kamada BioPharma Limited 16/11/2004
Alpha-1 proteinase inhibitor EU/3/06/350 Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Octapharma (IP) Limited 16/02/2006
Alpha-1 proteinase inhibitor (for inhalation use) EU/3/12/1045 Treatment of cystic fibrosis Grifols Deutschland GmbH 10/10/2012
Alpha-1 proteinase inhibitor (inhalation use) EU/3/07/474 Treatment of cystic fibrosis CSL Behring GmbH 14/09/2007
Alpha-1 proteinase inhibitor (inhalation use) EU/3/08/546 Treatment of congenital alpha-1 antitrypsin deficiency Grifols Deutschland GmbH 03/06/2008
Alpha-tocopherol EU/3/16/1775 Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
Alpha-tocopherol and ascorbic acid EU/3/17/1832 Treatment of fragile X syndrome Advanced Medical Projects 27/02/2017
Alpha-tocotrienol quinone EU/3/11/937 Treatment of Leigh syndrome Edison Orphan Pharma BV 09/12/2011
Alvocidib EU/3/07/485 Treatment of chronic lymphocytic leukaemia Theorem Clinical Research GmbH 23/10/2007
Alvocidib EU/3/15/1437 Treatment of acute myeloid leukaemia Theorem Clinical Research GmbH 12/02/2015
Amatuximab EU/3/13/1222 Treatment of malignant mesothelioma Eisai Europe Limited 16/01/2014
Ambrisentan EU/3/05/273 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Glaxo Group Ltd 11/04/2005 Volibris
EU/1/08/451
24/04/2008
Amikacin sulfate EU/3/14/1259 Treatment of nontuberculous mycobacterial lung disease Insmed Limited 08/04/2014
Amikacin sulfate EU/3/14/1397 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis PlumeStars s.r.l. 16/12/2014
Amikacin sulfate (liposomal) EU/3/06/387 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Insmed Limited 25/07/2006
Ammonium tetrathiomolybdate EU/3/08/539 Treatment of Wilson's disease JJGConsultancy Ltd 01/04/2008
Amphotericin B (for inhalation use) EU/3/06/391 Prevention of pulmonary fungal infection in patients deemed at risk Novartis Europharm Limited 28/08/2006
Anti epidermal growth factor receptor antibody h-R3 EU/3/04/220 Treatment of glioma Oncoscience AG 02/09/2004
Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody EU/3/04/193 Treatment of ovarian cancer Neovii Biotech GmbH 08/03/2004
Anti-H5N1 equine immunoglobulin F(ab')2 fragments EU/3/15/1512 Treatment of avian influenza Fab'entech 28/07/2015
Antisense NF-K p65 Oligonucleotide EU/3/02/106 Treatment of active ulcerative colitis InDex Pharmaceuticals AB 30/07/2002
Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' EU/3/06/416 Treatment of acute myeloid leukaemia EleosInc Limited 03/11/2006
Antisense oligonucleotide complementary to the exonic splicer enhancer sequence at intron 26 of the centrosomal protein 290 pre-mRNA EU/3/16/1641 Treatment of Leber’s congenital amaurosis ProQR Therapeutics IV BV 28/04/2016
Antisense oligonucleotide directed against TGF-beta2 mRNA EU/3/15/1506 Prevention of scarring post glaucoma filtration surgery Isarna Therapeutics GmbH 19/06/2015
Antisense oligonucleotide targeted to the SMN2 gene EU/3/12/976 Treatment of 5q spinal muscular atrophy Biogen Idec Limited 02/04/2012 Spinraza
EU/1/17/1188
01/06/2017
Antisense oligonucleotide targeting exon 13 in the USH2A gene EU/3/17/1899 Treatment of retinitis pigmentosa ProQR Therapeutics IV BV 23/08/2017
Antisense oligonucleotide targeting the F508delta mutation of CFTR EU/3/13/1195 Treatment of cystic fibrosis ProQR Therapeutics III BV 07/10/2013
Antisense oligonucleotide targeting the USH2A gene EU/3/17/1853 Treatment of retinitis pigmentosa ProQR Therapeutics IV BV 20/03/2017
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/160 Treatment of retinopathy of prematurity Gene Signal SAS 02/10/2003
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/161 Treatment of neovascular glaucoma Gene Signal SAS 02/10/2003
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/07/445 Prevention of corneal graft rejection Gene Signal SAS 17/04/2007
Antroquinonol EU/3/16/1812 Treatment of pancreatic cancer Biological Consulting Europe Ltd 12/01/2017
Aplidine EU/3/04/245 Treatment of multiple myeloma Pharma Mar S.A. 16/11/2004
Apomorphine hydrochloride EU/3/11/862 Treatment of moderate and severe traumatic brain injury Dr Elkan Raphael Gamzu 13/05/2011
Apomorphine hydrochloride (inhalation use) EU/3/06/349 Treatment of off-periods in Parkinson’s disease not responding to oral treatment Vectura Group plc 16/02/2006
Arimoclomol EU/3/06/406 Treatment of amyotrophic lateral sclerosis Orphazyme ApS 26/10/2006
Arimoclomol citrate EU/3/14/1376 Treatment of Niemann-Pick disease, type C Orphazyme ApS 19/11/2014
Arimoclomol citrate EU/3/16/1659 Treatment of inclusion body myositis Orphazyme ApS 30/05/2016
Arsenic trioxide EU/3/16/1610 Treatment of acute myeloid leukaemia Orsenix Holdings BV 17/02/2016
Arsenic trioxide EU/3/16/1797 Treatment of graft-versus-host disease Medsenic 12/12/2016
artesunate EU/3/07/430 Treatment of malaria ACE Pharmaceuticals BV 20/02/2007
artesunate EU/3/07/510 Treatment of malaria Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 06/12/2007
Artesunate EU/3/12/1079 Treatment of malaria Dafra Pharma International NV 06/12/2012
Artesunate EU/3/15/1521 Treatment of malaria Dr Ulrich Granzer 28/07/2015
ascorbic acid EU/3/08/531 Treatment of Charcot-Marie-Tooth disease type 1A Murigenetics SAS 01/04/2008
Ascorbic acid EU/3/16/1776 Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
Asp-Arg-Val-Tyr-Ile-His-Pro EU/3/14/1241 Treatment of Duchenne muscular dystrophy Envigo Pharma Consulting Ltd 19/02/2014
Asp-Arg-Val-Tyr-Ile-His-Pro EU/3/17/1879 Treatment of epidermolysis bullosa Envigo Pharma Consulting Ltd 20/06/2017
Asunercept EU/3/17/1900 Treatment of myelodysplastic syndromes Apogenix AG 23/08/2017
Ataluren EU/3/12/1010 Treatment of Becker muscular dystrophy PTC Therapeutics International Limited 04/07/2012
Ataluren EU/3/14/1380 Treatment of mucopolysaccharidosis type I PTC Therapeutics International Limited 19/11/2014
Ataluren EU/3/15/1561 Treatment of aniridia PTC Therapeutics International Limited 09/10/2015
Autologous adipose tissue-derived mesenchymal stem cells EU/3/17/1854 Treatment of thromboangiitis obliterans (Buerger's disease) SPC GmbH 20/03/2017
Autologous adipose tissue-derived stromal vascular fraction cells EU/3/15/1464 Treatment of systemic sclerosis Assistance Publique Hôpitaux de Marseille 19/03/2015
Autologous adult bone marrow-derived non-expanded CD133+ haematopoietic stem cells EU/3/17/1862 Treatment of Asherman's syndrome Igenomix, S.L. 20/04/2017
Autologous bone marrow-derived mesenchymal stromal cells secreting neurotrophic factors EU/3/13/1148 Treatment of amyotrophic lateral sclerosis Brainstorm Cell Therapeutics UK Ltd 17/07/2013
Autologous bone marrow-derived mononuclear cell fraction EU/3/10/775 Treatment of thromboangiitis obliterans (Buerger's disease) t2cure GmbH 20/09/2010
Autologous CD34+ cells transduced with a lentiviral vector containing the human ADA gene EU/3/13/1134 Treatment of adenosine deaminase-deficient-severe combined immunodeficiency Prof. Bobby Gaspar 07/06/2013
Autologous CD34+ cells transduced with a lentiviral vector containing the human RAG1 gene EU/3/14/1257 Treatment of recombination-activating gene 1 deficient severe combined immunodeficiency Prof. F.J.T.Staal 26/03/2014
Autologous CD34+ cells transduced with a lentiviral vector containing the human SGSH gene EU/3/14/1280 Treatment of mucopolysaccharidosis IIIA (Sanfilippo A syndrome) Orchard Therapeutics Ltd 10/06/2014
Autologous CD34+ cells transduced with a lentiviral vector containing the human Wiskott-Aldrich syndrome gene EU/3/13/1196 Treatment of Wiskott-Aldrich-syndrome Généthon 07/10/2013
Autologous CD34+ cells transduced with lentiviral vector encoding the human beta globin gene EU/3/16/1660 Treatment of beta thalassaemia intermedia and major GlaxoSmithKline Trading Services Limited 30/05/2016
Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA EU/3/07/446 Treatment of metachromatic leukodystrophy GlaxoSmithKline Trading Services Limited 13/04/2007
Autologous CD34+ cells transfected with lentiviral vector containing the Wiskott-Aldrich syndrome protein gene EU/3/12/998 Treatment of Wiskott-Aldrich syndrome GlaxoSmithKline Trading Services Limited 06/06/2012
Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene EU/3/05/313 Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency GlaxoSmithKline Trading Services Limited 26/08/2005 Strimvelis
EU/1/16/1097
30/05/2016
Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human beta A-T87Q-globin gene EU/3/14/1263 Treatment of sickle cell disease bluebird bio France 29/04/2014
Autologous CD34+ haematopoietic stem cells transduced with lentiviral vector encoding the human betaA-T87Q-globin gene EU/3/12/1091 Treatment of beta-thalassaemia intermedia and major bluebird bio France 24/01/2013
Autologous CD4+ and CD8+ T cells expressing a CD19-specific chimeric antigen receptor EU/3/17/1890 Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 17/07/2017
Autologous CD4+ and CD8+ T-cells transduced with lentiviral vector containing an affinity-enhanced T-cell receptor targeting the New York esophageal antigen-1 EU/3/16/1694 Treatment of soft tissue sarcoma Adaptimmune Limited 14/07/2016
Autologous collagen type II-specific regulatory T cells EU/3/14/1405 Treatment of non-infectious uveitis TxCell 16/12/2014
Autologous dendritic cells incubated ex vivo with zebularine and factor VIII EU/3/16/1813 Treatment of haemophilia A Idogen AB 12/01/2017
Autologous dendritic cells pulsed with allogeneic tumour cell lysate EU/3/13/1229 Treatment of malignant mesothelioma Amphera BV 16/01/2014
Autologous dendritic cells pulsed with autologous tumour cell lysate EU/3/07/431 Treatment of glioma Northwest Biotherapeutics GmbH 15/02/2007
Autologous dendritic cells pulsed with recombinant human-fusion protein (mucin 1 - glutathione S transferase) coupled to oxidised polymannose EU/3/10/776 Treatment of ovarian cancer Prima Biomed GmbH 20/09/2010
Autologous dendritic cells pulsed with RNA from glioma stem cells EU/3/14/1273 Treatment of glioma Epitarget AS 04/06/2014
Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha) EU/3/14/1247 Treatment of glioma Diamond BioPharm Limited 19/02/2014
Autologous dermal fibroblasts genetically modified ex vivo with a lentiviral vector containing the human COL7A1 gene EU/3/16/1642 Treatment of epidermolysis bullosa Intrexon Actobiotics N.V. 28/04/2016
Autologous Epstein-Barr virus specific T-cells derived from peripheral blood mononuclear cells, expanded ex vivo EU/3/16/1695 Treatment of extranodal NK/T-cell lymphoma, nasal type Cell Medica Ltd. 14/07/2016
Autologous Epstein-Barr virus specific T-cells derived from peripheral blood mononuclear cells, expanded ex vivo EU/3/16/1696 Treatment of post-transplant lymphoproliferative disorder Cell Medica Ltd. 14/07/2016
Autologous ex-vivo-expanded leucocytes treated with 5-aza-2-deoxycytidine EU/3/13/1197 Treatment of glioma CytoVac A/S 13/11/2013
Autologous ex-vivo-expanded peripheral polyclonal lymphocytes enriched in activated natural killer cells EU/3/17/1918 Treatment of multiple myeloma CellProtect Nordic Pharmaceuticals AB 16/10/2017
Autologous haematopoietic cells genetically modified with a lentiviral vector containing the human gp91(phox) gene EU/3/12/957 Treatment of X-linked chronic granulomatous disease Généthon 09/02/2012
Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene EU/3/09/623 Treatment of beta-thalassaemia intermedia and major EGT San Rocco Italia SRL 29/04/2009
Autologous haematopoietic stem cells transduced with lentiviral vector Lenti-D encoding the human ABCD1 cDNA EU/3/12/1003 Treatment of adrenoleukodystrophy bluebird bio France 06/06/2012
Autologous human peripheral blood Vdelta1+ T lymphocytes activated in vitro by cytokine and monoclonal antibody treatment EU/3/15/1566 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Lymphact - Lymphocyte Activation Technologies S.A. 09/10/2015
Autologous mesenchymal stromal cells on a decellularised tracheal scaffold from a cadaveric donor EU/3/16/1717 Treatment of tracheal stenosis Videregen Ltd 29/08/2016
Autologous mononuclear cells derived from human cord blood EU/3/16/1743 Treatment of neonatal encephalopathy BrainRepair UG (haftungsbeschränkt) 14/10/2016
Autologous mononuclear cells derived from human cord blood EU/3/16/1744 Treatment of periventricular leukomalacia BrainRepair UG (haftungsbeschränkt) 14/10/2016
Autologous regulatory T cells with an immunophenotype of CD4+CD25hiFoxP3+ EU/3/13/1171 Prevention of graft rejection following solid organ transplantation iReg Medical AB 07/10/2013
Autologous renal cell tumor vaccine EU/3/02/116 Treatment of renal cell carcinoma Liponova GmbH 21/10/2002
Autologous stromal vascular cell fraction from adipose tissue EU/3/16/1643 Treatment of systemic sclerosis Cytori Ltd 28/04/2016
Autologous T cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19 EU/3/14/1266 Treatment of B-lymphoblastic leukaemia/lymphoma Novartis Europharm Limited 29/04/2014
Autologous T cells transduced with lentiviral vector containing a chimeric antigen receptor directed against CD19 EU/3/16/1745 Treatment of diffuse large B-cell lymphoma Novartis Europharm Limited 14/10/2016
Autologous T cells transduced with lentiviral vector encoding an anti-SLAMF7 CD28/CD3-zeta chimeric antigen receptor EU/3/17/1833 Treatment of plasma cell myeloma Dr. Michael Hudecek 27/02/2017
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3 zeta chimeric antigen receptor EU/3/14/1393 Treatment of diffuse large B cell lymphoma Kite Pharma EU B.V. 16/12/2014
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1552 Treatment of mantle cell lymphoma Kite Pharma EU B.V. 09/10/2015
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1553 Treatment of primary mediastinal large B-cell lymphoma Kite Pharma EU B.V. 09/10/2015
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1571 Treatment of acute lymphoblastic leukaemia Kite Pharma EU B.V. 11/11/2015
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1572 Treatment of chronic lymphocytic leukaemia/small lymphocytic lymphoma Kite Pharma EU B.V. 11/11/2015
Autologous T cells transduced with retroviral vector encoding an anti-CD19 CD28/CD3-zeta chimeric antigen receptor EU/3/15/1579 Treatment of follicular lymphoma Kite Pharma EU B.V. 11/11/2015
Autologous T lymphocyte-enriched population of cells transduced with a lentiviral vector encoding a chimeric antigen receptor targeting human B cell maturation antigen with 4-1BB and CD3-zeta intracellular signalling domains EU/3/17/1863 Treatment of multiple myeloma Celgene Europe Limited 20/04/2017
Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex EU/3/05/270 Treatment of renal cell carcinoma Antigenics Therapeutics Limited 11/04/2005
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin EU/3/06/394 Treatment of follicular lymphoma Biovest Europe Limited 28/08/2006
Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin EU/3/10/831 Treatment of mantle cell lymphoma Biovest Europe Limited 23/02/2011
Autologous tumour-derived gp96 heat shock protein-peptide complex EU/3/09/624 Treatment of glioma Antigenics Therapeutics Limited 29/04/2009
Avacopan EU/3/17/1880 Treatment of C3 glomerulopathy ChemoCentryx Limited 20/06/2017
Avelumab EU/3/16/1798 Treatment of gastric cancer Merck Serono Europe Limited 12/12/2016
Avian polyclonal IgY antibody against Pseudomonas aeruginosa EU/3/08/564 Treatment of cystic fibrosis Immunsystem I.M.S. AB 23/09/2008
Aviptadil EU/3/06/395 Treatment of acute lung injury mondoBIOTECH Laboratories Anstalt 28/08/2006
Aviptadil EU/3/07/473 Treatment of sarcoidosis mondoBIOTECH Laboratories Anstalt 14/09/2007
Azacitidine EU/3/01/084 Treatment of myelodysplastic syndromes Celgene Europe Limited 06/02/2002 Vidaza
EU/1/08/488
22/12/2008
Azacitidine EU/3/07/509 Treatment of acute myeloid leukaemia Celgene Europe Limited 29/11/2007 Vidaza
EU/1/08/488
22/12/2008
Aztreonam lysinate (inhalation use) EU/3/04/204 Treatment of gram negative bacteria lung infections in cystic fibrosis Gilead Sciences International Ltd 21/06/2004 Cayston
EU/1/09/543
23/09/2009
Bacillus subtilis oxalate decarboxylase EU/3/17/1891 Treatment of primary hyperoxaluria Allena Pharmaceuticals Ireland Limited 17/07/2017
Bacterial lipase EU/3/05/323 Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Nordmark Arzneimittel GmbH u. Co. KG 07/11/2005
Bazedoxifene acetate EU/3/14/1367 Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 19/11/2014
Becatecarin EU/3/06/388 Treatment of cancers of the biliary tree Helsinn Birex Pharmaceuticals Ltd 25/07/2006
Beclomethasone 17, 21-dipropionate (oral use) EU/3/02/093 Treatment of intestinal graft-versus-host disease Soligenix UK Ltd 13/03/2002
Belinostat EU/3/12/1055 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Onxeo DK, Filial af Onxeo S.A., Frankrig 10/10/2012
Belinostat EU/3/13/1151 Treatment of malignant thymoma Onxeo DK, Filial af Onxeo S.A., Frankrig 17/07/2013
Benserazide hydrochloride EU/3/14/1402 Treatment of beta-thalassaemia intermedia and major Isabelle Ramirez 16/12/2014
Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] EU/3/09/715 Treatment of acute lymphoblastic leukaemia Incyte Biosciences UK Ltd 02/02/2010 Iclusig
EU/1/13/839
03/07/2013
Benzamide, 3-(2-imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methyl-N-[4-[(4-methyl-1-piperazinyl)methyl]-3-(trifluoromethyl)phenyl] EU/3/09/716 Treatment of chronic myeloid leukaemia Incyte Biosciences UK Ltd 02/02/2010 Iclusig
EU/1/13/839
03/07/2013
Benzoic acid, sodium salt EU/3/02/111 Treatment of non-ketotic hyperglycinaemia Lucane Pharma SA 11/09/2002
Beraprost sodium (modified release tablet) EU/3/08/554 Treatment of pulmonary arterial hypertension IDEA Innovative Drug European Associates Limited 10/07/2008
Beta-artemether / lumefantrine (powder for oral suspension) EU/3/09/702 Treatment of malaria Dafra Pharma International NV 28/01/2010
Bevacizumab EU/3/14/1390 Treatment of hereditary haemorrhagic telangiectasia Dr Sophie Dupuis-Girod 16/12/2014
Bilayer engineered collagen hydrogel-based skin graft composed of autologous keratinocytes and fibroblasts EU/3/15/1596 Treatment of partial deep dermal and full thickness burns Voisin Consulting S.A.R.L. 14/12/2015
Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix EU/3/06/369 Treatment of epidermolysis bullosa Biodan Yelah S.L. 22/05/2006
Bimosiamose disodium EU/3/05/285 Treatment of acute lung injury Revotar Biopharmaceuticals AG 27/05/2005
Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium EU/3/04/232 Treatment of glioma Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 20/10/2004
Bitopertin EU/3/17/1919 Treatment of beta-thalassaemia intermedia and major Roche Registration Limited 16/10/2017
Blinatumomab EU/3/09/650 Treatment of acute lymphoblastic leukaemia Amgen Europe B.V. 24/07/2009 Blincyto
EU/1/15/1047
25/11/2015
Bosutinib EU/3/10/762 Treatment of chronic myeloid leukaemia Pfizer Limited 04/08/2010 Bosulif
EU/1/13/818
02/04/2013
Bovine bile extract EU/3/05/287 Treatment of pancreatic cancer Dr Ulrich Granzer 20/06/2005
Brentuximab vedotin EU/3/11/939 Treatment of cutaneous T-cell lymphoma Takeda Pharma A/S 11/01/2012
Brincidofovir EU/3/16/1644 Prevention of cytomegalovirus disease Chimerix UK Ltd 28/04/2016
Brincidofovir EU/3/16/1697 Treatment of adenovirus infection in immunocompromised patients Chimerix UK Ltd 14/07/2016
Brincidofovir EU/3/16/1777 Treatment of smallpox Chimerix UK Ltd 18/11/2016
Brivudine EU/3/09/703 Treatment of pancreatic cancer RESprotect GmbH 28/01/2010
Budesonide EU/3/13/1181 Treatment of eosinophilic oesophagitis Dr Falk Pharma GmbH 05/08/2013
Budesonide EU/3/16/1778 Treatment of primary IgA nephropathy Pharmalink AB 18/11/2016
Budesonide (oral use) EU/3/06/413 Treatment of Graft-versus-Host disease Dr Falk Pharma GmbH 03/11/2006
Cabiralizumab EU/3/16/1799 Treatment of tenosynovial giant cell tumour, localised and diffuse type Albany Regulatory Consulting Limited 12/12/2016
Caffeine citrate EU/3/03/132 Treatment of primary apnoea of premature newborns Chiesi Farmaceutici S.p.A. 17/02/2003 Peyona
EU/1/09/528
06/07/2009
Caffeine citrate EU/3/14/1261 Prevention of bronchopulmonary dysplasia Viridian Pharma Ltd 11/04/2014
Cannabidiol EU/3/14/1339 Treatment of Dravet syndrome GW Pharma Ltd 15/10/2014
Cannabidiol EU/3/15/1520 Treatment of perinatal asphyxia GW Pharma Ltd 28/07/2015
Cannabidiol EU/3/16/1645 Prevention of graft-versus-host disease Richardson Associates Regulatory Affairs Ltd 28/04/2016
Cannabidiol EU/3/16/1718 Treatment of graft-versus-host disease Richardson Associates Regulatory Affairs Ltd 29/08/2016
Cannabidiol EU/3/17/1855 Treatment of Lennox-Gastaut syndrome GW Research Ltd 20/03/2017
Cannabidiol EU/3/17/1920 Treatment of West syndrome GW Research Ltd 16/10/2017
Carbamazepine EU/3/16/1746 Treatment of metaphyseal chondrodysplasia, Schmid type University of Newcastle upon Tyne 14/10/2016
Carbetocin EU/3/12/975 Treatment of Prader-Willi syndrome Ferring Pharmaceuticals A/S 21/03/2012
Carboxy pyrrolidine hexanoyl pyrrolidine carboxylate EU/3/14/1292 Treatment of AL amyloidosis GlaxoSmithKline Trading Services Limited 30/07/2014
Carboxypeptidase G2 EU/3/02/128 Adjunctive treatment in patients at risk of methotrexate toxicity BTG Management Services Limited 03/02/2003
Cardiotrophin-1 EU/3/06/396 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation Digna Biotech S.L. 28/08/2006
Cardiotrophin-1 EU/3/11/893 Treatment of acute liver failure Digna Biotech S.L. 30/08/2011
Carfilzomib EU/3/08/548 Treatment of multiple myeloma Amgen Europe B.V. 03/06/2008 Kyprolis
EU/1/15/1060
23/11/2015
Carglumic acid EU/3/08/575 Treatment of isovaleric acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
EU/1/02/246
01/06/2011
Carglumic acid EU/3/08/576 Treatment of methylmalonic acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
EU/1/02/246
01/06/2011
Carglumic acid EU/3/08/577 Treatment of propionic acidaemia Orphan Europe S.A.R.L. 07/11/2008 Carbaglu
EU/1/02/246
01/06/2011
Catumaxomab EU/3/06/414 Treatment of gastric cancer Neovii Biotech GmbH 03/11/2006
CD33-directed antibody-drug conjugate consisting of an antibody conjugated to a DNA cross-linking pyrrolobenzodiazepine dimer drug EU/3/15/1545 Treatment of acute myeloid leukaemia Seattle Genetics UK, Limited 10/08/2015
Cediranib EU/3/14/1303 Treatment of ovarian cancer AstraZeneca AB 29/07/2014
Ceftriaxone EU/3/14/1425 Treatment of spinocerebellar ataxia Ospedale San Raffaele s.r.l. 15/01/2015
Cenersen EU/3/08/587 Treatment of chronic lymphocytic leukaemia EleosInc Limited 03/12/2008
Chemically modified human recombinant sulfamidase EU/3/16/1747 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Swedish Orphan Biovitrum AB (publ) 14/10/2016
Chenodeoxycholic acid EU/3/14/1406 Treatment of inborn errors of primary bile acid synthesis Leadiant GmbH 16/12/2014 Chenodeoxycholic acid Leadiant
EU/1/16/1110
12/04/2017
Chimeric 2'-O-(2-methoxyethyl) modified oligonucleotide targeted to huntingtin RNA EU/3/15/1453 Treatment of Huntington’s disease Ionis USA Limited 19/03/2015
Chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2 EU/3/14/1422 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) BioMarin Europe Ltd. 15/01/2015
Chimeric group B adenovirus (11p/3) with deletions in the E3 and E4 regions EU/3/15/1434 Treatment of ovarian cancer PsiOxus Therapeutics Ltd 12/02/2015
Chimeric IgG monoclonal antibody cG250 EU/3/02/094 Treatment of renal cell carcinoma Wilex AG 19/03/2002
Chimeric locked nucleic acid deoxynucleoside phosphorothioate-linked oligonucleotide inhibitor directed against microRNA-155-5p EU/3/17/1872 Treatment of cutaneous T-cell lymphoma Miragen Therapeutics Europe Ltd 22/05/2017
Chimeric monoclonal antibody against claudin 6 EU/3/12/1092 Treatment of ovarian cancer GANYMED Pharmaceuticals GmbH 24/01/2013
Chimeric monoclonal antibody against claudin-18 splice variant 2 EU/3/10/803 Treatment of gastric cancer GANYMED Pharmaceuticals GmbH 26/11/2010
Chimeric monoclonal antibody against claudin-18 splice variant 2 EU/3/13/1177 Treatment of pancreatic cancer GE Healthcare AS 05/08/2013
Chimeric monoclonal antibody against GD2 EU/3/12/1062 Treatment of neuroblastoma EUSA Pharma (UK) Limited 08/11/2012 Dinutuximab beta Apeiron
EU/1/17/1191
11/05/2017
Chimeric monoclonal antibody to O-acetyl-GD2 antigen EU/3/14/1416 Treatment of neuroblastoma OGD2 Pharma 15/01/2015
Chimeric monoclonal antibody to shiga-toxin 1 and 2 EU/3/05/301 Treatment of shiga-toxin producing bacterial infection. Albany Regulatory Consulting Limited 26/08/2005
Chimeric-anti-interleukin-6 monoclonal antibody EU/3/07/508 Treatment of Castleman’s disease Janssen-Cilag International NV 30/11/2007 Sylvant
EU/1/14/928
27/05/2014
Chlormethine EU/3/12/963 Treatment of cutaneous T-cell lymphoma Actelion Registration Ltd 22/05/2012 Ledaga
EU/1/16/1171
07/03/2017
Chloroquine EU/3/14/1377 Treatment of glioma DualTpharma B.V. 19/11/2014
Cholest-4-en-3-one, oxime EU/3/05/264 Treatment of 5q spinal muscular atrophy Roche Registration Limited 10/03/2005
Cholic acid EU/3/02/127 Treatment of inborn errors in primary bile acid synthesis Laboratoires CTRS 18/12/2002 Orphacol
EU/1/13/870
16/09/2013
Cholic acid EU/3/09/683 Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid Retrophin Europe Limited 28/10/2009 Kolbam
EU/1/13/895
08/04/2014
Choline tetrathiomolybdate EU/3/12/1089 Treatment of Wilson’s disease Wilson Therapeutics AB 24/01/2013
Ciclosporin EU/3/06/360 Treatment of vernal keratoconjunctivitis Santen Oy 06/04/2006
Ciclosporin EU/3/07/455 Prevention of corneal graft rejection SANTEN SAS 22/10/2007
Ciclosporin EU/3/07/489 Treatment of Herpes simplex virus stromal keratitis SANTEN S.A.S. 29/10/2007
Ciclosporin EU/3/10/791 Treatment of moderate and severe closed traumatic brain injury NeuroVive Pharmaceutical AB 01/10/2010
Ciclosporin (eye drops, solution) EU/3/09/651 Treatment of atopic keratoconjunctivitis Allergan Pharmaceuticals Ireland 24/07/2009
Ciclosporin (inhalation use) EU/3/04/210 Treatment of bronchiolitis obliterans syndrome Breath Therapeutics GmbH 29/07/2004
Ciclosporin (inhalation use) EU/3/04/209 Prevention of graft rejection after lung transplantation Breath Therapeutics GmbH 29/07/2004
Ciprofloxacin (inhalation use) EU/3/07/469 Treatment of cystic fibrosis Bayer AG 03/08/2007
Ciprofloxacin (liposomal) EU/3/09/652 Treatment of cystic fibrosis Aradigm Limited 24/07/2009
Cisplatin EU/3/16/1719 Treatment of malignant mesothelioma PlumeStars s.r.l. 29/08/2016
Cisplatin (liposomal) EU/3/07/451 Treatment of pancreatic cancer Regulon AE 08/06/2007
Citric acid monohydrate EU/3/16/1675 Treatment of acute liver failure CATS Consultants GmbH 27/06/2016
Cladribine EU/3/13/1182 Treatment of mastocytosis Lipomed GmbH 05/08/2013
Clonidine hydrochloride EU/3/11/919 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Onxeo 27/10/2011
Combination of 4-hydroxyandrostenedione, Serenoa serrulata fruit extract and alpha lipoic acid EU/3/16/1646 Treatment of multiple symmetric lipomatosis Dr. Regenold GmbH 28/04/2016
Combretastatin A1 diphosphate EU/3/15/1587 Treatment of acute myeloid leukaemia Diamond BioPharm Limited 14/12/2015
Copper meso-5,15-bis[3-[(1,2-dicarba-closo-dodecaboranyl)methoxy]phenyl]-meso-10,20-dinitroporphyrin EU/3/13/1138 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy MorEx Development Partners LLP 27/06/2013
Covalently closed DNA plasmids coding for cytomegalovirus phosphoprotein 65 and glycoprotein B genes EU/3/12/1042 Prevention of cytomegalovirus disease in patients with impaired cell mediated immunity deemed at risk Astellas Pharma Europe B.V. 09/08/2012
Crenolanib besylate EU/3/16/1748 Treatment of acute myeloid leukemia Arog Pharmaceuticals Europe Ltd 14/10/2016
Crenolanib besylate EU/3/16/1749 Treatment of soft tissue sarcoma Arog Pharmaceuticals Europe Ltd 14/10/2016
Cultured allogeneic corneal limbal stem cells EU/3/14/1340 Treatment of limbal stem cell deficiency NHS National Services Scotland Trading as Scottish National Blood Transfusion Service 15/10/2014
Cyclic pyranopterin monophosphate EU/3/10/777 Treatment of molybdenum cofactor deficiency type A Alexion Europe SAS 20/09/2010
Cyclocreatine EU/3/16/1676 Treatment of creatine deficiency syndromes Pharma Gateway AB 27/06/2016
Cyclo-Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys EU/3/13/1102 Treatment of high altitude pulmonary oedema Apeptico Forschung und Entwicklung GmbH 08/02/2013
Cyclo(-gamma-aminobutyryl-L-phenylalanyl-L-tryptophanyl-D-tryptophanyl-L-lysyl-L-threonyl-L phenylalanyl-N-3-carboxypropyl)-glycine amide, acetate salt EU/3/12/1075 Treatment of acromegaly Cortendo AB 06/12/2012
Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl] acetate salt EU/3/13/1114 Treatment of congenital alpha-1 antitrypsin deficiency Polyphor UK Ltd 20/03/2013
Cyclo[L-alanyl-L-seryl-L-isoleucyl-L-prolyl-L-prolyl-L-glutaminyl-L-lysyl-L-tyrosyl-D-prolyl-L-prolyl-(2S)-2-aminodecanoyl-L-alpha-glutamyl-L-threonyl]acetate salt EU/3/17/1834 Treatment of primary ciliary dyskinesia Polyphor UK Ltd 27/02/2017
Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt EU/3/08/610 Treatment of medullary thyroid carcinoma Ipsen Pharma 06/02/2009 Cometriq
EU/1/13/890
26/03/2014
Cysteamine EU/3/11/928 Treatment of cystic fibrosis NovaBiotics Ltd 09/12/2011
Cysteamine EU/3/14/1240 Treatment of cystic fibrosis Istituto Europeo per la Ricerca sulla Fibrosi Cistica - ONLUS 19/02/2014
Cysteamine bitartrate EU/3/14/1252 Treatment of pancreatic cancer Horizon Pharma Europe B.V. 26/03/2014
Cysteamine bitartrate EU/3/14/1306 Treatment of Huntington’s disease Horizon Pharma Europe B.V. 29/07/2014
Cysteamine bitartrate (gastroresistant) EU/3/10/778 Treatment of cystinosis Horizon Pharma Europe B.V. 20/09/2010 Procysbi
EU/1/13/861
10/09/2013
Cysteamine hydrochloride EU/3/08/578 Treatment of cystinosis Orphan Europe S.A.R.L. 07/11/2008 Cystadrops
EU/1/15/1049
23/01/2017
Cysteamine hydrochloride EU/3/14/1341 Treatment of cystinosis Lucane Pharma SA 15/10/2014
Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate EU/3/03/149 Treatment of pancreatic cancer in combination with ifosfamide Pharmacyte Biotech Europe Limited 30/06/2003
Dantrolene sodium EU/3/14/1379 Treatment of malignant hyperthermia Eagle Laboratories Limited 19/11/2014
Dantrolene sodium EU/3/16/1800 Treatment of Wolfram syndrome Alan Boyd Consultants Ltd 12/12/2016
Daratumumab EU/3/13/1153 Treatment of plasma cell myeloma Janssen-Cilag International NV 17/07/2013 Darzalex
EU/1/16/1101
24/05/2016
Darinaparsin EU/3/11/850 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) IDEA Innovative Drug European Associates Limited 15/04/2011
Daunorubicin (liposomal) EU/3/08/585 Treatment of acute myeloid leukaemia Diatos S. A. 03/12/2008
Decitabine EU/3/03/135 Treatment of myelodysplastic syndromes Janssen-Cilag International NV 14/02/2003
Decitabine EU/3/06/370 Treatment of acute myeloid leukaemia Janssen-Cilag International NV 08/06/2006 Dacogen
EU/1/12/792
24/09/2012
Decitabine and tetrahydrouridine EU/3/17/1881 Treatment of sickle cell disease Ulrich Muehlner 20/06/2017
Deferiprone EU/3/10/832 Treatment of sickle cell disease Apotex Europe B.V. 23/02/2011
Defibrotide EU/3/04/211 Prevention of hepatic veno-occlusive disease Gentium S.r.I. 29/07/2004
Defibrotide EU/3/04/212 Treatment of hepatic veno-occlusive disease Gentium S.r.I. 29/07/2004 Defitelio
EU/1/13/878
22/10/2013
Defibrotide EU/3/13/1201 Prevention of graft-versus-host disease Gentium S.r.I. 13/11/2013
Delta-9-tetrahydrocannabinol and cannabidiol from extracts of the Cannabis sativa L. plant EU/3/16/1621 Treatment of glioma GW Research Ltd 17/02/2016
Denileukin diftitox EU/3/01/075 Treatment of cutaneous T-cell lymphoma Eisai Limited 11/12/2001
Dexamethasone sodium phosphate encapsulated in human autologous erythrocytes EU/3/13/1158 Treatment of ataxia telangiectasia Erydel S.p.A. 17/07/2013
Dexamethasone sodium phosphate encapsulated in human erythrocytes EU/3/04/230 Treatment of cystic fibrosis Erydel S.p.A. 20/10/2004
Diacerein EU/3/14/1236 Treatment of epidermolysis bullosa Medpace Finland OY 19/02/2014
Diaspirin cross-linked haemoglobin EU/3/14/1378 Treatment of hepatocellular carcinoma New B Innovation (UK) Limited 19/11/2014
Diaspirin cross-linked haemoglobin EU/3/16/1628 Treatment of oesophageal cancer New B Innovation (UK) Limited 21/03/2016
Diclofenamide EU/3/16/1616 Treatment of periodic paralysis Prof. Michael Hanna 17/02/2016
Diclofenamide EU/3/16/1677 Treatment of periodic paralysis Sun Pharmaceutical Industries Europe BV 27/06/2016
Dimethyl fumarate EU/3/16/1698 Treatment of bullous pemphigoid Immungenetics AG 14/07/2016
dimethyl sulfoxide EU/3/05/263 Treatment of severe closed traumatic brain injury AOP Orphan Pharmaceuticals AG 03/03/2005
Dinaciclib EU/3/11/901 Treatment of chronic lymphocytic leukaemia Merck Sharp & Dohme Limited 27/09/2011
Dipalmitoylphosphatidylcholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol, sodium salt, synthetic surfactant protein C analogue and synthetic surfactant protein B analogue EU/3/12/982 Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Chiesi Farmaceutici S.p.A. 02/04/2012
DNA plasmid encoding a recombinant fusion protein consisting of the extracellular domain of human TNFa p55 receptor linked to the human IgG1 Fc domain EU/3/16/1619 Treatment of non-infectious uveitis Eyevensys SAS 17/02/2016
Donor lymphocyte preparation depleted of functional alloreactive T-cells EU/3/08/561 Prevention of Graft-versus-Host disease Kiadis Pharma Netherlands B.V. 05/09/2008
Donor T lymphocytes depleted ex vivo of host alloreactive T cells using photodynamic treatment EU/3/14/1356 Treatment of acute myeloid leukaemia Kiadis Pharma Netherlands B.V. 19/11/2014
Donor T lymphocytes depleted ex vivo of host alloreactive T cells using photodynamic treatment EU/3/16/1678 Treatment in haematopoietic stem cell transplantation Kiadis Pharma Netherlands B.V. 27/06/2016
Doxorubicin EU/3/15/1513 Treatment of hepatoblastoma Double Bond Pharmaceutical AB 28/07/2015
Doxorubicin hydrochloride in a lipid-based pegylated nanoparticle modified with a 31-aminoacid peptide targeting nucleolin EU/3/16/1814 Treatment of malignant mesothelioma TREAT U, S.A. 12/01/2017
Doxorubicin hydrochloride (in heat-sensitive liposomes) EU/3/10/833 Treatment of hepatocellular carcinoma Biological Consulting Europe Ltd 23/02/2011
Doxorubicin hydrochloride (liposomal) EU/3/06/410 Treatment of soft tissue sarcoma GP-Pharm S.A. 27/10/2006
Doxorubicin polyisohexylcyanoacrylate nanoparticles EU/3/04/229 Treatment of the hepatocellular carcinoma Onxeo 21/10/2004
Doxorubicin(6-maleimidocaproyl)hydrazone EU/3/14/1258 Treatment of soft tissue sarcoma Pharma Gateway AB 26/03/2014
Doxycycline hyclate EU/3/12/955 Treatment of familial amyloid polyneuropathy Giampaolo Merlini 02/04/2012
Doxycycline hyclate EU/3/12/961 Treatment of systemic amyloidosis caused by beta-2 microglobulin Giampaolo Merlini 05/03/2012
Drotrecogin alfa (activated) EU/3/08/565 Treatment of acute respiratory distress syndrome Savara ApS 22/09/2008
Dry extract from birch bark (DER 0.1-0.2:1), extraction solvent n-heptane 95% (V/V) EU/3/10/845 Treatment of epidermolysis bullosa Birken AG 23/02/2011
Duramycin EU/3/02/120 Treatment of cystic fibrosis AOP Orphan Pharmaceuticals AG 13/11/2002
E. Coli heat-shock protein 70 with bovine retinal S-antigen EU/3/05/346 Treatment of autoimmune uveitis Biotech Tools SA 24/01/2006
((E)-1-(4'-chlorophenyl)-3-(4-hydroxy-3-metoxyphenyl)prop-2-en-1-one) EU/3/14/1384 Treatment of WHIM syndrome Centre National de la Recherche Scientifique (CNRS) 16/12/2014
(E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/279 Treatment of cutaneous T-cell lymphoma Celgene Europe Limited 27/05/2005
(E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/328 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Celgene Europe Limited 28/10/2005
(E)-2,4,6-trimethoxystyryl-3-carboxymethylamino-4-methoxybenzyl-sulfone sodium salt EU/3/12/987 Treatment of myelodysplastic syndromes Onconova Europe GmbH 26/04/2012
(E)-(6-((N-methyl-((3-methylbenzofuran-2-yl)methyl)amino)-3-oxoprop-1-en-1-yl)-2-oxo-3,4-dihydro-1,8-naphthyridin-1(2H)-yl)methyl phosphate, bis ethanolamine salt EU/3/16/1737 Treatment of osteomyelitis Voisin Consulting S.A.R.L. 14/10/2016
Ecopipam EU/3/09/717 Treatment of Lesch-Nyhan disease Dr Alain Munoz 03/02/2010
Ecothiopate iodide EU/3/15/1474 Treatment of Stargardt's disease Dorian Regulatory Affairs BV 24/04/2015
Eculizumab EU/3/03/166 Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe SAS 17/10/2003 Soliris
EU/1/07/393
22/06/2007
Eculizumab EU/3/09/653 Treatment of atypical haemolytic uremic syndrome Alexion Europe SAS 24/07/2009 Soliris
EU/1/07/393
29/11/2011
Eculizumab EU/3/13/1185 Treatment of neuromyelitis optica Alexion Europe SAS 05/08/2013
Eculizumab EU/3/14/1254 Prevention of graft rejection following solid organ transplantation Alexion Europe SAS 26/03/2014
Eculizumab EU/3/14/1304 Treatment of myasthenia gravis Alexion Europe SAS 29/07/2014 Soliris
EU/1/07/393
17/08/2017
Edaravone EU/3/14/1399 Treatment of amyotrophic lateral sclerosis Treeway B.V. 16/12/2014
Edaravone EU/3/15/1510 Treatment of amyotrophic lateral sclerosis Mitsubishi Tanabe Pharma Europe Ltd. 19/06/2015
Eflornithine EU/3/10/779 Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 20/09/2010
Eflornithine EU/3/11/902 Treatment of neuroblastoma Cancer Prevention Pharma Limited 27/09/2011
Eflornithine EU/3/16/1679 Treatment of glioma Orbus Therapeutics Limited 27/06/2016
Eflornithine in combination with sulindac EU/3/12/1086 Treatment of familial adenomatous polyposis Cancer Prevention Pharma Limited 24/01/2013
Eicosapentaenoic acid EU/3/09/666 Treatment of familial adenomatous polyposis S.L.A. Pharma (UK) Limited 08/10/2009
Elafin EU/3/07/443 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Proteo Biotech AG 20/03/2007
Emeramide EU/3/17/1864 Prevention of mercury toxicity NBMI Science Limited 20/04/2017
Emtricitabine EU/3/14/1420 Treatment of Aicardi-Goutières syndrome Dr Yanick Crow 15/01/2015
Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor EU/3/12/1072 Treatment of macular telangiectasia type 2 Enpharma Ltd 08/11/2012
Encapsulated human retinal pigment epithelial cell line transfected with plasmid vector expressing human ciliary neurotrophic factor EU/3/12/1098 Treatment of retinitis pigmentosa Enpharma Ltd 24/01/2013
Enoxacin EU/3/15/1459 Treatment of amyotrophic lateral sclerosis Dr. Regenold GmbH 19/03/2015
Entinostat EU/3/10/732 Treatment of Hodgkin's lymphoma Syndax Limited 10/06/2010
Entolimod EU/3/15/1607 Treatment of acute radiation syndrome TMC Pharma Services Ltd 11/01/2016
Enzastaurin hydrochloride EU/3/05/343 Treatment of glioma Isabelle Ramirez 23/12/2005
Enzastaurin hydrochloride EU/3/07/442 Treatment of diffuse large B cell lymphoma Isabelle Ramirez 20/03/2007
Eptacog alfa (activated) EU/3/05/333 Treatment of diffuse alveolar haemorrhage Savara ApS 14/12/2005
Erdosteine EU/3/12/1067 Treatment of mercury toxicity Rafifarm SRL 08/11/2012
Erdosteine EU/3/12/1084 Treatment of lead toxicity Rafifarm SRL 06/12/2012
Estetrol EU/3/17/1865 Treatment of neonatal encephalopathy Mithra Pharmaceuticals S.A. 28/04/2017
Estradiol Hemihydrate and Progesterone EU/3/05/275 Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age Dr Frank Pohlandt 11/04/2005
Ethyl Eicosopentaenoate EU/3/00/013 Treatment of Huntington's disease Amarin Neuroscience Limited 29/12/2000
Etilefrin EU/3/02/122 Treatment of low flow priapism Laboratoires SERB 13/11/2002
Everolimus EU/3/10/764 Treatment of tuberous sclerosis Novartis Europharm Limited 04/08/2010 Votubia
EU/1/11/710
06/09/2011
Exenatide EU/3/16/1629 Treatment of idiopathic intracranial hypertension Alan Boyd Consultants Ltd 21/03/2016
Exendin (9-39) EU/3/16/1750 Treatment of noninsulinoma pancreatogenous hypoglycaemia syndrome Eiger Biopharmaceuticals Europe Limited 14/10/2016
Exisulind EU/3/14/1387 Treatment of familial cerebral cavernous malformations Firc Institute of Molecular Oncology (IFOM) 16/12/2014
Exon 44 specific phosphorothioate oligonucleotide EU/3/08/598 Treatment of Duchenne muscular dystrophy BioMarin International Limited 27/02/2009
Exon 45 specific phosphorothioate oligonucleotide EU/3/12/991 Treatment of Duchenne muscular dystrophy BioMarin International Limited 26/04/2012
Exon 51 specific phosphorothioate oligonucleotide EU/3/08/599 Treatment of Duchenne muscular dystrophy BioMarin International Limited 27/02/2009
Exon 52 specific phosphorothioate oligonucleotide EU/3/12/1077 Treatment of Duchenne muscular dystrophy BioMarin International Limited 06/12/2012
Exon 53 specific phosphorothioate oligonucleotide EU/3/12/992 Treatment of Duchenne muscular dystrophy BioMarin International Limited 26/04/2012
Exon 55 specific phosphorothioate oligonucleotide EU/3/12/1078 Treatment of Duchenne muscular dystrophy BioMarin International Limited 06/12/2012
Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue EU/3/09/667 Treatment of anal fistula TiGenix S.A.U. 08/10/2009
Expanded human allogeneic neural retinal progenitor cells extracted from neural retina EU/3/13/1140 Treatment of retinitis pigmentosa ReNeuron Ltd 19/06/2013
Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower EU/3/05/302 Treatment of sickle cell disease Xechem UK Ltd 26/08/2005
Ex-vivo cultured adult human mesenchymal stem cells EU/3/07/432 Treatment of Graft-versus-Host disease Voisin Consulting S.A.R.L. 20/02/2007
Ex-vivo expanded autologous human corneal epithelium containing stem cells EU/3/08/579 Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns Chiesi Farmaceutici S.p.A. 07/11/2008 Holoclar
EU/1/14/987
19/02/2015
Ex-vivo expanded autologous human corneal epithelium containing stem cells EU/3/13/1168 Treatment of limbal stem cell deficiency University of Newcastle upon Tyne 17/07/2013
Ex-vivo-cultured human mesenchymal stromal cells EU/3/14/1253 Prevention of graft rejection following solid organ transplantation iCell Science AB 26/03/2014
Ex-vivo-expanded autologous fibroblasts transduced with lentiviral vector containing the COL7A1 gene EU/3/16/1611 Treatment of epidermolysis bullosa Dr Waseem Qasim 17/02/2016
Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a COL17A1-encoding retroviral vector EU/3/15/1467 Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a COL7A1-encoding retroviral vector EU/3/15/1466 Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
Ex-vivo-expanded autologous human keratinocytes containing epidermal stem cells transduced with a LAMB3-encoding retroviral vector EU/3/15/1465 Treatment of epidermolysis bullosa Chiesi Farmaceutici S.p.A. 19/03/2015
Ex-vivo-expanded autologous keratinocytes transduced with retroviral vector containing the COL7A1 gene EU/3/17/1835 Treatment of epidermolysis bullosa Ser-mes Planificación SL 27/02/2017
Fc- and CDR-modified humanised monoclonal antibody against C5 EU/3/16/1661 Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe SAS 30/05/2016
Fenfluramine hydrochloride EU/3/13/1219 Treatment of Dravet syndrome Zogenix International Ltd 18/12/2013
Fenfluramine hydrochloride EU/3/17/1836 Treatment of Lennox-Gastaut syndrome Zogenix International Ltd 27/02/2017
Fenretinide EU/3/16/1630 Treatment of cutaneous T-cell lymphoma Clinipace GmbH 21/03/2016
Fenretinide EU/3/16/1751 Treatment of peripheral T-cell lymphoma Clinipace GmbH 14/10/2016
Fibrinogen-coated albumin spheres EU/3/15/1442 Treatment of Ebola virus disease Fibreu Limited 12/02/2015
Fibrinogen-coated albumin spheres EU/3/15/1535 Treatment of acute radiation syndrome Fibreu Limited 10/08/2015
filgrastim EU/3/08/532 Treatment of amyotrophic lateral sclerosis NeuroVision Pharma GmbH 01/04/2008
Filgrastim EU/3/08/580 Treatment of spinal cord injury NeuroVision Pharma GmbH 07/11/2008
Fimaporfin EU/3/16/1720 Treatment of cholangiocarcinoma PCI Biotech AS 29/08/2016
Fixed-dose combination of fosfomycin disodium and tobramycin EU/3/15/1538 Treatment of cystic fibrosis CURx Pharma (UK) Limited 10/08/2015
Fixed-dose combination of (R-S) baclofen, naltrexone hydrochloride and D-sorbitol EU/3/14/1260 Treatment of Charcot-Marie-Tooth disease type 1A Pharnext SA 26/03/2014
Florilglutamic acid (18F) EU/3/16/1631 Diagnosis of glioma Piramal Imaging GmbH 21/03/2016
Florilglutamic acid (18F) EU/3/16/1632 Diagnosis of hepatocellular carcinoma Piramal Imaging GmbH 21/03/2016
Fluciclovine (18F) EU/3/15/1472 Diagnosis of glioma Blue Earth Diagnostics Ltd 24/04/2015
Fluocinolone acetonide (prolonged-release intravitreal implant) EU/3/05/261 Treatment of non-infectious uveitis affecting the posterior segment of the eye Bausch & Lomb Ireland 07/03/2005
Fluticasone propionate EU/3/16/1815 Treatment of eosinophilic oesophagitis Adare Pharmaceuticals srl 12/01/2017
Forodesine EU/3/10/780 Treatment of chronic lymphocytic leukaemia Mundipharma Research Limited 20/09/2010
Forodesine hydrochloride EU/3/06/421 Treatment of acute lymphoblastic leukaemia Napp Pharmaceuticals Research Limited 18/12/2006
Forodesine hydrochloride EU/3/06/428 Treatment of cutaneous T-cell lymphoma Napp Pharmaceuticals Research Limited 29/01/2007
Fosbretabulin tromethamine EU/3/13/1154 Treatment of ovarian cancer Diamond BioPharm Limited 17/07/2013
Fosbretabulin tromethamine EU/3/16/1633 Treatment of gastro-entero-pancreatic neuroendocrine tumours Diamond BioPharm Limited 21/03/2016
Fusion proteins composed by a genetically modified cholera toxin subunit A1, peptides from the acetylcholine receptor alpha chain and a dimer of the D fragment from Staphylococcus aureus protein A EU/3/15/1489 Treatment of myasthenia gravis Toleranzia AB 21/05/2015
G17(9) gastrin-diphtheria toxoid conjugate EU/3/02/129 Treatment of pancreatic cancer Cato Europe GmbH 24/01/2003
G17(9) gastrin-diphtheria toxoid conjugate EU/3/02/130 Treatment of gastric cancer Cato Europe GmbH 28/01/2003
Gadodiamide (liposomal) EU/3/08/583 Treatment of glioma Dr Matthias Luz 03/12/2008
Gallium (68Ga)-edotreotide EU/3/15/1450 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 19/03/2015 SomaKit TOC
EU/1/16/1141
12/12/2016
Gallium (68Ga)-pasireotide tetraxetan EU/3/11/920 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours OctreoPharm Sciences GmbH 27/10/2011
Gallium [Ga-68]-N-[(4,7,10-tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-Lcysteinyl-L-threonine-cyclic(2-7)disulfide EU/3/14/1237 Diagnosis of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 19/02/2014
Gemtuzumab Ozogamicin EU/3/00/005 Treatment of acute myeloid leukaemia Pfizer Limited 18/10/2000
Genetically modified adeno-associated viral vector serotype 9 expressing shRNA as well as a codon-optimized shRNA-insensitive wildtype PABPN1 EU/3/16/1816 Treatment of oculopharyngeal muscular dystrophy Clinipace GmbH 12/01/2017
Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) EU/3/06/405 Treatment of renal cell carcinoma MOLOGEN AG 23/10/2006
Genetically modified human adenovirus encoding human PH20 hyaluronidase EU/3/11/880 Treatment of pancreatic cancer VCN Biosciences S.L. 21/06/2011
Genetically modified Lactococcus lactis bacteria containing the human trefoil factor 1 gene EU/3/11/903 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Intrexon Actobiotics N.V. 27/09/2011
Genetically modified serotype 5/3 adenovirus coding for granulocyte macrophage colony-stimulating factor EU/3/14/1265 Treatment of ovarian cancer Targovax Oy 29/04/2014
Genetically modified serotype 5/3 adenovirus coding for granulocyte macrophage colony-stimulating factor EU/3/14/1398 Treatment of malignant mesothelioma Targovax Oy 16/12/2014
Genetically modified serotype 5/3 adenovirus coding for granulocyte-macrophage colony-stimulating factor EU/3/13/1145 Treatment of soft tissue sarcoma Targovax Oy 19/06/2013
Genistein sodium salt dihydrate EU/3/12/980 Treatment of mucopolysaccharidosis type III (Sanfilippo syndrome) Axcentua Pharmaceuticals AB 02/04/2012
Gevokizumab EU/3/13/1111 Treatment of chronic non-infectious uveitis XOMA UK Limited 12/03/2013
Gevokizumab EU/3/14/1311 Treatment of Schnitzler syndrome XOMA UK Limited 22/08/2014
Gimatecan EU/3/03/174 Treatment of glioma Sigma-Tau Industrie Farmaceutiche Riunite S.p.A 01/12/2003
Givinostat EU/3/09/719 Treatment of polycythaemia vera Italfarmaco S.p.A. 03/02/2010
Givinostat EU/3/12/1009 Treatment of Duchenne muscular dystrophy Italfarmaco S.p.A. 04/07/2012
Glibenclamide EU/3/15/1589 Treatment of neonatal diabetes AMMTeK 15/01/2016
Glucagon EU/3/12/960 Treatment of congenital hyperinsulinism Biodel UK Limited 05/03/2012
Glucagon EU/3/14/1342 Treatment of congenital hyperinsulinism S-cubed Ltd 15/10/2014
Glucopyranosyl lipid A stable emulsion and recombinant New York esophageal squamous cell carcinoma-1 protein EU/3/16/1634 Treatment of soft tissue sarcoma Immune Design Ltd 21/03/2016
Glufosfamide EU/3/11/851 Treatment of pancreatic cancer Theradex (Europe) Ltd. 15/04/2011
[gly2] Recombinant human glucagon-like peptide EU/3/01/077 Treatment of Short Bowel Syndrome Shire Pharmaceuticals Ireland Limited 11/12/2001 Revestive
EU/1/12/787
04/09/2012
Glyceryl tri-(4-phenylbutyrate) EU/3/10/733 Treatment of carbamoyl-phosphate synthase-1 deficiency Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/1/15/1062
01/12/2015
Glyceryl tri-(4-phenylbutyrate) EU/3/10/734 Treatment of ornithine carbamoyltransferase deficiency Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/1/15/1062
01/12/2015
Glyceryl tri-(4-phenylbutyrate) EU/3/10/735 Treatment of citrullinaemia type 1 Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/1/15/1062
01/12/2015
Glyceryl tri-(4-phenylbutyrate) EU/3/10/736 Treatment of argininosuccinic aciduria Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/1/15/1062
01/12/2015
Glyceryl tri-(4-phenylbutyrate) EU/3/10/737 Treatment of hyperargininaemia Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/1/15/1062
01/12/2015
Glyceryl tri-(4-phenylbutyrate) EU/3/10/738 Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Horizon Pharma Ireland Limited 10/06/2010 Ravicti
EU/1/15/1062
01/12/2015
Glyceryl tri-(4-phenylbutyrate) EU/3/10/739 Treatment of citrullinaemia type 2 Horizon Pharma Ireland Limited 10/06/2010
Glycosylation independent lysosomal targeting tagged recombinant human acid alpha glucosidase EU/3/11/921 Treatment of glycogen storage disease type II (Pompe's disease) BioMarin Europe Ltd. 27/10/2011
Glycyl-L-2-methylprolyl-L-glutamic acid EU/3/15/1529 Treatment of fragile X syndrome QRC Consultants Ltd 28/07/2015
Glycyl-L-2-methylprolyl-L-glutamic acid EU/3/15/1534 Treatment of Rett syndrome QRC Consultants Ltd 10/08/2015
Granulocyte macrophage colony stimulating factor EU/3/13/1147 Treatment of pulmonary alveolar proteinosis Savara ApS 17/07/2013
Guanabenz EU/3/09/625 Treatment of traumatic spinal cord injury Acure Pharma AB 29/04/2009
Gusperimus trihydrochloride EU/3/01/034 Treatment of Wegener’s granulomatosis Nordic Group B.V. 29/03/2001
Haematopoietic stem cells modified with a lentiviral vector containing the CD18 gene EU/3/16/1753 Treatment of leukocyte adhesion deficiency type I Consorcio Centro de Investigación Biomédica en Red M.P. 14/10/2016
Halofuginone Hydrobromide EU/3/01/074 Treatment of systemic sclerosis PPD Global Ltd 11/12/2001
Halofuginone Hydrobromide EU/3/12/988 Treatment of Duchenne muscular dystrophy Biological Consulting Europe Ltd 26/04/2012
H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt EU/3/07/521 Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients Vaxon Biotech 18/12/2007
H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 EU/3/05/292 Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Auris Medical Limited 16/06/2005
Heat-killed Mycobacterium obuense (whole cell) EU/3/14/1385 Treatment of pancreatic cancer Immodulon Therapeutics Ltd 16/12/2014
Heat-killed Mycobacterium vaccae (whole cell) EU/3/10/786 Treatment of tuberculosis Immodulon Therapeutics Ltd 20/09/2010
Heparin sodium EU/3/06/371 Treatment of cystic fibrosis Ockham Biotech Limited 22/05/2006
Heparin-activated recombinant human fibroblast growth factor 1 (on a biodegradable device made from alpha-calcium sulphate hemihydrate) EU/3/10/754 Treatment of traumatic spinal cord injury Bioarctic AB 27/07/2010
Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 EU/3/06/407 Prevention of necrotizing enterocolitis Dr Michael Moore 31/10/2006
Hepatitis C Immunoglobulin EU/3/05/295 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 08/07/2005
Herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes EU/3/03/168 Adjunctive treatment in hematopoietic cell transplantation MolMed S.p.A. 20/10/2003 Zalmoxis
EU/1/16/1121
23/08/2016
Herpes simplex type 1 virus containing cellular B-myb gene as tumour-specific promoter EU/3/14/1412 Treatment of pancreatic cancer Karcinolys S.A.S 15/01/2015
Herpes simplex virus lacking infected cell protein 34.5 EU/3/03/153 Treatment of glioma Virttu Biologics Limited 09/07/2003
Heterologous human adult liver derived stem cells EU/3/07/506 Treatment of Crigler-Najjar syndrome Promethera Biosciences 29/11/2007
Heterologous human adult liver derived stem cells EU/3/08/530 Treatment of ornithinine transcarbamylase deficiency Promethera Biosciences 04/02/2008
Heterologous human adult liver-derived progenitor cells EU/3/13/1161 Treatment of carbamoyl-phosphate synthase-1 deficiency Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1162 Treatment of citrullinaemia type 1 Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1163 Treatment of argininosuccinic aciduria Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1164 Treatment of hyperargininaemia Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1165 Treatment of N-acetylglutamate synthetase (NAGS) deficiency Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1166 Treatment of citrullinaemia type 2 Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived progenitor cells EU/3/13/1167 Treatment of ornithine translocase deficiency (hyperornithinaemia-hyperammonaemia homocitrullinuria (HHH) syndrome) Promethera Biosciences 17/07/2013
Heterologous human adult liver-derived stem cells EU/3/11/904 Treatment of ornithine transcarbamylase deficiency Fresenius Medical Care Deutschland GmbH 27/09/2011
Heterologous human adult liver-derived stem cells EU/3/12/971 Treatment of carbamoyl-phosphate synthase-1 deficiency Fresenius Medical Care Deutschland GmbH 05/03/2012
Heterologous human adult liver-derived stem cells EU/3/12/983 Treatment of acute liver failure Fresenius Medical Care Deutschland GmbH 26/04/2012
Hexasodium phytate EU/3/12/1026 Treatment of calciphylaxis Laboratoris Sanifit S.L. 17/07/2012
Histamine dihydrochloride EU/3/05/272 Treatment of acute myeloid leukaemia Meda AB 11/04/2005 Ceplene
EU/1/08/477
09/10/2008
HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor EU/3/04/202 Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients Cellcure A/S 21/06/2004
HLA-B27 derived peptide (amino acid 125-138) EU/3/04/219 Treatment of autoimmune uveitis Dr Gerhild Wildner 02/09/2004
H-Phe-Ser-Arg-Tyr-Ala-Arg-OH acetate EU/3/16/1662 Treatment of amyotrophic lateral sclerosis QRC Consultants Ltd 30/05/2016
Human allogeneic bone marrow derived osteoblastic-like cells EU/3/13/1176 Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 05/08/2013
Human allogeneic bone-marrow-derived osteoblastic cells EU/3/15/1533 Treatment of osteogenesis imperfecta Bone Therapeutics SA 10/08/2015
Human Alpha1-Proteinase Inhibitor (respiratory use) EU/3/01/044 Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency CSL Behring GmbH 09/07/2001
Human anti-intercellular adhesion molecule1 monoclonal antibody EU/3/08/600 Treatment of multiple myeloma BioInvent International AB 20/01/2009
Human apotransferrin EU/3/12/1027 Treatment of congenital hypotransferrinaemia Sanquin Plasma Products B.V. 17/07/2012
Human autologous bone-forming cells derived from bone marrow stem cells EU/3/07/490 Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 29/10/2007
Human autologous mesenchymal adult stem cells extracted from adipose tissue EU/3/05/303 Treatment of anal fistula TiGenix S.A.U. 26/08/2005
Human coagulation factor X EU/3/07/471 Treatment of hereditary factor X deficiency Bio Products Laboratory 17/09/2007 Coagadex
EU/1/16/1087
18/03/2016
Human cytomegalovirus immunoglobulin EU/3/06/408 Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Biotest Pharma GmbH 31/10/2006
Human donor haematopoietic stem and progenitor cells that have been treated ex vivo with the protein transduction domain of the HIV-1 transactivation protein fused to MYC transcription factor EU/3/16/1817 Treatment in haematopoietic stem cell transplantation Coté Orphan Consulting UK Limited 12/01/2017
Human embryonic stem-cell-derived retinal pigment epithelial cells EU/3/11/874 Treatment of Stargardt’s disease Astellas Pharma Europe B.V. 21/06/2011
Human erythrocytes encapsulating inositol hexaphosphate EU/3/12/1008 Treatment of sickle cell disease ERYtech Pharma S.A. 04/07/2012
Human haptoglobin EU/3/11/936 Treatment of sickle cell disease Bio Products Laboratory Ltd 09/12/2011
Human hemin EU/3/13/1149 Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Borders Technology Management Ltd 17/07/2013
Human hepatoma cell line HepaRG in bioartificial liver EU/3/16/1818 Treatment of acute liver failure Hep-Art Medical Devices BV 12/01/2017
Human heterologous liver cells (for infusion) EU/3/06/362 Treatment of acute liver failure Promethera Biosciences 11/04/2006
Human heterologous liver cells (for infusion) EU/3/07/470 Treatment of ornithine-transcarbamylase deficiency Promethera Biosciences 14/09/2007
Human heterologous liver cells (for infusion) EU/3/10/818 Treatment of citrullinaemia type 1 Promethera Biosciences 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/819 Treatment of hyperargininaemia Promethera Biosciences 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/820 Treatment of argininosuccinic aciduria Promethera Biosciences 17/12/2010
Human heterologous liver cells (for infusion) EU/3/10/821 Treatment of carbamoyl-phosphate synthase-1 deficiency Promethera Biosciences 17/12/2010
Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein EU/3/05/334 Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) Edimer Ltd 14/12/2005
Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) EU/3/06/417 Treatment of renal cell carcinoma Immunservice GmbH 27/10/2006
Human MHC non-restricted cytotoxic T-cell line EU/3/09/696 Treatment of ovarian cancer Galileo Research S.r.l. 30/11/2009
Human monoclonal antibody against activin A EU/3/16/1779 Treatment of fibrodysplasia ossificans progressiva Regeneron Ireland 18/11/2016
Human monoclonal antibody against CD4 EU/3/04/198 Treatment of cutaneous T-cell lymphoma TenX Biopharma Ltd 14/04/2004
Human monoclonal antibody against Fas ligand EU/3/12/956 Treatment of pemphigus PinCell s.r.l. 09/02/2012
Human monoclonal antibody against human interleukin 13 EU/3/13/1205 Treatment of eosinophilic oesophagitis Novartis Europharm Limited 13/11/2013
Human monoclonal antibody against Pseudomonas aeruginosa IATS-O1 EU/3/09/705 Treatment of pneumonia caused by serotype O1 Pseudomonas aeruginosa Envestia Limited 28/01/2010
Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 EU/3/06/381 Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa Envestia Limited 29/06/2006
Human monoclonal antibody targeting Staphylococcus aureus alpha-toxin EU/3/12/968 Treatment of pneumonia caused by Staphylococcus aureus Envestia Limited 05/03/2012
Human monoclonal IgG1 antibody against tissue factor pathway inhibitor EU/3/16/1752 Treatment of haemophilia A Pfizer Limited 14/10/2016
Human/murine chimeric monoclonal antibody against endoglin EU/3/16/1648 Treatment of soft tissue sarcoma Tracon Pharma Limited 28/04/2016
Human normal immunoglobulin EU/3/17/1866 Treatment in solid organ transplantation Hôpital Foch 20/04/2017
Human papilloma virus type 16 E6/E7 synthetic long peptides EU/3/07/520 Treatment of epithelial neoplasia of the vulva positive for human papilloma virus ISA Therapeutics B.V. 20/12/2007
Human plasma-derived alpha-1 proteinase inhibitor EU/3/15/1455 Treatment of graft-versus-host disease Kamada BioPharma Limited 19/03/2015
Human plasmin EU/3/10/834 Treatment of acute peripheral arterial occlusion Grifols Deutschland GmbH 23/02/2011
Human plasminogen EU/3/07/461 Treatment of ligneous conjunctivitis Kedrion S.p.A. 03/08/2007
Human plasminogen EU/3/15/1511 Treatment of plasminogen deficiency ProMetic BioTherapeutics Ltd 28/07/2015
Human platelet antigen-1a immunoglobulin EU/3/11/922 Prevention of fetal and neonatal alloimmune thrombocytopenia due to human platelet antigen-1a incompatibility Prophylix Pharma AS 27/10/2011
Human reovirus type 3 Dearing strain EU/3/15/1469 Treatment of ovarian cancer Oncolytics Biotech (UK) Limited 19/03/2015
Human reovirus type 3 Dearing strain EU/3/15/1477 Treatment of pancreatic cancer Oncolytics Biotech (UK) Limited 24/04/2015
Human Staphylococcus aureus immunoglobulin EU/3/05/319 Treatment of Staphylococcus aureus bacteremia Biotest Pharma GmbH 28/10/2005
Human telomerase reverse transcriptase peptide (611-626) EU/3/06/384 Treatment of pancreatic cancer Gemvax A/S 25/07/2006
Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys EU/3/09/677 Treatment of acute lung injury Apeptico Forschung und Entwicklung GmbH 08/10/2009
Humanised anti-alpha ? beta 6 monoclonal antibody EU/3/14/1301 Treatment of idiopathic pulmonary fibrosis Biogen Idec Limited 29/07/2014
Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein EU/3/05/290 Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck Viventia Biotech (EU) Limited 20/06/2005
Humanised anti-CD37 monoclonal antibody conjugated to maytansinoid DM1 EU/3/15/1494 Treatment of diffuse large B-cell lymphoma Voisin Consulting S.A.R.L. 21/05/2015
Humanised anti-folate receptor 1 monoclonal antibody conjugated to maytansinoid DM4 EU/3/15/1458 Treatment of ovarian cancer ImmunoGen Europe Limited 19/03/2015
Humanised anti-IL-6 receptor monoclonal antibody EU/3/16/1680 Treatment of neuromyelitis optica spectrum disorders Chugai Pharma Europe Ltd 27/06/2016
Humanised Fc engineered monoclonal antibody against CD19 EU/3/14/1286 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma MorphoSys AG 04/07/2014
Humanised Fc engineered monoclonal antibody against CD19 EU/3/14/1424 Treatment of diffuse large B-cell lymphoma MorphoSys AG 15/01/2015
Humanised fusion protein consisting of extracellular domain of CD24 linked to IgG1 Fc domain EU/3/15/1575 Prevention of graft-versus-host disease Enpharma Ltd 11/11/2015
Humanised IgG1 kappa antibody against serum amyloid A and AL amyloid EU/3/13/1100 Treatment of amyloid light-chain amyloidosis Prothena Therapeutics Limited 08/02/2013
Humanised IgG1 monoclonal antibody against human eotaxin-2 EU/3/14/1371 Treatment of systemic sclerosis FGK Representative Service GmbH 19/11/2014
Humanised IgG1 monoclonal antibody against human KIR3DL2 EU/3/14/1322 Treatment of cutaneous T-cell lymphoma Innate Pharma S.A. 22/08/2014
Humanised IgG1 monoclonal antibody against the receptor-binding site of human placental growth factor EU/3/16/1819 Treatment of medulloblastoma Oncurious NV 12/01/2017
Humanised IgG4 monoclonal antibody against extracellular tau EU/3/15/1522 Treatment of progressive supranuclear palsy Biogen Idec Limited 28/07/2015
Humanised IgG4 monoclonal antibody against total complement component 1, subcomponent s EU/3/16/1609 Treatment of autoimmune haemolytic anaemia Assign Group Development UK Ltd 17/02/2016
Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 EU/3/09/638 Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation Opsona Therapeutics Limited 15/05/2009
Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 EU/3/17/1837 Treatment of myelodysplastic syndromes Opsona Therapeutics Limited 27/02/2017
Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 EU/3/17/1838 Treatment of pancreatic cancer Opsona Therapeutics Limited 27/02/2017
Humanised monoclonal antibody against CD38 EU/3/14/1268 Treatment of plasma cell myeloma Sanofi-Aventis groupe 29/04/2014
Humanised monoclonal antibody against myostatin EU/3/13/1105 Treatment of Duchenne muscular dystrophy Pfizer Limited 08/02/2013
Humanised monoclonal antibody against P-selectin EU/3/12/1034 Treatment of sickle cell disease Novartis Europharm Limited 09/08/2012
Humanised monoclonal antibody of the IgG4 kappa isotype targeting CD47 EU/3/15/1582 Treatment of acute myeloid leukaemia ICON Clinical Research Limited 11/11/2015
Humanised monoclonal antibody targeting interleukin-15 EU/3/16/1681 Treatment of eosinophilic oesophagitis Dr Alain Vicari 27/06/2016
Humanised monoclonal antibody to the folate receptor alpha EU/3/08/535 Treatment of ovarian cancer Eisai Europe Limited 01/04/2008
Humanised monoclonal IgG4 antibody against tissue factor pathway inhibitor EU/3/12/1052 Treatment of haemophilia A Novo Nordisk A/S 10/10/2012
Humanised monoclonal modified IgG4 antibody with bispecific structure targeting factors IX, IXa, X and Xa EU/3/13/1221 Treatment of haemophilia A Roche Registration Limited 18/12/2013
Humanised recombinant IgG4 anti-human tau antibody EU/3/16/1649 Treatment of progressive supranuclear palsy AbbVie Ltd 28/04/2016
Humanised recombinant monoclonal antibody against epidermal growth factor receptor conjugated to maleimidocaproyl monomethylauristatin F EU/3/14/1305 Treatment of glioma AbbVie Ltd 29/07/2014
Humanised single chain monoclonal antibody against CD37 EU/3/12/1083 Treatment of chronic lymphocytic leukaemia Aptevo Europe Limited 06/12/2012
Humanized Agonistic Anti-CD28 Monoclonal Antibody EU/3/05/276 Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) TeGenero AG 11/04/2005
Hydrocinnamate-[Orn-Pro-dCha-Trp-Arg]acetate EU/3/15/1527 Treatment of amyotrophic lateral sclerosis PBS Regulatory Consulting Group Limited 28/07/2015
Hydrocortisone (modified release tablet) EU/3/05/296 Treatment of congenital adrenal hyperplasia Diurnal Limited 27/07/2005
Hydrocortisone (modified release tablet) EU/3/06/372 Treatment of adrenal insufficiency Shire Services BVBA 22/05/2006 Plenadren
EU/1/11/715
14/11/2011
Hydrocortisone (modified release tablet) EU/3/07/441 Treatment of adrenal insufficiency Diurnal Limited 20/03/2007
Hydroxychloroquine EU/3/16/1820 Treatment of antiphospholipid syndrome Centre Hospitalier Universitaire d'Angers 12/01/2017
Hydroxy-propyl-beta-cyclodextrin EU/3/11/895 Treatment of Niemann-Pick disease, type C Medical Need Europe AB 30/08/2011
Hypothiocyanite / lactoferrin EU/3/09/654 Treatment of cystic fibrosis Alaxia 24/07/2009
Ibrutinib EU/3/13/1203 Treatment of diffuse large B-cell lymphoma Janssen-Cilag International NV 13/11/2013
Ibrutinib EU/3/13/1212 Treatment of follicular lymphoma Janssen-Cilag International NV 18/12/2013
Ibrutinib EU/3/14/1264 Treatment of lymphoplasmacytic lymphoma Janssen-Cilag International NV 29/04/2014 IMBRUVICA
EU/1/14/945
07/07/2015
Ibrutinib EU/3/15/1541 Treatment of marginal zone lymphoma Janssen-Cilag International NV 10/08/2015
Ibrutinib EU/3/16/1780 Treatment of graft-versus-host disease Janssen-Cilag International NV 18/11/2016
Ibudilast EU/3/16/1801 Treatment of amyotrophic lateral sclerosis MediciNova (Europe) Limited 12/12/2016
Ibutamoren mesilate EU/3/17/1882 Treatment of growth hormone deficiency Richardson Associates Regulatory Affairs Ltd 20/06/2017
Icatibant acetate EU/3/03/133 treatment of angioedema Shire Orphan Therapies GmbH 17/02/2003 Firazyr
EU/1/08/461
15/07/2008
Idebenone EU/3/01/062 Treatment of Friedreich’s ataxia Laboratoires Takeda 20/11/2001
Idebenone EU/3/04/189 Treatment of Friedreich’s ataxia Santhera Pharmaceuticals (Deutschland) GmbH 08/03/2004
Idebenone EU/3/07/434 Treatment of Leber's hereditary optic neuropathy Santhera Pharmaceuticals (Deutschland) GmbH 15/02/2007 Raxone
EU/1/15/1020
10/09/2015
Idebenone EU/3/07/437 Treatment of Duchenne muscular dystrophy Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2007
IL-12-secreting dendritic cells, loaded with autologous tumour lysate EU/3/12/1058 Treatment of glioma Activartis Biotech GmbH 08/11/2012
Imatinib EU/3/14/1357 Treatment of acute respiratory distress syndrome Exvastat Limited 19/11/2014
Imetelstat sodium EU/3/15/1593 Treatment of myelofibrosis Janssen-Cilag International NV 14/12/2015
Imexon EU/3/05/341 Treatment of ovarian cancer ICON Clinical Research (U.K.) Limited 23/12/2005
Immortalised human C3A hepatoblastoma cells EU/3/13/1143 Treatment of acute liver failure Vital Therapies Limited 19/06/2013
Immunoglobulin G1, anti-(human tumour-associated calcium signal transducer 2)(human-Mus musculus monoclonal hRS7 heavy chain), disulfide with human-Mus musculus monoclonal hRS7 k-chain, dimer, hexakis(thioether) with (4S)-4-[[[[4-[[(2S)-2-(4-aminobutyl)-2-[[2-[2-[[26-[4-[[[[4-[(3-mercapto-2,5-dioxo-1-pyrrolidinyl)methyl]cyclohexyl]carbonyl]amino]methyl]-1H-1,2,3-triazol-1-yl]-3,6,9,12,15,18,21,24-octaoxahexacos-1-yl]amino]-2-oxoethoxy]acetyl]amino]-1-oxoethyl]amino]phenyl]methoxy]carbonyl]oxy]-4,11-diethyl-9-hydroxy-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14(4H,12H)-dione EU/3/14/1343 Treatment of pancreatic cancer Immunomedics GmbH 15/10/2014
Inebilizumab EU/3/17/1856 Treatment of neuromyelitis optica spectrum disorders AstraZeneca AB 20/03/2017
Inecalcitol EU/3/13/1223 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Hybrigenics SA 16/01/2014
Inecalcitol EU/3/15/1523 Treatment of acute myeloid leukaemia Hybrigenics SA 28/07/2015
Inolimomab EU/3/01/028 Treatment of Graft versus Host Disease Jazz Pharmaceuticals France SAS 05/03/2001
Inotuzumab ozogamicin EU/3/13/1127 Treatment of B-cell acute lymphoblastic leukaemia Pfizer Limited 07/06/2013 Besponsa
EU/1/17/1200
03/07/2017
Insulin human EU/3/15/1532 Treatment of short bowel syndrome Sirius Regulatory Consulting Limited 10/08/2015
Interferon alfa-n3 EU/3/15/1568 Treatment of Middle East respiratory syndrome NV Hemispherx BioPharma Europe 11/11/2015
Interferon beta EU/3/07/505 Treatment of acute lung injury Faron Pharmaceuticals Limited 29/11/2007
Interferon gamma EU/3/07/491 Treatment of idiopathic pulmonary fibrosis mondoBIOTECH Laboratories AG 29/10/2007
Interferon gamma EU/3/11/935 Treatment of Friedreich's ataxia Horizon Pharma Ireland Limited 09/12/2011
Iodine (131I) chlorotoxin EU/3/07/492 Treatment of glioma Eisai Europe Limited 22/10/2007
Iodine (131I) iobenguane EU/3/07/525 Treatment of neuroblastoma Molecular Insight Limited 31/01/2008
Iodine (131I) murine IgG1 monoclonal antibody against CD276 EU/3/17/1839 Treatment of neuroblastoma Y-mAbs Therapeutics A/S 27/02/2017
Isavuconazonium sulfate EU/3/14/1276 Treatment of mucormycosis Basilea Medical Ltd 04/06/2014 Cresemba
EU/1/15/1036
19/10/2015
Isavuconazonium sulfate EU/3/14/1284 Treatment of invasive aspergillosis Basilea Medical Ltd 04/07/2014 Cresemba
EU/1/15/1036
19/10/2015
Isofagomine tartrate EU/3/07/493 Treatment of Gaucher Disease Amicus Therapeutics UK Ltd 23/10/2007
Itraconazole EU/3/17/1901 Treatment of naevoid basal-cell carcinoma syndrome (Gorlin syndrome) Mayne Pharma UK Limited 23/08/2017
Ivosidenib EU/3/16/1802 Treatment of acute myeloid leukaemia QRC Consultants Ltd 12/12/2016
Ixazomib EU/3/12/1060 Treatment of systemic light chain amyloidosis Takeda Pharma A/S 08/11/2012
Ketoconazole EU/3/12/965 Treatment of Cushing’s syndrome Laboratoire HRA Pharma 23/04/2012 Ketoconazole HRA
EU/1/14/965
21/11/2014
Ketoconazole EU/3/12/1031 Treatment of Cushing’s syndrome Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare 09/08/2012
Ketoconazole EU/3/17/1857 Treatment of granulosa cell tumours Grupo Español de Tumores Huérfanos e Infrecuentes (GETHI) 20/03/2017
l, 1'-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane EU/3/04/227 Treatment to mobilize progenitor cells prior to stem cell transplantation Genzyme Europe B.V. 20/10/2004 Mozobil
EU/1/09/537
04/08/2009
Lactobacillus acidophilus and Bifidobacterium bifidum EU/3/13/1213 Prevention of necrotising enterocolitis Laboratorio Farmaceutico S.I.T. s.r.l. 18/12/2013
Lactobacillus reuteri EU/3/15/1436 Prevention of necrotising enterocolitis Infant Bacterial Therapeutics AB 12/02/2015
Lanreotide acetate EU/3/15/1514 Treatment of autosomal dominant polycystic kidney disease Prof. Dr R.T.Gansevoort 10/08/2015
L-asparaginase encapsulated in erythrocytes EU/3/06/409 Treatment of acute lymphoblastic leukaemia ERYtech Pharma S.A. 27/10/2006
L-asparaginase encapsulated in erythrocytes EU/3/09/633 Treatment of pancreatic cancer ERYtech Pharma S.A. 15/05/2009
L-asparaginase encapsulated in erythrocytes EU/3/13/1106 Treatment of acute myeloid leukaemia ERYtech Pharma S.A. 08/02/2013
L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-, complex with keyhole limpet haemocyanin EU/3/11/923 Treatment of glioma Orphix Consulting GmbH 27/10/2011
Lenalidomide EU/3/07/494 Treatment of chronic lymphocytic leukaemia Celgene Europe Limited 19/11/2007
Lenalidomide EU/3/11/868 Treatment of diffuse large B-cell lymphoma Celgene Europe Limited 13/05/2011
Lenalidomide EU/3/11/924 Treatment of mantle cell lymphoma Celgene Europe Limited 27/10/2011 Revlimid
EU/1/07/391
12/07/2016
Lenalidomide EU/3/12/1097 Treatment of follicular lymphoma Celgene Europe Limited 24/01/2013
Lenalidomide EU/3/15/1473 Treatment of marginal zone lymphoma Celgene Europe Limited 24/04/2015
Lentiviral vector carrying the Fanconi anaemia-A (FANCA) gene EU/3/10/822 Treatment of Fanconi anaemia type A Consorcio Centro de Investigación Biomédica en Red M.P. 17/12/2010
Lentiviral vector containing the human ABCA4 gene EU/3/09/720 Treatment of Stargardt's disease Sanofi-Aventis groupe 02/02/2010
Lentiviral vector containing the human liver and erythroid pyruvate kinase (PKLR) gene EU/3/14/1330 Treatment of pyruvate kinase deficiency Consorcio Centro de Investigación Biomédica en Red M.P. 22/08/2014
Lentiviral vector containing the human MYO7A gene EU/3/10/727 Treatment of retinitis pigmentosa in Usher syndrome 1B Sanofi-Aventis groupe 23/03/2010
Lenvatinib EU/3/13/1119 Treatment of follicular thyroid cancer Eisai Europe Limited 26/04/2013 Lenvima
EU/1/15/1002
01/06/2015
Lenvatinib EU/3/13/1121 Treatment of papillary thyroid cancer Eisai Europe Limited 26/04/2013 Lenvima
EU/1/15/1002
01/06/2015
Lenvatinib EU/3/15/1460 Treatment of hepatocellular carcinoma Eisai Europe Limited 19/03/2015
Letermovir EU/3/12/999 Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity Merck Sharp & Dohme Limited 06/06/2012
Leuprorelin acetate EU/3/16/1821 Treatment of congenital hypogonadotropic hypogonadism Stichting Centre for Human Drug Research (CHDR) 12/01/2017
Levamisol hydrochloride EU/3/05/324 Treatment of nephrotic syndrome ACE Pharmaceuticals BV 28/10/2005
Levoglutamide EU/3/12/1011 Treatment of sickle cell disease Emmaus Medical Europe Limited 04/07/2012
Lipid-complexed cisplatin EU/3/13/1169 Treatment of osteosarcoma Richardson Associates Regulatory Affairs Ltd 05/08/2013
Lipopolysaccharide of Ochrobactrum intermedium EU/3/11/941 Prevention of sepsis in at-risk premature infants of less than or equal to 32 weeks of gestational age Diomune S.L. 11/01/2012
Liposomal combination of cytarabine and daunorubicin EU/3/11/942 Treatment of acute myeloid leukaemia Jazz Pharmaceuticals Ireland Ltd 11/01/2012
Lisuride hydrogen maleate EU/3/11/869 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Sinoxa Pharma GmbH 13/05/2011
Lithium citrate tetrahydrate (in reverse-micelle formulation) EU/3/09/706 Treatment of Huntington's disease Medesis Pharma 28/01/2010
Live attenuated Listeria monocytogenes bioengineered with a chimeric human epidermal growth factor receptor 2 fused to a truncated form of the Lm protein listeriolysin O EU/3/15/1595 Treatment of osteosarcoma Coté Orphan Consulting UK Limited 14/12/2015
Live attenuated Listeria monocytogenes delta actA/delta inlB strain expressing human mesothelin EU/3/15/1594 Treatment of malignant mesothelioma Aduro Biotech Holdings, Europe B.V. 14/12/2015
Live attenuated Listeria monocytogenes delta actA/delta inlB strain expressing human mesothelin EU/3/15/1603 Treatment of pancreatic cancer Aduro Biotech Holdings, Europe B.V. 11/01/2016
Live attenuated Listeria monocytogenes transfected with plasmids encoding the HPV-16E7 protein fused to a truncated fragment of the Lm protein listeriolysin O EU/3/15/1602 Treatment of anal cancer Dr Ulrich Granzer 11/01/2016
Live-attenuated non-replicative Pseudomonas aeruginosa strain expressing large T antigen of Merkel cell polyomavirus EU/3/16/1781 Treatment of Merkel cell carcinoma APCure SAS 18/11/2016
L-Lysine-N-acetyl-L-cysteinate EU/3/01/026 Treatment of cystic fibrosis LABORATOIRES SMB SA 14/02/2001
Lomitapide EU/3/10/823 Treatment of familial chylomicronaemia Aegerion Pharmaceuticals Limited 17/12/2010
Lonafarnib EU/3/13/1225 Treatment of hepatitis delta virus infection Eiger Biopharmaceuticals Europe Limited 16/01/2014
Low molecular weight dextran sulfate EU/3/09/669 Prevention of graft rejection during pancreatic islet transplantation TikoMed AB 09/10/2009
Low molecular weight dextran sulfate EU/3/11/883 Treatment for mobilisation of progenitor cells prior to stem cell transplantation TikoMed AB 05/08/2011
L-Pyr-L-Glu-L-Gln-L-Leu-L-Glu-L-Arg-L-Ala-L-Leu-L-Asn-L-Ser-L-Ser EU/3/13/1191 Treatment of sarcoidosis Araim Pharma Europe Ltd 07/10/2013
L-Pyr-L-Glu-L-Gln-L-Leu-L-Glu-L-Arg-L-Ala-L-Leu-L-Asn-L-Ser-L-Ser EU/3/16/1721 Prevention of graft loss in pancreatic islet transplantation Araim Pharma Europe Ltd 29/08/2016
L-selenomethionine EU/3/16/1782 Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
L-threo-3,4-dihydroxyphenylserine EU/3/07/465 Treatment of orthostatic hypotension in patients with pure autonomic failure H. Lundbeck A/S 02/08/2007
L-threo-3,4-dihydroxyphenylserine EU/3/07/466 Treatment of orthostatic hypotension in patients with multiple system atrophy H. Lundbeck A/S 02/08/2007
Lurbinectedin EU/3/12/1053 Treatment of ovarian cancer Pharma Mar S.A. 10/10/2012
Lutetium (177Lu) edotreotide EU/3/14/1269 Treatment of gastro-entero-pancreatic neuroendocrine tumours ITM Solucin GmbH 04/06/2014
Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide EU/3/07/523 Treatment of gastro-entero-pancreatic neuroendocrine tumours Advanced Accelerator Applications 31/01/2008 Lutathera
EU/1/17/1226
28/09/2017
Lutetium-177(3+),S2,S7-cyclo[N-{4,7,10-tricarboxymethyl-1,4,7,10-tetraaza-cyclododecan-1-yl-acetyl}-4-chloro-L-phenylalanyl-D-cysteinyl-4-[(4S)-2,6-dioxo-1,3-diazinane-4-carboxamido]-L-phenylalanyl-4-(carbamoylamino)-D-phenylalanyl-L-lysyl-L-threonyl-L-cysteinyl-D-tyrosinamide] EU/3/16/1754 Treatment of gastro-entero-pancreatic neuroendocrine tumours Ipsen Pharma 14/10/2016
Macitentan EU/3/09/707 Treatment of idiopathic pulmonary fibrosis Actelion Registration Ltd 28/01/2010
Macitentan EU/3/11/909 Treatment of pulmonary arterial hypertension Actelion Registration Ltd 27/09/2011 Opsumit
EU/1/13/893
27/12/2013
Macromolecular conjugate of heparin sodium on a polymer backbone EU/3/14/1332 Prevention of ischaemia reperfusion injury associated with solid organ transplantation Corline Biomedical AB 22/08/2014
(manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) EU/3/07/522 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Kinesys Consulting Ltd 31/01/2008
Mannitolum EU/3/05/325 Treatment of cystic fibrosis Pharmaxis Pharmaceuticals Limited 07/11/2005 Bronchitol
EU/1/12/760
18/04/2012
Maribavir EU/3/07/519 Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk Shire Pharmaceuticals Ireland Limited 18/12/2007
Maribavir EU/3/13/1133 Treatment of cytomegalovirus disease in patients with impaired cell mediated immunity Shire Pharmaceuticals Ireland Limited 07/06/2013
Marizomib EU/3/14/1295 Treatment of plasma cell myeloma Richardson Associates Regulatory Affairs Ltd 29/07/2014
Masitinib mesilate EU/3/09/684 Treatment of pancreatic cancer AB Science S.A. 28/10/2009
Masitinib mesilate EU/3/16/1722 Treatment of amyotrophic lateral sclerosis AB Science 29/08/2016
Mavoglurant EU/3/12/1046 Treatment of fragile X syndrome Novartis Europharm Limited 10/10/2012
Maytansinoid-conjugated human monoclonal antibody against mesothelin EU/3/12/1073 Treatment of malignant mesothelioma Bayer AG 06/12/2012
Mazindol EU/3/15/1444 Treatment of narcolepsy HAC Pharma 12/02/2015
Mazindol EU/3/15/1547 Treatment of narcolepsy NeuroLifeSciences 09/10/2015
Mecasermin EU/3/05/307 Treatment of primary growth hormone insensitivity syndrome Ipsen Pharma 26/08/2005
Mecasermin rinfabate EU/3/06/399 Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Premacure AB 28/08/2006
Megestrol acetate EU/3/17/1858 Treatment of granulosa cell tumours Grupo Español de Tumores Huérfanos e Infrecuentes (GETHI) 20/03/2017
Melarsoprol EU/3/12/1068 Treatment of African trypanosomiasis Pr. Peter Kennedy 08/11/2012
Melatonin EU/3/12/978 Treatment of perinatal asphyxia Chiesi Farmaceutici S.p.A. 02/04/2012
Melatonin EU/3/16/1682 Treatment of necrotising enterocolitis Therapicon Srl 01/08/2016
Melatonin EU/3/16/1683 Treatment of neonatal sepsis Therapicon Srl 27/06/2016
Melatonin EU/3/16/1755 Treatment of Smith-Magenis syndrome Therapicon Srl 14/10/2016
Melphalan flufenamide EU/3/15/1463 Treatment of plasma cell myeloma Oncopeptides AB 19/03/2015
Mepolizumab EU/3/04/213 Treatment of hypereosinophilic syndrome Glaxo Group Ltd 29/07/2004
Mepolizumab EU/3/13/1116 Treatment of Churg-Strauss Syndrome Glaxo Group Ltd 12/03/2013
Mercaptopurine (oral liquid) EU/3/07/496 Treatment of acute lymphoblastic leukaemia Orbona Pharma Ltd 22/10/2007
Mercaptopurine (oral suspension) EU/3/09/628 Treatment of acute lymphoblastic leukaemia Nova Laboratories Limited 30/04/2009 Xaluprine
EU/1/11/727
13/03/2012
Metastable technetium 99 [99mTc] demogastrin 2 EU/3/06/400 Diagnosis of medullary thyroid carcinoma Biomedica Life Sciences SA 28/08/2006
Metformin EU/3/16/1803 Treatment of progressive myoclonic epilepsy type 2 (Lafora disease) Consorcio Centro de Investigación Biomédica en Red M.P. 12/12/2016
Methotrexate EU/3/16/1723 Treatment of alkaptonuria aimAKU (Associazione Italiana Malati di Alcaptonuria) 29/08/2016
Methotrexate (oral liquid) EU/3/07/495 Treatment of acute lymphoblastic leukaemia Orbona Pharma Ltd 24/10/2007
Methoxsalen EU/3/06/374 Treatment of Graft-versus-Host disease Therakos (UK) Limited 22/05/2006
Methyl 3-((2R)-2-hydroxy-4-(((((S)-1-methoxy-1-oxopropan-2-yl) amino)(phenoxy)phosphoryl)oxy)-3,3-dimethylbutanamido)propanoate EU/3/16/1612 Treatment of pantothenate-kinase-associated neurodegeneration Retrophin Europe Limited 17/02/2016
Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate EU/3/07/518 Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension Bayer AG 20/12/2007 Adempas
EU/1/13/907
31/03/2014
Methyl O-4-O-[2-[2-[2-[2-[[N-[(1R)-1-[[4-(aminoiminomethyl)phenyl]methyl]-2-oxo-2-(1-piperidinyl)ethyl]-N2-[(4-methoxy-2,3,6-trimethylphenyl)sulfonyl]-L-a-asparaginyl-4-aminobutanoyl-N6-[5-[(3aS,4S,6aR)-hexahydro-2-oxo-1H-thieno[3,4-d]imidazol-4-yl]-1-oxopentyl]-L-lysyl]amino]ethoxy]ethoxy]ethoxy]ethyl]-2,3-di-O-methyl-6-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl--D-glucopyranuronosyl-(1->4)-O-2,3,6-tri-O-sulfo-a-D-glucopyranosyl-(1->4)-O-2,3-di-O-methyl-a-L-idopyranuronosyl-(1->4)-3-O-methyl-a-D-glucopyranoside 2,6-bis(hydrogen sulfate) octasodium salt EU/3/11/884 Prevention of ischaemia/reperfusion injury associated with solid organ transplantation Endotis Pharma 05/08/2011
Methylthioninium EU/3/10/804 Treatment of progressive supranuclear palsy TauRx Therapeutics Europe Ltd 26/11/2010
Methylthioninium EU/3/10/805 Treatment of behavioural variant frontotemporal dementia TauRx Therapeutics Europe Ltd 26/11/2010
Methylthioninium EU/3/10/806 Treatment of progressive non-fluent aphasia TauRx Therapeutics Europe Ltd 26/11/2010
Methylthioninium EU/3/10/807 Treatment of frontotemporal dementia with parkinsonism-17 TauRx Therapeutics Europe Ltd 26/11/2010
Metreleptin EU/3/12/1022 Treatment of Familial Partial Lipodystrophy Aegerion Pharmaceuticals Limited 17/07/2012
Metreleptin EU/3/12/1023 Treatment of Barraquer-Simons syndrome Aegerion Pharmaceuticals Limited 17/07/2012
Metreleptin EU/3/12/1024 Treatment of Lawrence syndrome Aegerion Pharmaceuticals Limited 17/07/2012
Metreleptin EU/3/12/1025 Treatment of Berardinelli-Seip syndrome Aegerion Pharmaceuticals Limited 17/07/2012
Metronidazole EU/3/11/875 Treatment of pouchitis Avivia Projects BV 21/06/2011
Mexiletine hydrochloride EU/3/13/1126 Treatment of non-dystrophic myotonia Prof. Michael Hanna 07/06/2013
Mexiletine hydrochloride EU/3/13/1189 Treatment of myotonic disorders Agenzia Industrie Difesa-Stabilimento Chimico Farmaceutico Militare 07/10/2013
Mexiletine hydrochloride EU/3/14/1353 Treatment of myotonic disorders Lupin (Europe) Limited 19/11/2014
Midostaurin EU/3/04/214 Treatment of acute myeloid leukaemia Novartis Europharm Limited 29/07/2004 Rydapt
EU/1/17/1218
20/09/2017
Midostaurin EU/3/10/765 Treatment of mastocytosis Novartis Europharm Limited 04/08/2010 Rydapt
EU/1/17/1218
20/09/2017
Mifamurtide EU/3/16/1699 Treatment of echinococcosis Delta Proteomics SAS 14/07/2016
Mifamurtide EU/3/16/1700 Treatment of hepatocellular carcinoma Delta Proteomics SAS 14/07/2016
Mifepristone EU/3/09/614 Treatment of hypercortisolism (Cushing's syndrome) of endogenous origin EXELGYN 27/02/2009
Mifepristone EU/3/11/925 Treatment of hypercortisolism (Cushing's syndrome) of endogenous origin Dr Ulrich Granzer 27/10/2011
Miglustat EU/3/06/351 Treatment of Niemann-Pick disease, type C Actelion Registration Ltd 16/02/2006 Zavesca
EU/1/02/238
28/01/2009
Milatuzumab EU/3/08/601 Treatment of multiple myeloma Immunomedics GmbH 19/01/2009
Milatuzumab EU/3/08/602 Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 19/01/2009
Milciclib maleate EU/3/12/1059 Treatment of malignant thymoma Tiziana Life Sciences PLC 08/11/2012
Miltefosine EU/3/02/104 Treatment of visceral leishmaniasis Zentaris GmbH 12/06/2002
Miltefosine EU/3/05/282 Treatment of Acanthamoeba keratitis Orpha-Devel Handels und Vertriebs GmbH 27/05/2005
Miltefosine EU/3/08/567 Treatment of cutaneous T-cell lymphoma ExperGen Drug Development GmbH 22/09/2008
Mixture of seven synthetic fragments consisting of p21 RAS peptides EU/3/11/885 Treatment of pancreatic cancer Targovax ASA 05/08/2011
Mixture of two adeno-associated viral vectors of serotype 8 containing the 5'-half sequence of human ABCA4 gene and the 3'-half sequence of human ABCA4 gene EU/3/14/1283 Treatment of Stargardt's disease Fondazione Telethon 04/07/2014
Mixture of two adeno-associated viral vectors of serotype 8 containing the 5'-half sequence of human MYO7A gene and the 3'-half sequence of human MYO7A gene EU/3/14/1282 Treatment of Usher syndrome Fondazione Telethon 04/07/2014
Mixture of two allogeneic human pancreatic cancer cell lines stably transduced with a retroviral vector encoding the murine alpha-(1,3)-galactosyltransferase gene EU/3/12/1048 Treatment of pancreatic cancer European Medical Advisory Services Limited 10/10/2012
Modified adenovirus serotype 5/35 containing a CMV promoter-driven transgene cassette with the human transgenes for a membrane-bound CD40 ligand and full length 4-1BBL EU/3/15/1516 Treatment of pancreatic cancer Lokon Pharma AB 28/07/2015
Modified messenger ribonucleic acid encoding human ornithine transcarbamylase enzyme encapsulated into lipid nanoparticles EU/3/17/1867 Treatment of ornithine transcarbamylase deficiency PhaseRx Ireland, Ltd 20/04/2017
Modified mRNA encoding the UGT1A1 protein EU/3/16/1684 Treatment of Crigler-Najjar syndrome Alexion Europe SAS 27/06/2016
Modified recombinant human C-type natriuretic peptide EU/3/12/1094 Treatment of achondroplasia BioMarin Europe Ltd. 24/01/2013
Mogamulizumab EU/3/11/943 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Kyowa Kirin Limited 11/01/2012
Mogamulizumab EU/3/16/1756 Treatment of cutaneous T-cell lymphoma Kyowa Kirin Limited 14/10/2016
Molgramostim EU/3/16/1685 Treatment of acute respiratory distress syndrome Savara ApS 27/06/2016
Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E EU/3/08/595 Treatment of anaplastic large cell lymphoma Takeda Pharma A/S 15/01/2009 ADCETRIS
EU/1/12/794
30/10/2012
Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E EU/3/08/596 Treatment of Hodgkin lymphoma Takeda Pharma A/S 15/01/2009 ADCETRIS
EU/1/12/794
30/10/2012
Moxetumomab pasudotox EU/3/13/1150 Treatment of B-lymphoblastic leukaemia/lymphoma MedImmune Ltd 17/07/2013
Multilamellar microvesicle comprising phosphatidylcholine, sphingomyelin, phosphatidylethanolamine, phosphatidylserine, phospatidylinositol and cholesterol EU/3/11/896 Treatment of cystic fibrosis Lamellar Biomedical Ltd 30/08/2011
Muramyl tripeptide phosphatidyl ethanolamine EU/3/04/206 Treatment of osteosarcoma Takeda France SAS 21/06/2004 Mepact
EU/1/08/502
23/03/2009
Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 EU/3/08/592 Treatment of hairy cell leukaemia MedImmune Ltd 04/12/2008
Murine IgM monoclonal antibody binding to alpha beta T-cell receptor EU/3/13/1113 Prevention of graft rejection following solid organ transplantation CTI Clinical Trial and Consulting Services Europe GmbH 12/03/2013
Murine monoclonal antibody against CD26 EU/3/10/808 Treatment of graft-versus-host disease ADIENNE S.r.l. 26/11/2010
Myriocin EU/3/15/1449 Treatment of retinitis pigmentosa Nanovector s.r.l. 12/02/2015
N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide EU/3/07/478 Treatment of Hodgkin lymphoma Mapi Ireland Limited 14/09/2007
N- (2-Amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide EU/3/07/526 Treatment of acute myeloid leukaemia Mapi Ireland Limited 31/01/2008
N-[(1R)-1-phenylethyl]-6-{1H-pyrazolo[3,4-d]pyrimidin-4-yl}quinazolin-2-amine EU/3/17/1868 Treatment of fragile X syndrome Sentinel Oncology Limited 20/04/2017
N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide EU/3/08/556 Treatment of cystic fibrosis Vertex Pharmaceuticals (Europe) Limited 08/07/2008 Kalydeco
EU/1/12/782
25/07/2012
N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide EU/3/15/1560 Treatment of Duchenne muscular dystrophy FGK Representative Service GmbH 09/10/2015
N-{2-[(6-{[(2,6-dichloro-3,5-dimethoxyphenyl)carbamoyl](methyl)amino}pyrimidin-4-yl)amino]-5-(4-ethylpiperazin-1-yl)phenyl}prop-2-enamide EU/3/17/1902 Treatment of hepatocellular carcinoma Eisai Europe Limited 23/08/2017
N-[2,6-bis(1-methylethyl)phenyl]-N-[[1-[4-(dimethylamino) phenyl]cyclopentyl]methyl]urea, hydrochloride salt EU/3/13/1128 Treatment of adrenocortical carcinoma Millendo Therapeutics Ltd 07/06/2013
N2'-Deacetyl-N2'-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody EU/3/08/593 Treatment of multiple myeloma Biotest AG 03/12/2008
N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl) amino] isonicotinamide hydrochloride EU/3/10/824 Treatment of acute myeloid leukaemia Merck KGaA 17/12/2010
N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride EU/3/09/685 Treatment of pancreatic cancer Merck KGaA 09/11/2009
N-[(2S)-5-{[(1R,2S)-2-(4-fluorophenyl)cyclopropyl]amino}-1-(4-methylpiperazin-1-yl)-1-oxopentan-2-yl]-4-(1H-1,2,3-triazol-1-yl)benzamide, bis-tosylate salt EU/3/16/1757 Treatment of myelofibrosis Imago BioSciences Ltd. 14/10/2016
N-(3-(4-(3-(diisobutylamino)propyl)piperazin-1-yl)propyl)-1H-benzo[d]imidazol-2-amine disulphate salt EU/3/15/1446 Treatment of progressive supranuclear palsy AlzProtect sas 12/02/2015
N-3[[4(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl) oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) EU/3/04/188 Treatment of moderate and severe traumatic brain injury Xytis Pharmaceuticals Limited 23/02/2004
N-(4-(1-cyanocyclopentyl)phenyl)-2-(4-pyridinylmethyl)amino-3-pyridinecarboxamide methanesulfonate EU/3/17/1840 Treatment of gastric cancer Sirius Regulatory Consulting Limited 27/02/2017
N-[4-[[(2-amino-3,4-dihydro-4-oxo-6-pteridinyl)methyl]amino]benzoyl]-D-gamma-glutamyl-(2S)-2-amino-beta-alanyl-L-alpha-aspartyl-L-cysteine to be used with folic acid EU/3/12/1043 Diagnosis of positive folate receptor status in ovarian cancer Voisin Consulting S.A.R.L. 10/09/2012
N-(4-methoxyphenyl)-N,2,6-trimethylfuro[2,3-d]pyrimidin-4-amine EU/3/16/1618 Treatment of glioma FLAG Therapeutics Ltd 17/02/2016
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4 methylpiperazin-1-yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide EU/3/15/1580 Treatment of neuroblastoma Pharma Gateway AB 11/11/2015
N-(5-(6-chloro-2,2-difluorobenzo[d][1,3]dioxol-5-yl)pyrazin-2-yl)-2-fluoro-6-methylbenzamide EU/3/16/1783 Treatment of acute pancreatitis Cogas Pharma Limited 18/11/2016
N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide EU/3/08/568 Treatment of partial deep dermal and full thickness burn wounds Creative Antibiotics Sweden AB 22/09/2008
N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide EU/3/11/897 Treatment of tuberculosis RLM Consulting 30/08/2011
N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt EU/3/09/622 Treatment of acute myeloid leukaemia Daiichi Sankyo Europe GmbH 23/03/2009
N-(6-(2-aminophenylamino)-6-oxohexyl)-4-methylbenzamide EU/3/10/793 Treatment of Friedreich's ataxia Repligen Europe Limited 01/10/2010
N-acetyl-D-mannosamine monohydrate EU/3/16/1635 Treatment of GNE myopathy Escala Therapeutics Ltd 21/03/2016
N-adamantanyl-N'-geranyl-ethylenediamine EU/3/07/479 Treatment of tuberculosis RLM Consulting 14/09/2007
Nafamostat mesilate EU/3/10/782 Treatment of cystic fibrosis Mucokinetica Ltd 20/09/2010
Naloxone hydrochloride dihydrate EU/3/12/1057 Treatment of cutaneous T-cell lymphoma Winston Laboratories Ltd 08/11/2012
Nanobody directed towards the human A1 domain of von Willebrand factor EU/3/09/629 Treatment of thrombotic thrombocytopenic purpura Ablynx N.V. 30/04/2009
Nanoliposomal irinotecan EU/3/11/933 Treatment of pancreatic cancer Baxalta Innovations GmbH 09/12/2011 Onivyde
EU/1/16/1130
18/10/2016
Naproxcinod EU/3/13/1194 Treatment of Duchenne muscular dystrophy NicOx 07/10/2013
Naptumomab estafenatox EU/3/07/480 Treatment of renal cell carcinoma Active Biotech AB 14/09/2007
N-Butyldeoxygalactonojirimycin EU/3/12/1033 Treatment of Fabry disease Actelion Registration Ltd 09/08/2012
N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)-propyl]-carbamoyl}-methyl)-2-[2-(2-fluoro-phenyl)-ethylamino]-N-isobutyl-acetamide EU/3/14/1248 Treatment of optic neuritis Bionure Farma SL 19/02/2014
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/886 Treatment of post-polycythaemia vera myelofibrosis Gilead Sciences International Ltd 05/08/2011
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/887 Treatment of post-essential thrombocythaemia myelofibrosis Gilead Sciences International Ltd 05/08/2011
N-(cyanomethyl)-4-(2-{[4-(morpholin-4-yl)phenyl]amino}pyrimidin-4-yl)benzamide, dihydrochloride salt EU/3/11/888 Treatment of primary myelofibrosis Gilead Sciences International Limited 05/08/2011
Nemorubicin hydrochloride EU/3/05/300 Treatment of hepatocellular carcinoma Nerviano Medical Sciences Srl 28/07/2005
NGR-human tumour necrosis factor EU/3/08/549 Treatment of malignant mesothelioma MolMed S.p.A. 03/06/2008
NGR-human tumour necrosis factor EU/3/09/686 Treatment of hepatocellular carcinoma MolMed S.p.A. 09/11/2009
NH2-Cys-Ser-Ser-Val-Thr-Ala-Trp-Thr-Thr-Gly-Cys-Gly-CONH2 EU/3/11/910 Treatment of traumatic spinal cord injury PHARMAXON 27/09/2011
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/993 Treatment of neurofibromatosis type 2 Sirius Regulatory Consulting Limited 26/04/2012
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/996 Treatment of meningioma Sirius Regulatory Consulting Limited 06/06/2012
N-hydroxy-4-(3-methyl-2-(S)-phenyl-butyrylamino) benzamide EU/3/12/997 Treatment of schwannoma Sirius Regulatory Consulting Limited 06/06/2012
Nilotinib EU/3/06/375 Treatment of chronic myeloid leukaemia Novartis Europharm Limited 22/05/2006 Tasigna
EU/1/07/422
21/11/2007
Nimodipine EU/3/15/1554 Treatment of aneurysmal subarachnoid haemorrhage Dr Stefan Blesse 09/10/2015
Nimorazole EU/3/10/842 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Azanta A/S 23/02/2011
Nimorazole maleate EU/3/12/952 Treatment of squamous cell carcinoma of the head and neck in patients undergoing radiotherapy Conventia Medical LLP 09/02/2012
Nimotuzumab EU/3/08/550 Treatment of pancreatic cancer Oncoscience AG 03/06/2008
Nintedanib EU/3/13/1123 Treatment of idiopathic pulmonary fibrosis Boehringer Ingelheim International GmbH 26/04/2013 Ofev
EU/1/14/979
19/01/2015
Nintedanib EU/3/16/1724 Treatment of systemic sclerosis Boehringer Ingelheim International GmbH 29/08/2016
Nitisinone EU/3/02/096 Treatment of alkaptonuria Swedish Orphan Biovitrum AB (publ) 13/03/2002
Nitric oxide EU/3/13/1209 Treatment of cystic fibrosis Novoteris 18/12/2013
Nitric oxide EU/3/14/1344 Treatment of cystic fibrosis PD Dr med. Joachim Riethmüller 15/10/2014
Nitric oxide EU/3/15/1484 Treatment of cystic fibrosis Biological Consulting Europe Ltd 24/04/2015
Nitroglycerin EU/3/15/1435 Treatment of systemic sclerosis Covis Pharma S.à.r.l. 12/02/2015
[Nle4, D-Phe7]-alpha-melanocyte stimulating hormone EU/3/08/541 Treatment of erythropoietic protoporphyria Clinuvel UK Limited 08/05/2008 Scenesse
EU/1/14/969
29/12/2014
[Nle4, D-Phe7]-alpha-melanocyte stimulating hormone EU/3/08/545 Treatment of congenital erythropoietic porphyria Clinuvel UK Limited 08/05/2008
N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate EU/3/06/401 Treatment of familial amyloid polyneuropathy Pfizer Limited 28/08/2006 Vyndaqel
EU/1/11/717
18/11/2011
N-methyl-4-({4-[({3-methyl(methylsulfonyl)aminopyrazin-2-yl}methyl)amino]-5-(trifluoromethyl)pyrimidin-2-yl}amino)benzamide hydrochloride EU/3/13/1132 Treatment of malignant mesothelioma TMC Pharma Services Ltd 07/06/2013
N-methyl-4-({4-[({3-methyl(methylsulfonyl)aminopyrazin-2-yl}methyl)amino]-5-(trifluoromethyl)pyrimidin-2-yl}amino)benzamide hydrochloride EU/3/14/1429 Treatment of ovarian cancer TMC Pharma Services Ltd 15/01/2015
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/04/242 Treatment of mastocytosis AB Science S.A. 16/11/2004
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/04/251 Treatment of malignant gastro intestinal stromal tumours AB Science S.A. 21/12/2004
N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole EU/3/05/286 Treatment of multiple myeloma Dr Geoffrey Allan 20/06/2005
N,N'-bis(2-mercaptoethyl)isophthalamide EU/3/11/944 Treatment of mercury toxicity NBMI Science Limited 11/01/2012
Norursodeoxycholic acid EU/3/14/1288 Treatment of primary sclerosing cholangitis Dr Falk Pharma GmbH 04/07/2014
N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase EU/3/09/615 Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) Dr Ulrich Granzer 27/02/2009
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/794 Treatment of primary myelofibrosis Sanofi-Aventis groupe 01/10/2010
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/810 Treatment of post-essential thrombocythaemia myelofibrosis Sanofi-Aventis groupe 26/11/2010
N-tert-butyl-3-[(5-methyl-2-{[4-(2-pyrrolidin-1-ylethoxy)phenyl]amino}pyrimidin-4-yl)amino] benzenesulfonamide dihydrochloride monohydrate EU/3/10/811 Treatment of post-polycythaemia vera myelofibrosis Sanofi-Aventis groupe 26/11/2010
Obeticholic acid EU/3/13/1228 Treatment of primary sclerosing cholangitis Intercept Pharma Ltd 16/01/2014
Obinutuzumab EU/3/12/1054 Treatment of chronic lymphocytic leukaemia Roche Registration Limited 10/10/2012 Gazyvaro
EU/1/14/937
24/07/2014
Obinutuzumab EU/3/14/1325 Treatment of diffuse large B-cell lymphoma Roche Registration Limited 22/08/2014
Obinutuzumab EU/3/15/1504 Treatment of follicular lymphoma Roche Registration Limited 19/06/2015 Gazyvaro
EU/1/14/937
15/06/2016
Octenidine dihydrochloride EU/3/10/755 Prevention of late-onset sepsis in premature infants of less than or equal to 32 weeks of gestational age Schülke & Mayr GmbH 27/07/2010
Octreotide acetate (oral use) EU/3/13/1170 Treatment of acromegaly Larode Ltd 05/08/2013
Octreotide chloride (lipid depot solution) EU/3/09/645 Treatment of acromegaly Novartis Europharm Limited 12/06/2009
Odiparcil EU/3/17/1903 Treatment of mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome) Inventiva 23/08/2017
Ofatumumab EU/3/08/581 Treatment of chronic lymphocytic leukaemia Novartis Europharm Limited 07/11/2008 Arzerra
EU/1/10/625
21/04/2010
Olaparib EU/3/07/501 Treatment of ovarian cancer AstraZeneca AB 06/12/2007 Lynparza
EU/1/14/959
18/12/2014
Olaptesed pegol EU/3/14/1364 Treatment of glioma Noxxon Pharma AG 19/11/2014
Olaratumab EU/3/15/1447 Treatment of soft tissue sarcoma Eli Lilly Nederland B.V. 12/02/2015 Lartruvo
EU/1/16/1143
11/11/2016
Oleylphosphocholine EU/3/12/964 Treatment of leishmaniasis Oblita Therapeutics 23/04/2012
Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt EU/3/05/327 Treatment of glioma Oligovax 28/10/2005
Omigapil maleate EU/3/08/540 Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). Santhera Pharmaceuticals (Deutschland) GmbH 08/05/2008
Omigapil maleate EU/3/08/544 Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency Santhera Pharmaceuticals (Deutschland) GmbH 08/05/2008
Oregovomab EU/3/02/109 Treatment of ovarian cancer ViRexx International Corp. Limited 30/07/2002
Ornithine phenylacetate EU/3/11/945 Treatment of acute liver failure Amiculum Consulting Limited 11/01/2012
Osilodrostat EU/3/14/1345 Treatment of Cushing's syndrome Novartis Europharm Limited 15/10/2014
Ovine anti-colchicine polyclonal antibody fragments EU/3/10/825 Treatment of colchicine poisoning Laboratoires SERB 17/12/2010
Ovine-specific immunoglobulin (Fab) fragments raised against Vipera berus venom EU/3/15/1548 Treatment of snakebite envenomation MicroPharm Limited 09/10/2015
Oxalobacter formigenes strain HC-1 EU/3/06/354 Treatment of primary hyperoxaluria OxThera AB 17/02/2006
Oxalobacter formigenes strain HC-1 EU/3/14/1346 Treatment of short bowel syndrome OxThera AB 15/10/2014
Oxymetazoline hydrochloride EU/3/17/1892 Treatment of spinal cord injury RDD Pharma Limited 17/07/2017
Oxytocin EU/3/14/1302 Treatment of Prader-Willi syndrome Maïthé Tauber 29/07/2014
Paclitaxel (aqueous gel) EU/3/10/846 Treatment of oesophagus carcinoma BTG plc 23/02/2011
Paclitaxel (liposomal) EU/3/06/419 Treatment of pancreatic cancer SynCore Biotechnology Europe GmbH 31/10/2006
Paclitaxel (micellar) EU/3/06/422 Treatment of ovarian cancer Oasmia Pharmaceutical AB 18/12/2006
Paclitaxel-succinate-Arg-Arg-Leu-Ser-Tyr-Ser-Arg-Arg-Arg-Phe EU/3/14/1274 Treatment of glioma Orphit 04/06/2014
Palovarotene EU/3/14/1368 Treatment of fibrodysplasia ossificans progressiva Medpace Germany GmbH 19/11/2014
Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) EU/3/04/222 Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency TRX Services Limited 02/09/2004
Panobinostat EU/3/12/1063 Treatment of multiple myeloma Novartis Europharm Limited 08/11/2012 Farydak
EU/1/15/1023
01/09/2015
Paquinimod EU/3/10/836 Treatment of systemic sclerosis Active Biotech AB 23/02/2011
Para-aminosalicylic acid EU/3/10/826 Treatment of tuberculosis Lucane Pharma SA 17/12/2010 Granupas
EU/1/13/896
09/04/2014
Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex EU/3/06/367 Treatment of solitary bone cysts Kuros Biosurgery International AG 11/04/2006
Particles comprised of methacrylic acid based co-polymer, cross-linked with a bi-functional cross-linker, purified to bind L-phenylalanine and L-phenylalanine containing peptides EU/3/16/1784 Treatment of hyperphenylalaninaemia MipSalus ApS 18/11/2016
pasireotide EU/3/09/670 Treatment of acromegaly Novartis Europharm Limited 08/10/2009 Signifor
EU/1/12/753
21/11/2014
pasireotide EU/3/09/671 Treatment of Cushing's disease Novartis Europharm Limited 08/10/2009 Signifor
EU/1/12/753
27/04/2012
Pegylated arginine deiminase EU/3/05/289 Treatment of hepatocellular carcinoma Dr Francesco Izzo 20/06/2005
Pegylated B-domain-deleted sequence-modified recombinant human factor VIII EU/3/10/847 Treatment of haemophilia A Bayer AG 23/02/2011
Pegylated carboxyhaemoglobin EU/3/09/698 Treatment of sickle cell disease Voisin Consulting S.A.R.L. 26/11/2009
Pegylated L-asparaginase EU/3/08/569 Treatment of acute lymphoblastic leukaemia Sigma-Tau Rare Diseases, S.A. 22/09/2008
Pegylated proline-interferon alpha-2b EU/3/11/932 Treatment of polycythaemia vera AOP Orphan Pharmaceuticals AG 09/12/2011
Pegylated recombinant arginine deiminase EU/3/14/1409 Treatment of malignant mesothelioma Designerx Europe Limited c/o Olswang LLP 15/01/2015
Pegylated recombinant Erwinia chrysanthemi L-asparaginase EU/3/11/889 Treatment of acute lymphoblastic leukaemia Jazz Pharmaceuticals France SAS 05/08/2011
Pegylated recombinant factor VIII EU/3/12/995 Treatment of haemophilia A Novo Nordisk A/S 26/04/2012
Pegylated recombinant human hyaluronidase PH20 EU/3/14/1394 Treatment of pancreatic cancer Pharm Research Associates (UK) Limited 16/12/2014
Pegylated recombinant human interleukin-10 EU/3/16/1804 Treatment of pancreatic cancer Larode Ltd 12/12/2016
Pegylated recombinant phenylalanine ammonia lyase EU/3/09/708 Treatment of hyperphenylalaninaemia BioMarin International Limited 28/01/2010
Pentamer formyl thiophene acetic acid EU/3/17/1883 Treatment of Creutzfeldt-Jakob disease NeuroScios GmbH 20/06/2017
Pentetrazol EU/3/15/1569 Treatment of idiopathic hypersomnia Balance Therapeutics, Limited 11/11/2015
Pentosan polysulfate sodium EU/3/14/1359 Treatment of mucopolysaccharidosis type I Plexcera Therapeutics EU Limited 19/11/2014
Pentosan polysulfate sodium EU/3/16/1663 Treatment of interstitial cystitis NextraResearch S.r.l. 30/05/2016
Pentosan polysulfate sodium EU/3/16/1822 Treatment of interstitial cystitis HV-Polysaccharides GmbH & Co. KG 12/01/2017
Peptide 144 TGF- 1 inhibitor (TSLDASIIWAMMQN) EU/3/05/326 Treatment of systemic sclerosis Digna Biotech S.L. 28/10/2005
Peptide 144 TGF- 1 inhibitor (TSLDASIIWAMMQN) EU/3/05/329 Treatment of the localised scleroderma Digna Biotech S.L. 28/10/2005
Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis EU/3/09/689 Treatment of myasthenia gravis CuraVac Europe SA 09/11/2009
Peretinoin EU/3/11/890 Treatment of hepatocellular carcinoma Kowa Pharmaceutical Europe Co. Ltd 05/08/2011
P-ethoxy growth factor receptor-bound protein 2 antisense oligonucleotide EU/3/16/1758 Treatment of acute myeloid leukaemia Clinical Network Services (UK) Ltd 14/10/2016
Phenylephrine Hydrochloride EU/3/01/069 Treatment of ileal pouch anal anastomosis related faecal incontinence S.L.A. Pharma (UK) Limited 20/11/2001
Phosphoinositide 3-kinase gamma peptide EU/3/17/1859 Treatment of cystic fibrosis Kither Biotech s.r.l. 20/03/2017
Phosphorothioate oligonucleotide targeted to apolipoprotein C-III EU/3/14/1249 Treatment of familial chylomicronemia syndrome Akcea Therapeutics UK Ltd. 19/02/2014
Phosphorothioate oligonucleotide targeted to transthyretin EU/3/14/1250 Treatment of ATTR amyloidosis Ionis USA Limited 26/03/2014
Picropodophyllin EU/3/17/1904 Treatment of glioma Axelar AB 23/08/2017
Pioglitazone EU/3/14/1245 Treatment of adrenoleukodystrophy Minoryx Therapeutics S.L. 19/02/2014
Pioglitazone hydrochloride EU/3/16/1823 Treatment of sudden sensorineural hearing loss Regiomedica GmbH 12/01/2017
Pirfenidone EU/3/04/241 Treatment of idiopathic pulmonary fibrosis Roche Registration Limited 16/11/2004 Esbriet
EU/1/11/667
02/03/2011
Plasmid DNA encoding the human cystic fibrosis transmembrane conductance regulator gene complexed with a non-viral, cationic lipid based gene transfer agent EU/3/14/1277 Treatment of cystic fibrosis Imperial Innovations Limited 04/06/2014
Plerixafor EU/3/14/1403 Treatment of WHIM syndrome Groupe d'étude des neutropénies 16/12/2014
Polihexanide EU/3/07/498 Treatment of Acanthamoeba keratitis S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. 14/11/2007
Poloxamer 188 EU/3/13/1112 Treatment of sickle cell disease Theradex (Europe) Ltd. 12/03/2013
Poly[2-[(4-{[1-carboxy-2-(hexadecylcarbamoyl)ethyl]sulfanyl}-2,3-bis({2-[((2S)-2-(2-{[(2R)-2-carbamoyl-(2-{[(2S)-1-ethoxy-3-(3-hydroxy-4oxo-1,4-dihydropyridin-1-yl)-1-oxopropan-2-yl]carbamoyl}ethyl]sulfanyl}-3-{[(2S)-1-ethoxy-3-(3-hydroxy-4-oxo-1,4-dihydropyridin-1-yl)-1-oxopropan-2-yl]carbamoyl}propanamido)-3-(3-hydroxy-4-oxo-1,4-dihydropyridin-1-yl)propanoyl Ethyl ester) )-methoxy]acetyl}oxy)butyl)sulfanyl]-3-(hexadecylcarbamoyl)propanoic acid]-poly(ethylene glycol)-ester] EU/3/13/1220 Treatment of dengue Coté Orphan Consulting UK Limited 18/12/2013
Poly-cyclodextrin-bis-cysteine-PEG3400-camptothecin-conjugate EU/3/17/1860 Treatment of ovarian cancer Viadoc Business Solutions Limited 20/03/2017
Polyethylene glycol-modified human recombinant truncated cystathionine beta-synthase EU/3/16/1664 Treatment of homocystinuria Alan Boyd Consultants Ltd 30/05/2016
Poly(oxy-1,2-ethanediyl), alpha-(carboxymethyl)-omega-methoxy-,amide with arginase 1 [cobalt cofactor] (synthetic human) (1:10), trimer EU/3/16/1701 Treatment of hyperargininaemia ERA Consulting GmbH 14/07/2016
Poly(oxy-1,2-ethanediyl), .alpha.-hydro-.omega.-hydroxy-,15,15'-diester with N-acetyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-.alpha.-aspartyl-L-tryptophylglycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-L-threonyl-2-[2-(2-aminoethoxy)ethoxy]acetyl-N6-carboxy-L-lysinamide cyclic (2.fwdarw.12)-(disulfide); where two identical synthetic peptide domains are covalently linked at the ends of the polyethylene glycol chain EU/3/17/1873 Treatment of paroxysmal nocturnal haemoglobinuria Best Regulatory Consulting Ltd 22/05/2017
Polyphenyl(disodium 3-O-sulfo-beta-D-glucopyranuronate)-(1?3)-beta-D-galactopyranoside EU/3/17/1893 Treatment of anti-MAG neuropathy SFL Regulatory Affairs Consulting Ltd 17/07/2017
Pomalidomide EU/3/09/672 Treatment of multiple myeloma Celgene Europe Limited 08/10/2009 Imnovid
EU/1/13/850
08/08/2013
Ponatinib hydrochloride EU/3/14/1421 Treatment of gastrointestinal stromal tumours Incyte Biosciences UK Ltd 15/01/2015
Pralatrexate EU/3/07/444 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Allos Therapeutics Limited 13/04/2007
Pralatrexate EU/3/08/603 Treatment of non-papillary transitional cell carcinoma of the urinary bladder Allos Therapeutics Limited 19/01/2009
Pralatrexate EU/3/10/741 Treatment of cutaneous T-cell lymphoma Allos Therapeutics Limited 10/06/2010
Pralatrexate EU/3/10/795 Treatment of Hodgkin's lymphoma Allos Therapeutics Limited 01/10/2010
Prasterone EU/3/03/156 Treatment of adrenal insufficiency Medicom Healthcare BV 28/07/2003
Pravastatin / zoledronic acid EU/3/10/748 Treatment of Hutchinson-Gilford progeria Prenyl BIO SAS 09/06/2010
Pr-D-Cys-Met-Pip-Arg-Leu-Arg-Sar-Cys-Lys-Arg-Pro-Tyr-Tle-Leu-OH EU/3/16/1824 Treatment of perinatal asphyxia VECT-HORUS 12/01/2017
Propranolol EU/3/16/1805 Treatment of soft tissue sarcoma The Anticancer Fund 12/12/2016
Propranolol hydrochloride EU/3/17/1841 Treatment of von Hippel-Lindau disease Consejo Superior de Investigaciones Cientificas (CSIC) 27/02/2017
Pro-Pro-Thr-Val-Pro-Thr-Arg EU/3/14/1375 Treatment of xeroderma pigmentosum ProGeLife S.A.S. 19/11/2014
Purified bromelain EU/3/02/107 Treatment of partial deep dermal and full thickness burns MediWound Germany GmbH 30/07/2002 NexoBrid
EU/1/12/803
20/12/2012
Purified pasteurised and freeze-dried cell-wall fragments from Mycobacterium tuberculosis strain RUTI EU/3/17/1905 Treatment of tuberculosis Archivel Farma S.L. 23/08/2017
Pyridoxal 5'-phosphate EU/3/14/1347 Treatment of pyridoxamine 5'-phosphate oxidase deficiency Great Ormond Street Hospital for Children, NHS Foundation Trust 15/10/2014
Pyridoxalated haemoglobin polyoxyethylene EU/3/07/463 Treatment of cardiogenic shock Curacyte AG 02/08/2007
Pyridoxine and L-pyroglutamic acid EU/3/16/1673 Treatment of fragile X syndrome FGK Representative Service Ltd. 27/06/2016
(R)-1-[1-(4-acetoxy-3,3-dimethyl-2-oxo-butyl)-2-oxo-5-(pyridin-2-yl)-2,3-dihydro-1H-benzo[e][1,4]diazepin-3-yl]-3-(3-methylamino-phenyl)-urea EU/3/15/1588 Treatment of gastro-entero-pancreatic neuroendocrine tumours Trio Medicines Ltd 14/12/2015
R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H -1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea EU/3/07/452 Treatment of gastric carcinoid Trio Medicines Ltd 14/06/2007
(R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole EU/3/07/524 Treatment of tuberculosis Otsuka Novel Products GmbH 01/02/2008 Deltyba
EU/1/13/875
30/04/2014
(R)-6-(2-fluorophenyl)-N-(3-(2-((2-methoxyethyl)amino)ethyl)phenyl)-5,6-dihydrobenzo[h]quinazolin-2-amine dihydrochloride EU/3/16/1657 Treatment of biliary tract cancer QRC Consultants Ltd 30/05/2016
Radio-iodinated (131I) anti-CD45 murine monoclonal antibody EU/3/16/1760 Treatment in haematopoietic stem cell transplantation PharmaLex UK Services Limited 14/10/2016
Raloxifene hydrochloride EU/3/10/730 Treatment of hereditary haemorrhagic telangiectasia Consejo Superior de Investigaciones Cientificas (CSIC) 10/06/2010
Ramiprilat EU/3/13/1117 Treatment of Stargardt’s disease Iris Pharma 12/03/2013
Ramoplanin EU/3/01/049 Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection Vicuron Pharmaceuticals Italy srl, 09/07/2001
Raxibacumab EU/3/14/1352 Treatment of inhalation anthrax disease GlaxoSmithKline Trading Services Limited 15/10/2014
R-azasetron besylate EU/3/16/1785 Treatment of sudden sensorineural hearing loss Sensorion 18/11/2016
R-baclofen EU/3/11/858 Treatment of fragile X syndrome Lakeside Regulatory Consulting Services Ltd 15/04/2011
Recombinant adeno-associated viral vector containing human acid alfa-glucosidase-gene EU/3/12/1018 Treatment of glycogen storage disease type II (Pompe's disease) Audentes Therapeutics UK Limited 04/07/2012
Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene EU/3/07/440 Treatment of congenital alpha-1 antitrypsin deficiency TMC Pharma Services Ltd 20/03/2007
Recombinant adeno-associated viral vector containing human CNGA3 gene EU/3/15/1556 Treatment of achromatopsia caused by mutations in the CNGA3 gene TMC Pharma Services Ltd 09/10/2015
Recombinant adeno-associated viral vector containing the human CNGB3 gene EU/3/13/1099 Treatment of achromatopsia caused by mutations in the CNGB3 gene TMC Pharma Services Ltd 08/02/2013
Recombinant adeno-associated viral vector containing the human retinoschisin gene EU/3/13/1107 Treatment of X-linked juvenile retinoschisis TMC Pharma Services Ltd 12/03/2013
Recombinant adeno-associated viral vector containing the human RPGR gene EU/3/16/1665 Treatment of retinitis pigmentosa caused by mutations in the RPGR gene TMC Pharma Services Ltd 30/05/2016
Recombinant adeno-associated viral vector encoding a human micro-dystrophin gene under the control of a muscle specific promoter EU/3/16/1759 Treatment of Duchenne muscular dystrophy Pharma Gateway AB 14/10/2016
Recombinant adeno-associated viral vector serotype 2 carrying the gene for the human aromatic L-amino acid decarboxylase protein EU/3/16/1786 Treatment of aromatic L-amino acid decarboxylase deficiency Voisin Consulting S.A.R.L. 18/11/2016
Recombinant adeno-associated viral vector serotype 5 carrying the gene for the human frataxin protein EU/3/17/1906 Treatment of Friedreich’s ataxia Voisin Consulting S.A.R.L. 23/08/2017
Recombinant adeno-associated viral vector serotype 6 encoding the B-domain-deleted human factor VIII EU/3/17/1874 Treatment of haemophilia A Coté Orphan Consulting UK Limited 22/05/2017
Recombinant adeno-associated viral vector serotype 9 carrying the gene for the human E6-AP ubiquitin protein ligase EU/3/16/1651 Treatment of Angelman syndrome Voisin Consulting S.A.R.L. 28/04/2016
Recombinant adeno-associated viral vector serotype 9 containing the human N-alpha-acetylglucosaminidase gene EU/3/16/1825 Treatment of mucopolysaccharidosis type IIIB (Sanfilippo B syndrome) Ser-mes Planificación SL 12/01/2017
Recombinant antibody construct against human CD30 and CD16A EU/3/09/673 Treatment of Hodgkin lymphoma Affimed GmbH 09/10/2009
Recombinant antibody derivative against human CD19 and CD3 EU/3/03/175 Treatment of mantle cell lymphoma Amgen Europe B.V. 01/12/2003
Recombinant antibody derivative against human CD19 and CD3 EU/3/03/176 Treatment of chronic lymphocytic leukaemia Amgen Europe B.V. 01/12/2003
Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein EU/3/12/1038 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) AOP Orphan Pharmaceuticals AG 09/08/2012
Recombinant anti-CD3-bi-single-chain-Fv-diphtheria toxin fusion protein EU/3/12/1039 Treatment of cutaneous T-cell lymphoma AOP Orphan Pharmaceuticals AG 09/08/2012
Recombinant chimeric monoclonal antibody against CD20 EU/3/09/699 Treatment of chronic lymphocytic leukaemia LFB-Biotechnologies 26/11/2009
Recombinant derivative of C3 transferase EU/3/08/563 Treatment of traumatic spinal cord injury Vertex Pharmaceuticals (Europe) Limited 05/09/2008
Recombinant dog gastric lipase EU/3/03/157 Treatment of cystic fibrosis Meristem Therapeutics S.A. 09/07/2003
Recombinant factor VIIa modified with three terminal repeats derived from the chain of human chorionic gonadotropin EU/3/14/1312 Treatment of congenital factor VII deficiency Richardson Associates Regulatory Affairs Ltd 22/08/2014
Recombinant factor VIIa modified with three terminal repeats derived from the chain of human chorionic gonadotropin EU/3/14/1316 Treatment of haemophilia A Richardson Associates Regulatory Affairs Ltd 22/08/2014
Recombinant factor VIIa modified with three terminal repeats derived from the chain of human chorionic gonadotropin EU/3/14/1319 Treatment of haemophilia B Richardson Associates Regulatory Affairs Ltd 22/08/2014
Recombinant fragment of human surfactant protein-D EU/3/17/1907 Prevention of bronchopulmonary dysplasia Trimunocor Ltd 23/08/2017
Recombinant fusion protein consisting of a modified form of the extracellular domain of human activin receptor IIB linked to the human IgG1 Fc domain EU/3/14/1300 Treatment of beta-thalassaemia intermedia and major Celgene Europe Limited 29/07/2014
Recombinant fusion protein consisting of a modified form of the extracellular domain of human activin receptor IIB linked to the human IgG1 Fc domain EU/3/14/1331 Treatment of myelodysplastic syndromes Celgene Europe Limited 22/08/2014
Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 EU/3/07/453 Treatment of haemophilia B (congenital factor IX deficiency) Swedish Orphan Biovitrum AB (publ) 08/06/2007 ALPROLIX
EU/1/16/1098
13/05/2016
Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/06/411 Prevention of Graft-versus-Host disease Apogenix GmbH 31/10/2006
Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/09/709 Treatment of glioma Apogenix GmbH 28/01/2010
Recombinant fusion protein linking coagulation factor VIIa with albumin EU/3/13/1188 Treatment of congenital factor VII deficiency CSL Behring GmbH 07/10/2013
Recombinant fusion protein linking human coagulation factor IX with human albumin EU/3/09/723 Treatment of haemophilia B CSL Behring GmbH 04/02/2010 IDELVION
EU/1/16/1095
13/05/2016
Recombinant fusion protein linking human coagulation factor VIIa with human albumin EU/3/11/855 Treatment of haemophilia A CSL Behring GmbH 15/04/2011
Recombinant fusion protein linking human coagulation factor VIIa with human albumin EU/3/11/863 Treatment of haemophilia B CSL Behring GmbH 13/05/2011
Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] EU/3/08/553 Treatment of glioma Envigo Pharma Consulting Ltd 03/06/2008
Recombinant glycoprotein gp350 of Epstein-Barr virus EU/3/02/118 Prevention of post transplantation lympho-proliferative disorders Henogen S.A. 22/10/2002
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/248 Treatment of multiple myeloma CellGenix GmbH 21/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/249 Treatment of follicular lymphoma CellGenix GmbH 23/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/04/250 Treatment of mantle cell lymphoma CellGenix GmbH 21/12/2004
Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors EU/3/09/656 Treatment of diffuse large B-cell lymphoma CellGenix GmbH 24/07/2009
Recombinant human acid alpha-glucosidase conjugated with mannose-6-phosphate analogues EU/3/16/1726 Treatment of glycogen storage disease type II (Pompe’s disease) NanoMedSyn 29/08/2016
Recombinant human acid ceramidase EU/3/14/1243 Treatment of Farber disease Enzyvant Farber Ireland Limited 21/02/2014
Recombinant human acid ceramidase EU/3/15/1536 Treatment of cystic fibrosis Plexcera Therapeutics EU Limited 10/08/2015
Recombinant human acid sphingomyelinase EU/3/01/056 Treatment of Niemann-Pick disease Genzyme Europe B.V. 19/09/2001
Recombinant human ADAMTS-13 EU/3/08/588 Treatment of thrombotic thrombocytopenic purpura Baxalta Innovations GmbH 03/12/2008
Recombinant human alkaline phosphatase EU/3/14/1427 Treatment of hypophosphatasia AM-Pharma BV 15/01/2015
Recombinant human alpha 1 chain homotrimer of type VII collagen EU/3/14/1272 Treatment of epidermolysis bullosa Shire Pharmaceuticals Ireland Limited 04/06/2014
Recombinant human alpha-1-microglobulin EU/3/14/1289 Treatment of pre-eclampsia A1M Pharma AB 04/07/2014
Recombinant human alpha-glucosidase conjugated with multiple copies of synthetic bismannose-6-phosphate-tetra-mannose glycan EU/3/14/1251 Treatment of glycogen storage disease type II (Pompe's disease) Genzyme Europe B.V. 26/03/2014
Recombinant human antibody directed against misfolded human superoxide dismutase 1 EU/3/17/1894 Treatment of amyotrophic lateral sclerosis The Medical & Regulatory Partnership Limited 17/07/2017
Recombinant human anti-interferon gamma monoclonal antibody EU/3/10/749 Treatment of haemophagocytic lymphohistiocytosis NovImmune B.V. 09/06/2010
Recombinant human apolipoprotein A-I in a complex with phospholipids EU/3/14/1314 Treatment of ATP-binding cassette transporter A1 deficiency Cerenis Therapeutics Holding SA 22/08/2014
Recombinant human apolipoprotein A-I in a complex with phospholipids EU/3/14/1315 Treatment of apolipoprotein A-I deficiency Cerenis Therapeutics Holding SA 22/08/2014
Recombinant human arylsulfatase A EU/3/10/813 Treatment of metachromatic leukodystrophy Shire Pharmaceuticals Ireland Limited 26/11/2010
Recombinant human aspartylglucosaminidase EU/3/14/1410 Treatment of aspartylglucosaminuria ACE BioSciences A/S 15/01/2015
Recombinant human beta-glucuronidase EU/3/12/973 Treatment of mucopolysaccharidosis type VII (Sly syndrome) Ultragenyx Germany GmbH 21/03/2012
Recombinant human bone morphogenetic protein 4 EU/3/14/1348 Treatment of glioma STEMGEN S.p.A 15/10/2014
Recombinant human C1-inhibitor EU/3/07/435 Prevention of delayed graft function after solid organ transplantation Pharming Group N.V. 20/02/2007
Recombinant human cerebral dopamine neurotrophic factor EU/3/16/1652 Treatment of amyotrophic lateral sclerosis Herantis Pharma Plc 28/04/2016
Recombinant human club cell 10 KDa protein EU/3/15/1456 Prevention of bronchopulmonary dysplasia RLM Consulting 19/03/2015
Recombinant human club cell 10 KDa protein EU/3/17/1842 Treatment of bronchiolitis obliterans syndrome EUDRAC Limited 27/02/2017
Recombinant human CXCL8 mutant EU/3/08/570 Prevention of delayed graft function after solid organ transplantation ProtAffin Biotechnologie AG 22/09/2008
Recombinant human CXCL8 mutant EU/3/13/1131 Treatment of cystic fibrosis ProtAffin Biotechnologie AG 07/06/2013
Recombinant human diamine oxidase EU/3/14/1320 Treatment of mastocytosis Medical University of Vienna 22/08/2014
Recombinant human dyskerin EU/3/12/1070 Treatment of dyskeratosis congenita Advanced Medical Projects 08/11/2012
Recombinant human elafin EU/3/09/710 Treatment of oesophagus carcinoma Proteo Biotech AG 28/01/2010
Recombinant human factor IX protein modified with three point mutations EU/3/17/1884 Treatment of haemophilia B Voisin Consulting S.A.R.L. 20/06/2017
Recombinant human galactocerebrosidase EU/3/11/911 Treatment of globoid cell leukodystrophy (Krabbe disease) ACE BioSciences A/S 27/09/2011
Recombinant human glutamate oxaloacetate transaminase 1 EU/3/15/1443 Treatment of glioma Dr. Regenold GmbH 12/02/2015
Recombinant human growth hormone modified by fusion with two hydrophilic polypeptide chains EU/3/13/1179 Treatment of growth hormone deficiency Larode Ltd 05/08/2013
Recombinant human heparan N-sulfatase EU/3/08/582 Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) Shire Pharmaceutical Development Limited 07/11/2008
Recombinant human hepatitis C monoclonal antibody against C4 region of E1 EU/3/07/503 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 06/12/2007
Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein EU/3/08/611 Treatment of acute liver failure Alfact Innovation SAS 11/02/2009
Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 EU/3/07/516 Treatment of acute myeloid leukaemia Xenetic Biosciences Plc 20/12/2007
Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 EU/3/10/840 Treatment of acute lymphoblastic leukaemia Xenetic Biosciences Plc 23/02/2011
Recombinant human IgG1 kappa light chain monoclonal antibody targeting plasma kallikrein EU/3/15/1551 Treatment of hereditary angioedema Dyax Ltd 09/10/2015
Recombinant human insulin receptor monoclonal antibody-fused iduronate 2-sulfatase EU/3/13/1198 Treatment of mucopolysaccharidosis type II (Hunter's syndrome) Voisin Consulting S.A.R.L. 13/11/2013
Recombinant human insulin receptor monoclonal antibody-fused-a-L-iduronidase EU/3/14/1349 Treatment of mucopolysaccharidosis type I Voisin Consulting S.A.R.L. 15/10/2014
Recombinant human interleukin-12 EU/3/16/1727 Treatment of acute radiation syndrome Coté Orphan Consulting UK Limited 29/08/2016
Recombinant human interleukin-3 truncated diphtheria toxin fusion protein EU/3/15/1563 Treatment of acute myeloid leukaemia TMC Pharma Services Ltd 09/10/2015
Recombinant human interleukin-3 truncated diphtheria toxin fusion protein EU/3/15/1567 Treatment of blastic plasmacytoid dendritic cell neoplasm TMC Pharma Services Ltd 11/11/2015
Recombinant human interleukin-7 EU/3/12/1013 Treatment of progressive multifocal leukoencephalopathy Inserm-ANRS (Agence Nationale de Recherches sur le Sida et les Hépatites Virales) 04/07/2012
Recombinant human interleukin-7 fused to a hybrid crystallisable fragment region of a human antibody EU/3/17/1875 Treatment of idiopathic CD4 lymphocytopenia NeoImmuneTech, INC., Spółka Akcyjna, Oddział w Polsce 22/05/2017
Recombinant human lecithin cholesterol acyltransferase EU/3/12/1051 Treatment of lecithin cholesterol acyltransferase deficiency AstraZeneca UK Limited 10/10/2012
Recombinant human lysosomal acid lipase EU/3/10/827 Treatment of lysosomal acid lipase deficiency Alexion Europe SAS 17/12/2010 Kanuma
EU/1/15/1033
01/09/2015
Recombinant human mesencephalic astrocyte-derived neurotrophic factor EU/3/15/1486 Treatment of retinitis pigmentosa Regintel Limited 24/04/2015
Recombinant human methionine proinsulin EU/3/12/985 Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 26/04/2012
Recombinant human minibody against complement component C5 EU/3/08/571 Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system ADIENNE S.r.l. 22/09/2008
Recombinant human minibody against complement component C5 EU/3/11/926 Treatment of primary membranoproliferative glomerulonephritis ADIENNE S.r.l. 27/10/2011
Recombinant Human minibody against complement component C5 fused with RGD-motif EU/3/08/604 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation ADIENNE S.r.l. 20/01/2009
Recombinant human monoclonal antibody against activin receptor type IIB EU/3/12/1035 Treatment of inclusion body myositis Novartis Europharm Limited 09/08/2012
Recombinant human monoclonal antibody against hepatitis B virus EU/3/13/1156 Prevention of hepatitis B re-infection following liver transplantation inVentiv Health Germany GmbH 17/07/2013
Recombinant human monoclonal antibody binding to vascular adhesion protein-1 EU/3/15/1461 Treatment of primary sclerosing cholangitis Biotie Therapies Corp 19/03/2015
Recombinant human monoclonal antibody of the IgG1 kappa class against human macrophage colony-stimulating factor EU/3/14/1350 Treatment of tenosynovial giant cell tumour, localised and diffused type Novartis Europharm Limited 15/10/2014
Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class EU/3/08/605 Treatment of spinal cord injury Novartis Europharm Limited 19/01/2009
Recombinant human monoclonal antibody to insulin receptor EU/3/16/1702 Treatment of congenital hyperinsulinism XOMA UK Limited 14/07/2016
Recombinant human monoclonal IgG1 antibody against programmed death ligand-1 EU/3/15/1590 Treatment of Merkel cell carcinoma Merck Serono Europe Limited 14/12/2015 Bavencio
EU/1/17/1214
20/09/2017
Recombinant human monoclonal IgG1 antibody for fibroblast growth factor 23 EU/3/14/1351 Treatment of X-linked hypophosphataemia Kyowa Kirin Limited 15/10/2014
Recombinant human monoclonal IgM antibody targeting glucose-regulated protein 78 EU/3/13/1190 Treatment of plasma cell myeloma Patrys GmbH 07/10/2013
Recombinant human N-acetylgalactosamine-6-sulfatase EU/3/09/657 Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) BioMarin Europe Ltd. 24/07/2009 Vimizim
EU/1/14/914
30/04/2014
Recombinant human nerve growth factor EU/3/13/1135 Treatment of retinitis pigmentosa Dompé farmaceutici S.p.A. 07/06/2013
Recombinant human nerve growth factor EU/3/15/1586 Treatment of neurotrophic keratitis Dompé farmaceutici S.p.A. 14/12/2015 OXERVATE
EU/1/17/1197
10/07/2017
Recombinant human parathyroid hormone EU/3/13/1210 Treatment of hypoparathyroidism Shire Pharmaceuticals Ireland Limited 18/12/2013 Natpar
EU/1/15/1078
26/04/2017
Recombinant human pentraxin-2 EU/3/12/1020 Treatment of idiopathic pulmonary fibrosis FGK Representative Service GmbH 17/07/2012
Recombinant human pentraxin-2 EU/3/14/1358 Treatment of post-essential thrombocythaemia myelofibrosis FGK Representative Service GmbH 19/11/2014
Recombinant human pentraxin-2 EU/3/14/1365 Treatment of post-polycythaemia vera myelofibrosis FGK Representative Service GmbH 19/11/2014
Recombinant human pentraxin-2 EU/3/14/1366 Treatment of primary myelofibrosis FGK Representative Service GmbH 19/11/2014
Recombinant Human Porphobilinogen Deaminase EU/3/02/103 Treatment of acute intermittent porphyria Zymenex A/S 12/06/2002
Recombinant human proinsulin EU/3/08/612 Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 11/02/2009
Recombinant human soluble Fc-gamma receptor IIb EU/3/07/462 Treatment of idiopathic thrombocytopenic purpura Baxalta Innovations GmbH 02/08/2007
Recombinant human surfactant protein D EU/3/14/1262 Prevention of bronchopulmonary dysplasia Dr Ulrich Granzer 11/04/2014
Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein EU/3/08/594 Treatment of hypophosphatasia Alexion Europe SAS 03/12/2008 Strensiq
EU/1/15/1015
01/09/2015
Recombinant human transglutaminase 1 encapsulated into liposomes EU/3/13/1130 Treatment of transglutaminase-1-deficient autosomal recessive congenital ichthyosis Westfälische Wilhelms-Universität Münster 07/06/2013
Recombinant human tripeptidyl-peptidase 1 EU/3/13/1118 Treatment of neuronal ceroid lipofuscinosis type 2 BioMarin International Limited 12/03/2013 Brineura
EU/1/17/1192
01/06/2017
Recombinant human type I pancreatic elastase EU/3/13/1218 Prevention of arteriovenous access dysfunction in haemodialysis patients Proteon Therapeutics Limited 18/12/2013
Recombinant human vascular endothelial growth factor EU/3/09/711 Treatment of amyotrophic lateral sclerosis Newron Sweden AB 29/01/2010
Recombinant human von Willebrand factor EU/3/10/814 Treatment of von Willebrand disease Baxalta Innovations GmbH 26/11/2010
Recombinant human a-Mannosidase EU/3/04/260 Treatment of α-Mannosidosis Chiesi Farmaceutici S.p.A. 26/01/2005
Recombinant humanised anti-human interleukin-1 beta monoclonal antibody EU/3/10/796 Treatment of Behçet's disease XOMA UK Limited 01/10/2010
Recombinant humanised monoclonal IgG2 lambda antibody against human sclerostin EU/3/16/1686 Treatment of osteogenesis imperfecta Mereo Biopharma 3 Limited 27/06/2016
Recombinant IgG degrading enzyme of Streptococcus pyogenes EU/3/16/1826 Prevention of graft rejection following solid organ transplantation Hansa Medical AB 12/01/2017
Recombinant kallikrein inhibitor EU/3/09/712 Treatment of Netherton syndrome Dermadis S.A.S. 29/01/2010
Recombinant megakaryopoeisis-stimulating protein EU/3/05/283 Treatment of idiopathic thrombocytopenic purpura Amgen Europe B.V. 27/05/2005 Nplate
EU/1/08/497
06/02/2009
Recombinant modified human growth hormone EU/3/12/1087 Treatment of growth hormone deficiency Richardson Associates Regulatory Affairs Ltd 24/01/2013
Recombinant modified vaccinia Ankara expressing human 5T4 EU/3/06/429 Treatment of renal cell carcinoma Oxford Biomedica (UK) Ltd 26/01/2007
Recombinant monoclonal antibody to human serum amyloid P component EU/3/14/1293 Treatment of AL amyloidosis GlaxoSmithKline Trading Services Limited 30/07/2014
Recombinant monoclonal IgG1 antibody against T-cell immune response cDNA 7 EU/3/15/1479 Prevention of graft rejection following solid organ transplantation Nekonal S.a.r.l. 24/04/2015
Recombinant protein consisting of modified human growth hormone releasing hormone and the translocation and endopeptidase domains of botulinum toxin serotype D EU/3/11/947 Treatment of acromegaly Syntaxin Limited 11/01/2012
Recombinant protein derived from the saliva of the Ornithodoros moubata tick EU/3/16/1687 Treatment of Guillain-Barré syndrome Akari Therapeutics Plc 27/06/2016
Recombinant protein derived from the saliva of the Ornithodoros moubata tick EU/3/16/1725 Treatment of paroxysmal nocturnal haemoglobinuria Akari Therapeutics Plc 29/08/2016
Recombinant P-selectin glycoprotein immunoglobulin EU/3/06/376 Prevention of post transplantation graft dysfunction RJM Consultancy Ltd 22/05/2006
Recombinant self-complementary adeno-associated viral vector serotype 9 containing the human CLN3 gene EU/3/16/1806 Treatment of neuronal ceroid lipofuscinosis Ser-mes Planificación SL 12/12/2016
Recombinant thymidine phosphorylase encapsulated in autologous erythrocytes EU/3/11/856 Treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) due to thymidine phosphorylase deficiency St George's University of London 15/04/2011
Recombinant truncated N-terminal fragment of human lens epithelium-derived growth factor EU/3/17/1908 Treatment of retinitis pigmentosa Dorian Regulatory Affairs BV 23/08/2017
Reduced oxydised N-acetyl heparin EU/3/15/1487 Treatment of plasma cell myeloma Leadiant Biosciences Ltd 21/05/2015
Reparixin EU/3/11/912 Prevention of graft rejection in pancreatic islet transplantation Dompé farmaceutici S.p.A. 27/09/2011
Repertaxin L-lysine salt EU/3/01/058 Prevention of delayed graft function in organ transplant Dompé farmaceutici S.p.A. 19/09/2001
Resiquimod EU/3/16/1653 Treatment of cutaneous T-cell lymphoma Galderma R&D 28/04/2016
Resminostat EU/3/11/913 Treatment of hepatocellular carcinoma 4SC AG 27/09/2011
Resminostat EU/3/11/930 Treatment of Hodgkin's lymphoma 4SC AG 09/12/2011
Retinol EU/3/14/1307 Prevention of bronchopulmonary dysplasia orphanix GmbH 22/08/2014
Retinol EU/3/17/1895 Prevention of retinopathy of prematurity orphanix GmbH 17/07/2017
Retroviral gamma-c cDNA containing vector EU/3/01/038 Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease GENOPOIETIC S.A.S. 30/05/2001
Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide EU/3/08/542 Treatment of acute myeloid leukaemia Dr Ulrich Granzer 08/05/2008
Rifapentine EU/3/10/750 Treatment of tuberculosis Sanofi-Aventis groupe 09/06/2010
Rilotumumab EU/3/14/1291 Treatment of gastric cancer Amgen Europe B.V. 29/07/2014
Riluzole EU/3/14/1401 Treatment of traumatic spinal cord injury Dr Laurent Vinay 16/12/2014
Rimeporide EU/3/15/1478 Treatment of Duchenne muscular dystrophy EUDRAC Limited 24/04/2015
Rimiducid EU/3/16/1666 Treatment of graft-versus-host disease Bellicum Pharma Limited 30/05/2016
Rintatolimod EU/3/15/1480 Treatment of Ebola virus disease NV Hemispherx BioPharma Europe 24/04/2015
Riociguat EU/3/14/1299 Treatment of systemic sclerosis Bayer AG 29/07/2014
Rituximab EU/3/17/1869 Treatment in solid organ transplantation Hôpital Foch 20/04/2017
RNA, [P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a?5') (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5' [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3'[2'a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl--alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl--alanyl-L-arginyl-6-aminohexanoyl--alanyl], octahydrochloride EU/3/09/725 Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 02/02/2010
RNA, [P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a?5')(C-m5U-C-C-A-A-C-A-m5U-C-A-A-G-G-A-A-G-A-m5U-G-G-C-A-m5U-m5U-m5U-C-m5U-A-G), P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy] ethoxy]carbonyl]-1-piperazinyl]-N,Ndimethylaminophosphonamidate EU/3/08/586 Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 03/12/2008
Rovalpituzumab tesirine EU/3/16/1667 Treatment of small cell lung cancer AbbVie Ltd 30/05/2016
R-salbutamol sulphate EU/3/07/481 Treatment of cutaneous forms of lupus erythematosus Astion Pharma A/S 14/09/2007
R,S-O-(3-piperidino-2-hydroxy-1-propyl)-nicotinic acid amidoxime dihydrochloride EU/3/13/1122 Treatment of Duchenne muscular dystrophy Vudbenk Life Science Kft. 26/04/2013
Rubitecan EU/3/03/145 Treatment of pancreatic cancer Eurogen Pharmaceuticals Limited 10/06/2003
Rucaparib EU/3/12/1049 Treatment of ovarian cancer Clovis Oncology UK Limited 10/10/2012
Rufinamide EU/3/04/240 Treatment of Lennox-Gastaut syndrome Eisai Limited 20/10/2004 Inovelon
EU/1/06/378
18/01/2007
S[+] apomorphine EU/3/12/954 Treatment of amyotrophic lateral sclerosis University of Sheffield 09/02/2012
(S)-10-[(dimethylamino)methyl]-4-ethyl-9-hydroxy-4-O-[alpha-(2'', 4'', 5'', 7''-tetranitro-9''-fluorenylideneaminooxy)propionyl]-1H-pyrano[3', 4', 6', 7']indolizino[1,2-beta]-quinoline-3, 14-(4H), 12H)-dione, hydrochloride EU/3/10/788 Treatment of hepatocellular carcinoma TLC Biopharmaceuticals B.V. 01/10/2010
(S)-1-(4-fluorophenyl)-1-(2-(4-(6-(1-methyl-1H-pyrazol-4-yl)pyrrolo[2,1-f][1,2,4]triazin-4-yl)piperazin-yl)pyrimidin-5-yl)ethan-1-amine EU/3/17/1889 Treatment of gastrointestinal stromal tumours PhaRA bvba 17/07/2017
(S)-2-(1-((6-amino-5-cyanopyrimidin-4-yl)amino)ethyl)-4-oxo-3-phenyl-3,4-dihydropyrrolo[2,1-f][1,2,4]triazine-5-carbonitrile EU/3/14/1335 Treatment of pemphigus Almirall, S.A. 15/10/2014
S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK EU/3/09/634 Treatment of pancreatic cancer MBiotec GmbH 15/05/2009
(S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine EU/3/07/513 Treatment of tuberculosis FGK Representative Service GmbH 29/11/2007
(S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one EU/3/13/1125 Treatment of chronic lymphocytic leukaemia/small lymphocytic lymphoma Voisin Consulting S.A.R.L. 26/04/2013
(S)-3-(1-(9H-purin-6-ylamino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one EU/3/13/1157 Treatment of follicular lymphoma Voisin Consulting S.A.R.L. 17/07/2013
(S)-3'-(OH)-desazadesferrithiocin-polyether, magnesium salt EU/3/09/647 Treatment of chronic iron overload requiring chelation therapy Shire Pharmaceutical Development Limited 24/07/2009
S3,S13-cyclo(D-tyrolsyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-aspartyl-L-tryptophyl-N-methyl-L-glycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-N-methyl-L-isoleucinamide) EU/3/14/1327 Treatment of paroxysmal nocturnal haemoglobinuria Amyndas Pharmaceuticals S.A. 22/08/2014
S3,S13-cyclo(D-tyrolsyl-L-isoleucyl-L-cysteinyl-L-valyl-1-methyl-L-tryptophyl-L-glutaminyl-L-aspartyl-L-tryptophyl-N-methyl-L-glycyl-L-alanyl-L-histidyl-L-arginyl-L-cysteinyl-N-methyl-L-isoleucinamide) EU/3/16/1608 Treatment of C3 glomerulopathy Amyndas Pharmaceuticals S.A. 17/02/2016
(S)-3-((S)-2-(2-((2,6-difluorophenyl)amino)-2-oxoacetamido)propanamido)-4-oxo-5-(2,3,5,6-tetrafluorophenoxy)pentanoic acid EU/3/17/1914 Treatment of primary sclerosing cholangitis Pharma Gateway AB 16/10/2017
(S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride EU/3/14/1336 Treatment of Leigh syndrome Khondrion BV 15/10/2014
(S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride EU/3/15/1543 Treatment of mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes Khondrion BV 10/08/2015
(S)-8-{2-amino-6-[1-(5-chloro-biphenyl-2-yl)-(R)-2,2,2-trifluoro-ethoxy]-pyrimidin-4-yl}-2,8-diaza-spiro[4.5]decane-3-carboxylic acid ethyl ester EU/3/17/1861 Treatment of pulmonary arterial hypertension Biological Consulting Europe Ltd 20/04/2017
(S)-{8-fluoro-2-2[4-(3-methoxyphenyl)-1-piperazinyl]-3-[2-methoxy-5-(trifluoromethyl)-phenyl]-3,4-dihydro-4-quinazolinyl} acetic acid EU/3/11/849 Prevention of cytomegalovirus disease in patients with impaired cell-mediated immunity deemed at risk Merck Sharp & Dohme Limited 15/04/2011
S-acetyl-(S)-4'-phosphopantetheine, calcium salt EU/3/16/1654 Treatment of pantothenate-kinase-associated neurodegeneration Acies Bio d.o.o. 28/04/2016
Sacrosidase EU/3/13/1183 Treatment of congenital sucrase-isomaltase deficiency QOL Therapeutics UK Ltd 05/08/2013
Salmonella typhi Ty21a strain transfected with a plasmid vector encoding the human vascular endothelial growth factor receptor 2 EU/3/17/1909 Treatment of glioma Vaximm GmbH 23/08/2017
Sapacitabine EU/3/08/557 Treatment of myelodysplastic syndromes Cyclacel Limited 08/07/2008
Sapacitabine EU/3/08/558 Treatment of acute myeloid leukaemia Cyclacel Limited 10/07/2008
Sarizotan hydrochloride EU/3/15/1531 Treatment of Rett syndrome Newron Pharmaceuticals SpA 28/07/2015
Self-complementary adeno-associated viral vector serotype 9 containing the SGSH gene EU/3/16/1761 Treatment of mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) Ser-mes Planificación SL 14/10/2016
Selinexor EU/3/14/1354 Treatment of chronic lymphocytic leukaemia / small lymphocytic lymphoma Karyopharm Europe GmbH 19/11/2014
Selinexor EU/3/14/1355 Treatment of plasma cell myeloma Karyopharm Europe GmbH 19/11/2014
(S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate EU/3/09/661 Treatment of carcinoid syndrome Ipsen Pharma 08/10/2009
Setmelanotide EU/3/16/1688 Treatment of Prader-Willi syndrome TMC Pharma Services Ltd 27/06/2016
Setmelanotide EU/3/16/1703 Treatment of pro-opiomelanocortin deficiency TMC Pharma Services Ltd 14/07/2016
Sevuparin sodium EU/3/15/1433 Treatment of sickle cell disease Modus Therapeutics AB 12/02/2015
Sialic acid EU/3/12/972 Treatment of GNE myopathy Ultragenyx Germany GmbH 05/03/2012
Sildenafil EU/3/17/1885 Treatment of congenital diaphragmatic hernia Avivia Beheer BV 20/06/2017
Sildenafil citrate EU/3/10/815 Treatment of postcardiotomy right ventricular failure Pfizer Limited 26/11/2010
Silibinin-C-2',3-dihydrogensuccinate, disodium salt EU/3/10/828 Prevention of recurrent hepatitis C in liver transplant recipients Rottapharm S.p.A 17/12/2010
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/01/079 Treatment of acute lung injury Pharm Research Associates (UK) Limited 04/02/2002
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/04/216 Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid EU/3/04/217 Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol, sodium salt and palmitic acid EU/3/11/927 Treatment of cystic fibrosis Pharm Research Associates (UK) Limited 27/10/2011
Sindbis virus envelope pseudotyped lentiviral vector encoding New York esophageal squamous cell carcinoma-1 protein EU/3/16/1636 Treatment of soft tissue sarcoma Immune Design Ltd 21/03/2016
Single-chain urokinase plasminogen activator EU/3/14/1383 Treatment of pleural empyema Coté Orphan Consulting UK Limited 16/12/2014
Siponimod EU/3/14/1369 Treatment of dermatomyositis Novartis Europharm Limited 19/11/2014
Siponimod EU/3/14/1370 Treatment of polymyositis Novartis Europharm Limited 19/11/2014
Sirolimus EU/3/11/898 Treatment of chronic non-infectious uveitis Santen Oy 30/08/2011
Sirolimus EU/3/13/1204 Prevention of arteriovenous access dysfunction in patients undergoing surgical creation of an arteriovenous access for haemodialysis S-cubed Ltd 13/11/2013
Sirolimus EU/3/15/1557 Treatment of tuberous sclerosis Desitin Arzneimittel GmbH 09/10/2015
Sirolimus EU/3/15/1585 Treatment of beta thalassaemia intermedia and major Rare Partners srl Impresa Sociale 14/12/2015
Sirolimus EU/3/16/1704 Treatment of sporadic lymphangioleiomyomatosis Best Regulatory Consulting Ltd 14/07/2016
Sirolimus EU/3/17/1886 Treatment of tuberous sclerosis Vale Pharmaceuticals Limited 20/06/2017
Sirolimus EU/3/17/1896 Treatment of pachyonychia congenita Raremoon Consulting Ltd 17/07/2017
Sirolimus EU/3/17/1910 Treatment of tuberous sclerosis Best Regulatory Consulting Ltd 23/08/2017
Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector EU/3/09/630 Treatment of dystrophic epidermolysis bullosa Prof. Alain Hovnanian 30/04/2009
Smilagenin EU/3/11/914 Treatment of amyotrophic lateral sclerosis QRC Consultants Ltd 27/09/2011
(S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate EU/3/15/1606 Treatment of soft tissue sarcoma TMC Pharma Services Ltd 11/01/2016
S-nitrosoglutathione EU/3/11/870 Treatment of pre-eclampsia Salupont Consulting Ltd 13/05/2011
Sodium (1R,3R,4R,5S)-3-({2-N-acetylamino-2-deoxy-3-O-[(1S)-1-carboxylato-2-cyclohexylethyl]-beta-D-galactopyranosyl}oxy)-4-({6-deoxy-alpha-L-galactopyranosyl}oxy)-5-ethyl-cyclohexan-1-yl-(38-oxo-2,5,8,11,14,17,20,23,26,29,32,35-dodecaoxa-39-azahentetracontan-41-yl)carboxamide EU/3/17/1876 Treatment of acute myeloid leukaemia TMC Pharma Services Ltd 22/05/2017
Sodium 2-hydroxylinoleate EU/3/15/1485 Treatment of neuroblastoma Ability Pharmaceuticals SL 24/04/2015
Sodium 2-hydroxylinoleate EU/3/17/1911 Treatment of pancreatic cancer Ability Pharmaceuticals SL 23/08/2017
Sodium (2R,3S,5R)-5-(4-amino-2-oxo-1,3,5-triazin-1(2H)-yl)-2-(hydroxymethyl)tetrahydrofuran-3-yl ((2R,3S,5R)-5-(2-amino-6-oxo-1H-purin-9(6H)-yl)-3-hydroxytetrahydrofuran-2-yl)methyl phosphate EU/3/15/1597 Treatment of acute myeloid leukaemia Otsuka Pharmaceutical Europe Ltd. 14/12/2015
Sodium 3-[(4aR,6R,7R,7aS)-7-hydroxy-2-oxido-2-sulfanylidene-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxaphosphinin-6-yl]-2-bromo-6-phenyl-5H-imidazo[1,2-a]purin-9-one EU/3/15/1462 Treatment of retinitis pigmentosa Universitätsklinikum Tübingen (UKT) 19/03/2015
Sodium acetate salt of the synthetic peptide H-D-Ala-Ser-Pro-Met-Leu-Val-Ala-Tyr-Asp-D-Ala-OH EU/3/14/1294 Treatment for necrotising soft tissue infections FGK Representative Service GmbH 29/07/2014
Sodium ascorbate and menadione sodium bisulfite EU/3/14/1308 Treatment of autosomal dominant polycystic liver disease MCA Regulatory Limited 22/08/2014
Sodium benzoate EU/3/15/1600 Treatment of hyperargininaemia Syri Limited 11/01/2016
Sodium benzoate EU/3/15/1601 Treatment of argininosuccinic aciduria Syri Limited 11/01/2016
Sodium benzoate EU/3/16/1705 Treatment of ornithine transcarbamylase deficiency Lucane Pharma SA 14/07/2016
Sodium benzoate EU/3/16/1706 Treatment of carbamoyl-phosphate synthase-1 deficiency Lucane Pharma SA 14/07/2016
Sodium benzoate EU/3/16/1707 Treatment of citrullinaemia type 1 Lucane Pharma SA 14/07/2016
Sodium benzoate EU/3/16/1708 Treatment of hyperargininaemia Lucane Pharma SA 14/07/2016
Sodium benzoate EU/3/16/1729 Treatment of lysinuric protein intolerance Lucane Pharma SA 29/08/2016
Sodium benzoate EU/3/16/1730 Treatment of ornithine translocase deficiency Lucane Pharma SA 29/08/2016
Sodium benzoate EU/3/16/1787 Treatment of argininosuccinic aciduria Lucane Pharma SA 18/11/2016
Sodium benzoate EU/3/16/1788 Treatment of N-acetylglutamate synthetase deficiency Lucane Pharma SA 18/11/2016
Sodium butyrate (rectal use) EU/3/05/284 Prevention of radiation proctitis Promefarm srl 27/05/2005
Sodium chlorite EU/3/13/1139 Treatment of amyotrophic lateral sclerosis Shore Limited 19/06/2013
Sodium hypochlorite EU/3/16/1709 Treatment of partial deep dermal and full thickness burns Hypo-Stream Ltd 14/07/2016
Sodium nitrite EU/3/12/967 Treatment of pulmonary arterial hypertension FGK Representative Service GmbH 05/03/2012
Sodium nitrite EU/3/13/1224 Treatment of aneurysmal subarachnoid haemorrhage Hope Pharmaceuticals, Ltd 16/01/2014
Sodium nitrite and ethylenediaminetetraacetic acid EU/3/16/1668 Treatment of cystic fibrosis Arch Bio Ireland Ltd 30/05/2016
Sodium phenylbutyrate EU/3/11/948 Treatment of 5q spinal muscular atrophy GMP-Orphan SA 11/01/2012
Sodium phenylbutyrate EU/3/15/1581 Treatment of pyruvate dehydrogenase complex deficiency Fondazione Telethon 11/11/2015
Sodium thiosulfate EU/3/10/848 Treatment of calciphylaxis Dr Franz Köhler Chemie GmbH 23/02/2011
Sodium thiosulfate EU/3/12/979 Treatment of calciphylaxis Aptiv Solutions (UK) Limited 02/04/2012
Sodium thiosulfate EU/3/14/1414 Treatment for calciphylaxis Hope Pharmaceuticals, Ltd 15/01/2015
Sodium valproate EU/3/14/1428 Treatment of Wolfram syndrome Alan Boyd Consultants Ltd 15/01/2015
Soluble recombinant human fibroblast growth factor receptor 3 EU/3/17/1843 Treatment of achondroplasia TherAchon SAS 27/02/2017
Soluble yeast beta-1,3/1,6-glucan EU/3/05/294 Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Biotec Pharmacon ASA 16/06/2005
Somatropin EU/3/00/001 AIDS wasting Merck Serono Europe Limited 08/08/2000
Sorafenib tosylate EU/3/06/364 Treatment of hepatocellular carcinoma Bayer AG 11/04/2006 Nexavar
EU/1/06/342
31/10/2007
Sorafenib tosylate EU/3/13/1199 Treatment of follicular thyroid cancer Bayer AG 13/11/2013 Nexavar
EU/1/06/342
27/05/2014
Sorafenib tosylate EU/3/13/1200 Treatment of papillary thyroid cancer Bayer AG 13/11/2013 Nexavar
EU/1/06/342
27/05/2014
Soraprazan EU/3/13/1208 Treatment of Stargardt’s disease Katairo GmbH 13/11/2013
Sulfonated monophosphorylated mannose oligosaccharide EU/3/11/872 Treatment of hepatocellular carcinoma S-cubed Ltd 21/06/2011
Synthetic 12 amino acids peptide designed after subcommissural organ spondin EU/3/13/1206 Treatment of spinal cord injury Neuronax SAS 13/11/2013
Synthetic 15-amino-acid macrocyclic peptide acylated with a polyethyleneglycol palmitoylated linker EU/3/16/1762 Treatment of paroxysmal nocturnal haemoglobinuria Ra Europe Limited 14/10/2016
Synthetic 47-amino-acid N-myristoylated lipopeptide, derived from the preS region of hepatitis B virus EU/3/15/1500 Treatment of hepatitis delta virus infection MYR GmbH 19/06/2015
Synthetic double-stranded RNA oligonucleotide specific to hydroxyacid oxidase 1 gene EU/3/15/1528 Treatment of primary hyperoxaluria type 1 Dicerna EU Limited 28/07/2015
Synthetic double-stranded short interfering RNA oligonucleotide directed against proopiomelanocortin EU/3/10/798 Treatment of adrenocorticotropin-dependent Cushing's syndrome Diurnal Limited 01/10/2010
Synthetic double-stranded siRNA oligonucleotide directed against antithrombin mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/14/1297 Treatment of haemophilia A Alnylam UK Limited 29/07/2014
Synthetic double-stranded siRNA oligonucleotide directed against antithrombin mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/14/1298 Treatment of haemophilia B Alnylam UK Limited 29/07/2014
Synthetic double-stranded siRNA oligonucleotide directed against delta-aminolevulinic acid synthase 1 mRNA covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/16/1731 Treatment of acute hepatic porphyria Alnylam UK Limited 29/08/2016
Synthetic double-stranded siRNA oligonucleotide directed against hydroxyacid oxidase 1 mRNA and covalently linked to a ligand containing three N-acetylgalactosamine residues EU/3/16/1637 Treatment of primary hyperoxaluria Alnylam UK Limited 21/03/2016
Synthetic double-stranded siRNA oligonucleotide directed against p53 mRNA EU/3/10/751 Prevention of delayed graft function after renal transplantation ProductLife Limited 09/06/2010
Synthetic double-stranded siRNA oligonucleotide directed against the keratin 6a N171K mutation EU/3/13/1141 Treatment of pachyonychia congenita Alan Irvine 19/06/2013
Synthetic double-stranded siRNA oligonucleotide directed against transthyretin mRNA EU/3/11/857 Treatment of transthyretin-mediated amyloidosis Alnylam UK Limited 15/04/2011
Synthetic glucagon analogue modified to contain 7 amino acid substitutions EU/3/17/1887 Treatment of congenital hyperinsulinism Zealand Pharma A/S 20/06/2017
Synthetic hepcidin EU/3/15/1555 Treatment of beta thalassaemia intermedia and major Cogas Pharma Limited 09/10/2015
Synthetic human hepcidin EU/3/16/1789 Treatment of sickle cell disease Cogas Pharma Limited 18/11/2016
Synthetic hypericin EU/3/15/1515 Treatment of cutaneous T-cell lymphoma Kinesys Consulting Ltd 28/07/2015
Synthetic peptide L-cysteine, L-cysteinylglycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-, cyclic (1.fwdarw.17)-disulfide EU/3/15/1549 Treatment of primary graft dysfunction following lung transplantation Apeptico Forschung und Entwicklung GmbH 09/10/2015
Synthetic peptide L-cysteine, L-cysteinylglycyl-L-glutaminyl-L-arginyl-L-.alpha.-glutamyl-L-threonyl-L-prolyl-L-.alpha.-glutamylglycyl-L-alanyl-L-.alpha.-glutamyl-L-alanyl-L-lysyl-L-prolyl-L-tryptophyl-L-tyrosyl-, cyclic (1.fwdarw.17)-disulfide EU/3/15/1591 Treatment of pseudohypoaldosteronism type 1B Apeptico Forschung und Entwicklung GmbH 14/12/2015
Synthetic ribonucleic acid oligonucleotide directed against superoxide dismutase 1 messenger ribonucleic acid EU/3/16/1732 Treatment of amyotrophic lateral sclerosis Biogen Idec Limited 29/08/2016
Synthetic signal peptide of human mucin-1 (amino acids 1-21) EU/3/14/1423 Treatment of plasma cell myeloma Richardson Associates Regulatory Affairs Ltd 15/01/2015
Tacrolimus EU/3/17/1912 Treatment of pulmonary arterial hypertension VIVUS B.V. 23/08/2017
Tadekinig alfa EU/3/16/1763 Treatment of haemophagocytic lymphohistiocytosis Coté Orphan Consulting UK Limited 14/10/2016
tafamidis EU/3/12/1066 Treatment of senile systemic amyloidosis Pfizer Limited 08/11/2012
Talactoferrinum alfa EU/3/07/448 Treatment of renal cell carcinoma Agennix Limited 05/06/2007
Taliglucerase alfa EU/3/10/726 Treatment of Gaucher Disease Pfizer Limited 23/03/2010
Tamoxifen citrate EU/3/17/1877 Treatment of cystic fibrosis GB Pharma Srl 22/05/2017
Tasimelteon EU/3/10/841 Treatment of non-24-hour sleep-wake disorders in blind people with no light perception Vanda Pharmaceuticals Limited 23/02/2011 Hetlioz
EU/1/15/1008
07/07/2015
Tauroursodeoxycholic acid EU/3/17/1844 Treatment of amyotrophic lateral sclerosis Bruschettini s.r.l. 27/02/2017
Teicoplanin EU/3/17/1913 Treatment of cystic fibrosis Neupharma S.r.l. 23/08/2017
Temocillin sodium EU/3/03/183 Treatment of Burkholderia cepacia lung infection in cystic fibrosis Eumedica N.V. 14/01/2004
Temozolomide EU/3/16/1733 Treatment of glioma Double Bond Pharmaceutical AB 29/08/2016
Temsirolimus EU/3/06/365 Treatment of renal cell carcinoma Pfizer Limited 06/04/2006 Torisel
EU/1/07/424
21/11/2007
Temsirolimus EU/3/06/420 Treatment of mantle cell lymphoma Pfizer Limited 06/11/2006 Torisel
EU/1/07/424
25/08/2009
Temsirolimus EU/3/16/1669 Treatment of adrenoleukodystrophy Consorcio Centro de Investigación Biomédica en Red M.P. 30/05/2016
Tenofovir disoproxil fumarate EU/3/14/1419 Treatment of Aicardi-Goutières syndrome Dr Yanick Crow 15/01/2015
Terguride EU/3/07/499 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Ergonex Licensing and Regulatory Services AG 29/11/2007
Terguride EU/3/12/1096 Treatment of systemic sclerosis medac Gesellschaft für klinische Spezialpräparate mbH 24/01/2013
Teriparatide EU/3/16/1689 Treatment of hypoparathyroidism Alacrita LLP 27/06/2016
Tesetaxel EU/3/10/829 Treatment of gastric cancer Genta Development Limited 17/12/2010
Tetrahydrobiopterin EU/3/04/199 Treatment of hyperphenylalaninemia BioMarin International Limited 08/06/2004 Kuvan
EU/1/08/481
04/12/2008
Tetrofosmin EU/3/16/1764 Diagnosis of glioma ProActina 14/10/2016
TGF-beta2 specific phosphorothioate antisense oligodeoxynucleotide EU/3/02/091 Treatment of high-grade glioma Dr Ulrich Granzer 22/03/2002
Thalidomide EU/3/01/067 Treatment of multiple myeloma Celgene Europe Limited 20/11/2001 Thalidomide Celgene
EU/1/08/443
18/04/2008
Thalidomide EU/3/17/1845 Treatment of hereditary haemorrhagic telangiectasia PlumeStars s.r.l. 27/02/2017
Thiotepa EU/3/06/424 Conditioning treatment prior to haematopoietic progenitor cell transplantation ADIENNE S.r.l. 29/01/2007 Tepadina
EU/1/10/622
17/03/2010
Three chimeric human/murine monoclonal antibodies against the Ebola (Zaire) surface glycoprotein EU/3/15/1558 Treatment for Ebola virus disease Dr Stefan Blesse 09/10/2015
Thymalfasin EU/3/02/110 Treatment of hepatocellular carcinoma SciClone Pharmaceuticals Italy S.r.l 30/07/2002
Thymidine and deoxycytidine EU/3/17/1870 Treatment of mitochondrial DNA depletion syndrome, myopathic form Vall d'Hebron Institute of Research 20/04/2017
Tideglusib EU/3/15/1452 Treatment of fragile X syndrome AMO Pharma Ltd 19/03/2015
Tipifarnib EU/3/05/269 Treatment of acute myeloid leukaemia TMC Pharma Services Ltd 10/03/2005
Tirapazamine EU/3/17/1897 Treatment of hepatocellular carcinoma PhaRA bvba 17/07/2017
Tivantinib EU/3/13/1202 Treatment of hepatocellular carcinoma Daiichi Sankyo Europe GmbH 13/11/2013
Tobramycin (inhalation powder) EU/3/03/140 Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Novartis Europharm Limited 17/03/2003 TOBI Podhaler
EU/1/10/652
25/07/2011
Tolfenamic acid EU/3/16/1613 Treatment of progressive supranuclear palsy RV Developpement 17/02/2016
Tolfenamic acid EU/3/16/1614 Treatment of behavioural variant frontotemporal dementia RV Developpement 17/02/2016
Topotecan hydrochloride (liposomal) EU/3/08/562 Treatment of glioma Dr Matthias Luz 05/09/2008
Tosedostat EU/3/09/659 Treatment of acute myeloid leukaemia Voisin Consulting S.A.R.L. 24/07/2009
Trabectedin EU/3/03/171 Treatment of ovarian cancer Pharma Mar S.A. 17/10/2003 Yondelis
EU/1/07/417
30/10/2009
Trabedersen EU/3/09/660 Treatment of pancreatic cancer Dr Ulrich Granzer 24/07/2009
Tranilast EU/3/10/756 Prevention of scarring post glaucoma filtration surgery Altacor Ltd 27/07/2010
Trans-4-[4-[5-[[6-(trifluoromethyl)-3-pyridinyl]amino]-2-pyridinyl]phenyl] cyclohexane acetic acid sodium salt EU/3/12/1036 Treatment of familial chylomicronaemia syndrome (type I hyperlipoproteinaemia) Novartis Europharm Limited 14/09/2012
Trans-N1-((1R,2S)-2-phenylcyclopropyl)cyclohexane-1,4-diamine bis-hydrochloride EU/3/13/1174 Treatment of acute myeloid leukaemia Roche Registration Limited 05/08/2013
Trans-resveratrol EU/3/16/1827 Treatment of spinocerebellar ataxia Luis Pereira de Almeida 12/01/2017
Trebananib EU/3/13/1207 Treatment of ovarian cancer Amgen Europe B.V. 13/11/2013
Trehalose EU/3/15/1496 Treatment of oculopharyngeal muscular dystrophy Dr Ulrich Granzer 21/05/2015
Trehalose EU/3/15/1502 Treatment of spinocerebellar ataxia Dr Ulrich Granzer 19/06/2015
Treosulfan EU/3/04/186 Conditioning treatment prior to haematopoietic progenitor cell transplantation medac Gesellschaft für klinische Spezialpräparate mbH 23/02/2004
Treprostinil diethanolamine EU/3/09/635 Treatment of systemic sclerosis United Therapeutics Europe Ltd 15/05/2009
Treprostinil diethanolamine (oral use) EU/3/05/310 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 26/08/2005
Treprostinil sodium EU/3/13/1103 Treatment of chronic thromboembolic pulmonary hypertension SciPharm S.a.r.L 08/02/2013
Treprostinil sodium (inhalation use) EU/3/04/197 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 14/04/2004
Tretazicar EU/3/08/529 Treatment of visceral leishmaniasis Morvus Technology Limited 04/02/2008
Triamcinolone acetonide EU/3/15/1490 Treatment of non-infectious uveitis S-cubed Ltd 21/05/2015
Trientine dihydrochloride EU/3/03/172 Treatment of Wilson's disease Univar BV 24/10/2003
Triheptanoin EU/3/15/1495 Treatment of glucose transporter type-1 deficiency syndrome Ultragenyx UK Limited 21/05/2015
Triheptanoin EU/3/15/1508 Treatment of very long-chain acyl-CoA dehydrogenase deficiency Ultragenyx UK Limited 19/06/2015
Triheptanoin EU/3/15/1524 Treatment of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency Ultragenyx UK Limited 28/07/2015
Triheptanoin EU/3/15/1525 Treatment of mitochondrial trifunctional protein deficiency Ultragenyx UK Limited 28/07/2015
Triheptanoin EU/3/15/1526 Treatment of carnitine palmitoyltransferase II deficiency Ultragenyx UK Limited 28/07/2015
Triheptanoin EU/3/16/1710 Treatment of McArdle’s disease Vall d'Hebron Institute of Research 14/07/2016
Tripotassium citrate monohydrate and potassium hydrogen carbonate EU/3/17/1888 Treatment of distal renal tubular acidosis Advicenne Pharma SA 20/06/2017
Two allogenic irradiated pancreatic tumour cell lines EU/3/15/1604 Treatment of pancreatic cancer Aduro Biotech Holdings, Europe B.V. 11/01/2016
Type I native bovine skin collagen EU/3/08/607 Treatment of systemic sclerosis arGentis Autoimmune Europe Limited 09/02/2009
Tyr-Gly-Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-Arg-Gly-Gly-Asp-Leu-Leu-Pro-Arg-Gly-Ser EU/3/16/1790 Treatment of Huntington’s disease Dr Ulrich Granzer 18/11/2016
Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu, Ser-Gly-Gln-Ala-Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu-Pro-Ser-Cys-Leu-Glu-Ser, Arg-Ser-Asp-Glu-Leu-Val-Arg-His-His-Asn-Met-His-Gln-Arg-Asn-Met-Thr-Lys-Leu and Pro-Gly-Cys-Asn-Lys-Arg-Tyr-Phe-Lys-Leu-Ser-His-Leu-Gln-Met-His-Ser-Arg-Lys-His-Thr-Gly EU/3/16/1655 Treatment of acute myeloid leukaemia SELLAS Life Sciences Group UK, Limited 28/04/2016
Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu, Ser-Gly-Gln-Ala-Tyr-Met-Phe-Pro-Asn-Ala-Pro-Tyr-Leu-Pro-Ser-Cys-Leu-Glu-Ser, Arg-Ser-Asp-Glu-Leu-Val-Arg-His-His-Asn-Met-His-Gln-Arg-Asn-Met-Thr-Lys-Leu and Pro-Gly-Cys-Asn-Lys-Arg-Tyr-Phe-Lys-Leu-Ser-His-Leu-Gln-Met-His-Ser-Arg-Lys-His-Thr-Gly EU/3/16/1656 Treatment of malignant mesothelioma SELLAS Life Sciences Group UK, Limited 28/04/2016
Ubenimex EU/3/16/1638 Treatment of pulmonary arterial hypertension Eiger Biopharmaceuticals Europe Limited 21/03/2016
Ubiquinol EU/3/16/1765 Treatment of primary coenzyme Q10 deficiency syndrome Consorcio Centro de Investigación Biomédica en Red M.P. 14/10/2016
Udenafil EU/3/16/1807 Treatment of functional single ventricle congenital heart disease Mapi Ireland Limited 12/12/2016
Ulinastatin EU/3/14/1318 Treatment of acute pancreatitis BSV BioScience GmbH 22/08/2014
Ulocuplumab EU/3/15/1445 Treatment of acute myeloid leukaemia Bristol-Myers Squibb Pharma EEIG 12/02/2015
Ursodeoxycholic acid EU/3/17/1878 Treatment of Niemann-Pick disease IntraBio Ltd 22/05/2017
Vaccine consisting of 5 survivin peptides with different human leukocyte antigen restrictions EU/3/16/1791 Treatment of ovarian cancer Dr Ulrich Granzer 18/11/2016
Vaccinia GM-CSF/TK-deactivated virus EU/3/09/700 Treatment of hepatocellular carcinoma Transgene S.A. 26/11/2009
Valproic Acid EU/3/16/1734 Treatment of McArdle’s disease Vall d'Hebron Institute of Research 29/08/2016
Valproic acid EU/3/16/1792 Treatment of diffuse large B-cell lymphoma Valcuria AB 18/11/2016
Variant of recombinant human fibroblast growth factor 19 EU/3/14/1329 Treatment of primary biliary cirrhosis Diamond BioPharm Limited 22/08/2014
Variant of recombinant human fibroblast growth factor 19 EU/3/15/1584 Treatment of primary sclerosing cholangitis Diamond BioPharm Limited 14/12/2015
Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar EU/3/04/201 Prevention of stenosis in synthetic grafts used in haemodialysis Finvector Vision Therapies Limited 08/06/2004
Vasoactive Intestinal Peptide EU/3/03/173 Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension mondoBIOTECH Laboratories AG 22/12/2003
Vector based on an adeno-associated virus serotype 2 backbone, pseudo-serotyped with a type 8 capsid, which carries the coding sequence of the human TYMP gene under the control of the human thyroxine binding globulin promoter EU/3/14/1326 Treatment of mitochondrial neurogastrointestinal encephalomyopathy Vall d'Hebron Institute of Research 22/08/2014
Velaglucerase alfa EU/3/10/752 Treatment of Gaucher disease Shire Pharmaceuticals Ireland Limited 09/06/2010 VPRIV
EU/1/10/646
30/08/2010
Veliparib EU/3/10/830 Treatment of ovarian cancer AbbVie Ltd 17/12/2010
Veltuzumab EU/3/09/713 Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 29/01/2010
Vemurafenib EU/3/16/1670 Treatment of Langerhans’ cell histiocytosis Groupe d'étude des histiocytoses 30/05/2016
Vemurafenib EU/3/17/1846 Treatment of Erdheim-Chester disease Groupe d'étude des histiocytoses 27/02/2017
Venetoclax EU/3/16/1617 Treatment of acute myeloid leukaemia AbbVie Ltd 17/02/2016
Venetoclax EU/3/16/1766 Treatment of diffuse large B-cell lymphoma AbbVie Ltd 14/10/2016
Venetoclax EU/3/16/1767 Treatment of multiple myeloma AbbVie Ltd 14/10/2016
Vincristine sulphate liposomes EU/3/08/555 Treatment of acute lymphoblastic leukaemia NDA Regulatory Science Ltd 08/07/2008
Viral vector containing DNA encoding the human SMN protein EU/3/11/876 Treatment of 5q spinal muscular atrophy University of Sheffield 21/06/2011
Voclosporin EU/3/12/1085 Treatment of non-infectious uveitis Granzer Regulatory Consulting & Services 06/12/2012
Volanesorsen sodium EU/3/16/1711 Treatment of familial partial lipodystrophy Ionis USA Limited 14/07/2016
Volasertib EU/3/14/1255 Treatment of acute myeloid leukaemia Boehringer Ingelheim International GmbH 26/03/2014
Vosaroxin EU/3/12/990 Treatment of acute myeloid leukaemia Sunesis Europe Ltd 26/04/2012
Xenon EU/3/15/1483 Treatment of perinatal asphyxia Neuroprotexeon Ltd 24/04/2015
Xenon EU/3/16/1768 Treatment of ischaemia reperfusion injury associated with cardiac arrest Neuroprotexeon Ltd 14/10/2016
Yttrium (90Y) antiferritin polyclonal antibodies EU/3/03/162 Treatment of Hodgkin lymphoma Mablife 02/10/2003
Yttrium (90Y) edotreotide EU/3/08/589 Treatment of gastro-entero-pancreatic neuroendocrine tumours Molecular Insight Limited 04/12/2008
Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 EU/3/08/608 Treatment of pancreatic cancer Immunomedics GmbH 06/02/2009
Yttrium (90Y)-DTPA-radiolabelled chimeric monoclonal antibody against frizzled homologue 10 EU/3/12/994 Treatment of soft tissue sarcoma Laboratoires OncoTherapy Science France, S.A.R.L 25/05/2012
(Z)-3-(3-(3,5-bis(trifluoromethyl)phenyl)-1H-1,2,4-triazol-1-yl)-N'-(pyrazin-2-yl)acrylohydrazide EU/3/14/1313 Treatment of acute myeloid leukaemia Karyopharm Europe GmbH 22/08/2014
(Z)-3-(3-(3,5-bis(trifluoromethyl)phenyl)-1H-1,2,4-triazol-1-yl)-N'-(pyrazin-2-yl)acrylohydrazide EU/3/14/1317 Treatment of diffuse large B-cell lymphoma Karyopharm Europe GmbH 22/08/2014
Zanolimumab EU/3/07/438 Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) TenX Biopharma Ltd 20/03/2007
Zinc gluconate EU/3/16/1793 Treatment of facioscapulohumeral muscular dystrophy Université de Montpellier 18/11/2016
Zoledronic acid EU/3/13/1192 Treatment of complex regional pain syndrome Axsome Therapeutics Limited 07/10/2013
Zoledronic acid EU/3/16/1735 Treatment of glioma Laboratorio Italiano Biochimico Farmaceutico Lisapharma S.p.A. 29/08/2016
Zosuquidar trihydrochloride EU/3/06/355 Treatment of acute myeloid leukaemia Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP 17/02/2006