Register of designated Orphan Medicinal Products (by number)

EU Designation Product Designated Orphan Indication Sponsor Designation date Tradename
EU Centralised Nr		 Authorisation date
EU/3/00/001 Somatropin AIDS wasting Serono Europe Ltd. 8/08/2000
EU/3/00/002 Alpha-Galactosidase A Treatment of Fabry disease TKT Europe AB 8/08/2000 Replagal
EU/1/01/189/...		 4/05/2001
EU/3/00/003 Alpha-Galactosidase A Treatment of Fabry disease Genzyme Europe B.V. 8/08/2000 Fabrazyme
EU/1/01/188/...		 4/05/2001
EU/3/00/005 Gemtuzumab Ozogamicin Treatment of acute myeloid leukaemia Wyeth Europa Ltd. 18/10/2000
EU/3/00/006 1,5-(Butylimino)-1,5-dideoxy, D-glucitol Treatment of Gaucher Disease Oxford GlycoSciences (UK) Ltd 18/10/2000 Zavesca
EU/1/02/238/...		 20/11/2002
EU/3/00/007 N-carbamyl-L-glutamic acid Treatment of N-acetylglutamate synthetase (NAGS) deficiency Orphan Europe S.a.r.l. 18/10/2000 Carbaglu
EU/1/02/246/...		 24/01/2003
EU/3/00/008 Arsenic trioxide Treatment of acute promyelocytic leukaemia Cephalon Europe 18/10/2000 Trisenox
EU/1/02/204/...		 5/03/2002
EU/3/00/010 Anagrelide Hydrochloride Treatment of essential thrombocythaemia Shire Pharmaceutical Development Ltd 29/12/2000 Xagrid
EU/1/04/295/...		 16/11/2004
EU/3/00/011 Busulfan (Intravenous use) Conditioning treatment prior to hematopoietic progenitor cell transplantation Pierre Fabre Médicament 29/12/2000 Busilvex
EU/1/03/254/...		 9/07/2003
EU/3/00/012 Nitisinone Treatment of tyrosinaemia type I Swedish Orphan International AB 29/12/2000 Orfadin
EU/1/04/303/...		 21/02/2005
EU/3/00/013 Ethyl Eicosopentaenoate Treatment of Huntington’s disease Amarin Neuroscience Limited 29/12/2000
EU/3/00/014 Iloprost Treatment of primary and of the following forms of secondary pulmonary hypertension: connective tissue disease pulmonary hypertension, drug-induced pulmonary hypertension, portopulmonary hypertension, pulmonary hypertension associated with congenital heart disease, chronic thromboembolic pulmonary hypertension Bayer Schering Pharma AG 29/12/2000 Ventavis
EU/1/03/255/...		 16/09/2003
EU/3/00/015 Xaliproden hydrochloride Treatment of amyotrophic lateral sclerosis Sanofi-Aventis 17/01/2001
EU/3/00/018 Recombinant human acid alpha-glucosidase

Treatment of Glycogen Storage Disease type II (Pompe´s disease) Genzyme Europe B.V. 14/02/2001 Myozyme
EU/1/06/333/...		 29/03/2006
EU/3/01/019 Bosentan Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Actelion Registration Limited 14/02/2001 Tracleer
EU/1/02/220/...		 15/05/2002
EU/3/01/020 Ibuprofen Treatment of patent ductus arteriosus Orphan Europe S.a.r.l. 14/02/2001 Pedea
EU/1/04/284/...		 29/07/2004
EU/3/01/021 Imatinib mesylate

 Treatment of chronic myeloid leukaemia Novartis Europharm Limited 14/02/2001 Glivec
EU/1/01/198/...		 27/08/2001
EU/3/01/022 Laronidase Treatment of Mucopolysaccharidosis, type I Genzyme Europe B.V. 14/02/2001 Aldurazyme
EU/1/03/253/...		 10/06/2003
EU/3/01/023 Pegvisomant

Treatment of acromegaly Pfizer Ltd 14/02/2001 Somavert
EU/1/02/240/...		 13/11/2002
EU/3/01/025 N-acetylgalactosamine-4-sulfatase

 Treatment of Mucopolysaccharidosis, type VI (Maroteaux-Lamy Syndrome) BioMarin Europe Ltd 14/02/2001 Naglazyme
EU/1/05/324/...		 24/01/2006
EU/3/01/026 L-Lysine-N-acetyl-L-cysteinate

 Treatment of cystic fibrosis SMB Technology SA 14/02/2001
EU/3/01/028 Inolimomab Treatment of Graft versus Host Disease EUSA Pharma SAS 5/03/2001
EU/3/01/031 Arsenic Trioxide Treatment of myelodysplastic syndromes Cephalon Europe 29/03/2001
EU/3/01/032 Arsenic Trioxide Treatment of multiple myeloma Cephalon Europe 29/03/2001
EU/3/01/033 Ranpirnase Treatment of malignant mesothelioma MoRa Pharma GmbH 29/03/2001
EU/3/01/034 Gusperimus trihydrochloride

 Treatment of Wegener´s granulomatosis Euro Nippon Kayaku GmbH 29/03/2001
EU/3/01/035 Levodopa and Carbidopa (Gastroenteral use)

 Treatment of advanced idiopathic Parkinson´s disease with severe motor fluctuations and not responding to oral treatment Solvay Pharmaceuticals GmbH 10/05/2001
EU/3/01/036 Recombinant human C1-inhibitor Treatment of angioedema caused by C1 inhibitor deficiency Pharming Group N.V. 11/05/2001
EU/3/01/038 Retroviral gamma-c cDNA containing vector Treatment of Severe Combined Immunodeficiency (SCID)-Xl Disease GENOPOIETIC S.A.S. 30/05/2001
EU/3/01/039 Ecteinascidin 743 Treatment of soft tissue sarcoma PharmaMar S.A. 30/05/2001 Yondelis
EU/1/07/417/...		 17/09/2007
EU/3/01/044 Human Alpha1-Proteinase Inhibitor (respiratory use) Treatment of emphysema secondary to congenital alpha 1-antitrypsin deficiency CSL Behring GmbH 9/07/2001
EU/3/01/045 Betaine anhydrous Treatment of homocystinuria Orphan Europe S.a.r.l. 9/07/2001 Cystadane
EU/1/06/379/...		 15/02/2007
EU/3/01/048 Ziconotide (intraspinal use) Treatment of chronic pain requiring intraspinal analgesia Eisai Limited 9/07/2001 Prialt
EU/1/04/302/...		 21/02/2005
EU/3/01/049 Ramoplanin Prevention of invasive infections due to Vancomycin Resistant Enterococci (VRE) in colonised patients deemed at risk of infection Vicuron Pharmaceuticals Italy srl, 9/07/2001
EU/3/01/050 Zinc acetate dihydrate Treatment of Wilson´s disease Orphan Europe S.a.r.l. 31/07/2001 Wilzin
EU/1/04/286/...		 13/10/2004
EU/3/01/051 1,3-Propanedisulfonic acid, disodium salt Treatment of Systemic Secondary Amyloidosis Neurochem Luxco II S.A.R.L. 31/07/2001
EU/3/01/054 Sinapultide, dipalmitoylfosfatidylcholine, palmitoyloleoyl fosfatidylglycerol and palmitic acid Treatment of Meconium Aspiration Syndrome Discovery Laboratories Inc. 19/09/2001
EU/3/01/055 Cladribine (subcutaneous use) Treatment of indolent non-Hodgkin´s lymphoma Lipomed GmbH 18/09/2001 Litak
EU/1/04/275/...		 14/04/2004
EU/3/01/056 Recombinant human acid sphingomyelinase Treatment of Niemann-Pick Disease, type B Genzyme Europe B.V. 19/09/2001
EU/3/01/058 Repertaxin L-lysine salt

 Prevention of delayed graft function in organ transplant Dompé s.p.a. 19/09/2001
EU/3/01/059 Dexrazoxane Treatment of anthracycline extravasations TopoTarget A/S 19/09/2001 Savene
EU/1/06/350/...		 28/07/2006
EU/3/01/061 Imatinib mesilate Treatment of malignant gastrointestinal stromal tumours Novartis Europharm Limited 20/11/2001
EU/3/01/062 Idebenone Treatment of Friedreich’s ataxia Laboratoires Takeda 20/11/2001
EU/3/01/063 Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) Treatment of chronic lymphocytic leukaemia Voisin Consulting S.A.R.L. 20/11/2001
EU/3/01/064 Abetimus sodium Treatment of lupus nephritis La Jolla Limited 20/11/2001
EU/3/01/065 Deoxyribose phosphorothioate (5´-tct-ccc-agc-gtg-cgc-cat-3´) Treatment of multiple myeloma Voisin Consulting S.A.R.L. 20/11/2001
EU/3/01/066 Thalidomide Treatment of erythema nodosum leprosum (ENL) or type II lepra reactions Pharmion Limited 20/11/2001
EU/3/01/067 Thalidomide Treatment of multiple myeloma Pharmion Limited 20/11/2001 Thalidomide Celgene
EU/1/08/443/...		 16/04/2008
EU/3/01/069 Phenylephrine Hydrochloride Treatment of ileal pouch anal anastomosis related faecal incontinence S.L.A. Pharma (UK) Limited 20/11/2001
EU/3/01/070 Celecoxib Treatment of Familial Adenomatous Polyposis Pfizer Limited 20/11/2001 Onsenal
EU/1/03/259/...		 17/10/2003
EU/3/01/071 Stiripentol Treatment of severe myoclonic epilepsy in infancy Biocodex 5/12/2001 Diacomit
EU/1/06/367/...		 4/01/2007
EU/3/01/073 Recombinant human monoclonal antibody to hsp90 Treatment of invasive fungal infections Novartis Europharm Limited 5/12/2001
EU/3/01/074 Halofuginone Hydrobromide Treatment of systemic sclerosis PPD Global Ltd 11/12/2001
EU/3/01/075 Denileukin diftitox Treatment of cutaneous T-cell lymphoma Eisai Limited 11/12/2001
EU/3/01/077 [gly2] Recombinant human glucagon-like peptide Treatment of Short Bowel Syndrome Nycomed Danmark ApS 11/12/2001
EU/3/01/078 Iduronate-2-sulfatase Treatment of Mucopolysaccharidosis, type II (Hunter Syndrome) TKT Europe AB 11/12/2001 Elaprase
EU/1/06/365/...		 8/01/2007
EU/3/01/079 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Treatment of acute lung injury Discovery Laboratories Inc. 4/02/2002
EU/3/01/081 Fumagillin Treatment of diarrhoea associated with intestinal microsporidial infection Sanofi-Aventis 4/02/2002
EU/3/01/082 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine Treatment of acute lymphoblastic leukaemia Genzyme Europe B.V. 5/02/2002 Evoltra
EU/1/06/334/...		 29/05/2006
EU/3/01/083 Adenovirus-mediated Herpes Simplex Virus-thymidine kinase gene Treatment of high-grade glioma with subsequent use of ganciclovir sodium Ark Therapeutics Ltd 6/02/2002
EU/3/01/084 Azacitidine Treatment of myelodysplastic syndromes Celgene Europe Limited 6/02/2002
EU/3/02/085 Carmustine (solution for intratumoral injection) Treatment of glioma Icon Clinical Research UK Ltd 5/03/2002
EU/3/02/086 Porfimer sodium (for use with photodynamic therapy) Treatment of high-grade dysplasia in Barrett´s Esophagus Axcan Pharma International BV 6/03/2002 PhotoBarr
EU/1/04/272/...		 25/03/2004
EU/3/02/088 Colistimethate sodium Treatment of Pseudomonas aeruginosa lung infection (including colonisation) in cystic fibrosis Forest Laboratories UK Ltd 19/02/2002
EU/3/02/091 TGF-ß2 specific phosphorothioate antisense oligodeoxynucleotide Treatment of high-grade glioma Antisense Pharma GmbH 22/03/2002
EU/3/02/092 4-(3,5-bis-(hydroxy-phenyl)-1,2,4) triazol-1-yl)-benzoic acid Treatment of chronic iron overload requiring chelation therapy Novartis Europharm Limited 13/03/2002 Exjade
EU/1/06/356/...		 28/08/2006
EU/3/02/093 Beclomethasone 17, 21-dipropionate (oral use) Treatment of intestinal graft-versus-host disease DOR BIOPHARMA UK Ltd 13/03/2002
EU/3/02/094 Chimeric IgG monoclonal antibody cG250 Treatment of renal cell carcinoma Wilex AG 19/03/2002
EU/3/02/095 Iodine (131I) chimeric IgG monoclonal antibody cG250 Treatment of renal cell carcinoma Wilex AG 19/03/2002
EU/3/02/096 Nitisinone Treatment of alkaptonuria Swedish Orphan International AB 13/03/2002
EU/3/02/098 Epothilone B Treatment of ovarian cancer Novartis Europharm Limited 22/03/2002
EU/3/02/100 Recombinant human alpha-1 antitrypsin Treatment of emphysema secondary to congenital alpha-1-antitrypsin deficiency Fulcrum Pharma (Europe) Ltd 30/04/2002
EU/3/02/101 Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein Treatment of glioma PPD Global Ltd 30/04/2002
EU/3/02/102 Mitotane Treatment of adrenal cortical carcinoma Laboratoire HRA Pharma 12/06/2002 Lysodren
EU/1/04/273/...		 28/04/2004
EU/3/02/103 Recombinant Human Porphobilinogen Deaminase Treatment of acute intermittent porphyria Zymenex A/S 12/06/2002
EU/3/02/104 Miltefosine Treatment of visceral leishmaniasis Zentaris GmbH 12/06/2002
EU/3/02/106 Antisense NF-kappaB p65 Oligonucleotide Treatment of active ulcerative colitis InDex Pharmaceuticals AB 30/07/2002
EU/3/02/107 Purified bromelain Treatment of partial deep dermal and full thickness burns Professor Keith Judkins 30/07/2002
EU/3/02/109 Oregovomab Treatment of ovarian cancer ViRexx International Corp. Limited 30/07/2002
EU/3/02/110 Thymalfasin Treatment of hepatocellular carcinoma SciClone Pharmaceuticals Italy S.r.l 30/07/2002
EU/3/02/111 Benzoic acid, sodium salt Treatment of non-ketotic hyperglycinaemia Ethicare GmbH 11/09/2002
EU/3/02/115 (-)-17-(cyclopropylmethyl)-3,14 ß-dihydroxy-4,5 a-epoxy-6ß-[N-methyl-trans-3-(3-furyl) acrylamido] morphinan hydrochloride (intravenous use) Treatment of uremic pruritus Toray International U.K. Limited 11/09/2002
EU/3/02/116 Autologous renal cell tumor vaccine Treatment of renal cell carcinoma Liponova GmbH 21/10/2002
EU/3/02/118 Recombinant glycoprotein gp350 of Epstein-Barr virus Prevention of post transplantation lympho-proliferative disorders Henogen S.A. 22/10/2002
EU/3/02/119 Iodine (¹³¹I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody Treatment of glioma Interface International Consultancy Limited 13/11/2002
EU/3/02/120 Duramycin Treatment of cystic fibrosis AOP Orphan Pharmaceuticals AG 13/11/2002
EU/3/02/121 5-aminolevulinic acid hydrochloride Intra-operative photodynamic diagnosis of residual glioma Medac Gesellschaft für klinische Spezialpräparate mbH 13/11/2002 Gliolan
EU/1/07/413/...		 7/09/2007
EU/3/02/122 Etilefrin Treatment of low flow priapism Laboratoires SERB 13/11/2002
EU/3/02/124 3,4-diaminopyridine phosphate Treatment of Lambert-Eaton myasthenic syndrome EUSA Pharma SAS 18/12/2002
EU/3/02/125 Monoclonal antibody to human interleukin-6 Treatment of post-transplant lymphoproliferative disorders EUSA Pharma SAS 18/12/2002
EU/3/02/126 Recombinant inhibitor of human plasma kallikrein treatment of angioedema Dyax s.a. 18/12/2002
EU/3/02/127 Cholic acid Treatment of inborn errors in primary bile acid synthesis Laboratoires C.T.R.S 18/12/2002
EU/3/02/128 Carboxypeptidase G2 Adjunctive treatment in patients at risk of methotrexate toxicity Enact Pharma PLC 3/02/2003
EU/3/02/129 G17(9) gastrin-diphtheria toxoid conjugate Treatment of pancreatic cancer Cato Europe GmbH 24/01/2003
EU/3/02/130 G17(9) gastrin-diphtheria toxoid conjugate Treatment of gastric cancer Cato Europe GmbH 28/01/2003
EU/3/02/131 Sodium oxybate Treatment of narcolepsy UCB Pharma Ltd. 3/02/2003 Xyrem
EU/1/05/312/...		 13/10/2005
EU/3/03/132 Caffeine citrate Treatment of primary apnoea of premature newborns Chiesi Farmaceutici S.P.A. 17/02/2003 Nymusa
EU/1/09/528/...		 2/07/2009
EU/3/03/133 Icatibant acetate treatment of angioedema Jerini AG 17/02/2003 Firazyr
EU/1/08/461/...		 11/07/2008
EU/3/03/134 Iodine (123I) Serum Amyloid P Diagnosis of the extent of histologically proven amyloidosis Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. 14/02/2003
EU/3/03/135 Decitabine Treatment of myelodysplastic syndromes Janssen-Cilag International NV 14/02/2003
EU/3/03/136 Iodine (¹³¹I) tositumomab Treatment of follicular lymphoma GlaxoSmithKline Research & Development Limited 14/02/2003
EU/3/03/137 Tositumomab Treatment of follicular lymphoma GlaxoSmithKline Research & Development Limited 14/02/2003
EU/3/03/138 a -1-acid glycoprotein Treatment of tricyclic antidepressants poisoning Bio Products Laboratory 20/03/2003
EU/3/03/139 Bosentan Treatment of systemic sclerosis Actelion Registration Limited 17/03/2003
EU/3/03/140 Tobramycin (inhalation powder) ?reatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Chiron Corporation Ltd 17/03/2003
EU/3/03/141 2-chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine Treatment of acute myeloid leukaemia Genzyme Europe BV 8/05/2003
EU/3/03/142 Iodine (131I) anti-CEA sheep-human chimeric monoclonal antibody Treatment of pancreatic cancer Xenova Biomedix Limited 7/05/2003
EU/3/03/144 Liarozole Treatment of congenital ichthyoses Barrier Therapeutics NV 10/06/2003
EU/3/03/145 Rubitecan Treatment of pancreatic cancer Eurogen Pharmaceuticals Limited 10/06/2003
EU/3/03/148 Chimeric-anti-interleukin-6 monoclonal antibody Treatment of renal cell carcinoma Centocor B.V. 30/06/2003
EU/3/03/149 Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate Treatment of pancreatic cancer in combination with ifosfamide Ziel Biopharma Limited 30/06/2003
EU/3/03/150 Adenovirus-Interferon gamma – coding DNA sequence Treatment of cutaneous T-cell lymphoma Transgene S.A. 9/07/2003
EU/3/03/151 Aplidine Treatment of acute lymphoblastic leukaemia Pharma Mar SA Sociedad Unipersonal 9/07/2003
EU/3/03/153 Herpes simplex virus lacking infected cell protein 34.5 Treatment of glioma Crusade Laboratories Limited 9/07/2003
EU/3/03/154 Hydroxyurea Treatment of sickle cell syndrome Addmedica 9/07/2003 Siklos
EU/1/07/397/...		 29/06/2007
EU/3/03/155 Murine anti-idiotypic antibody against OC125 antibody against CA125 antigen Treatment of ovarian cancer Menarini Ricerche S.p.A. 9/07/2003
EU/3/03/156 Prasterone Treatment of adrenal insufficiency Medicom Healthcare BV 28/07/2003
EU/3/03/157 Recombinant dog gastric lipase Treatment of cystic fibrosis Meristem Therapeutics S.A. 9/07/2003
EU/3/03/158 Recombinant Human Arylsulfatase A Treatment of metachromatic leukodystrophy Shire Pharmaceuticals Ireland Limited 9/07/2003
EU/3/03/160 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Treatment of retinopathy of prematurity Gene Signal SAS 2/10/2003
EU/3/03/161 Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Treatment of neovascular glaucoma Gene Signal SAS 2/10/2003
EU/3/03/162 Yttrium (90Y) antiferritin polyclonal antibodies Treatment of Hodgkin lymphoma Monoclonal Antibodies Therapeutics (MAT) 2/10/2003
EU/3/03/163 5,6,7,8-Tetrahydrobiopterin Treatment of hyperphenylalaninemia Orphanetics Pharma Entwicklungs GmbH 2/10/2003
EU/3/03/164 a-1-acid glycoprotein Treatment of cocaine poisoning Bio Products Laboratory 2/10/2003
EU/3/03/166 Eculizumab Treatment of paroxysmal nocturnal haemoglobinuria Alexion Europe S.A.S. 17/10/2003 Soliris
EU/1/07/393/...		 20/06/2007
EU/3/03/168 Herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes adjunctive treatment in hematopoietic cell transplantation MolMed SpA 20/10/2003
EU/3/03/169 Human immunoglobulin Treatment of dermatomyositis Orfagen 20/10/2003
EU/3/03/170 Human immunoglobulin Treatment of polymyositis Orfagen 24/10/2003
EU/3/03/171 Trabectedin Treatment of ovarian cancer Pharmamar S.A. Sociedad Unipersonal 17/10/2003
EU/3/03/172 Trientine dihydrochloride Treatment of Wilson´s disease Univar Limited 24/10/2003
EU/3/03/173 Vasoactive intestinal peptide Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Biogen Idec Limited 22/12/2003
EU/3/03/174 Gimatecan Treatment of glioma Sigma Tau Industrie Farmaceutiche Riunite S.p.A 1/12/2003
EU/3/03/175 Recombinant antibody derivative against human CD19 and CD3 Treatment of mantle cell lymphoma Micromet AG 1/12/2003
EU/3/03/176 Recombinant antibody derivative against human CD19 and CD3 Treatment of chronic lymphocytic leukaemia Micromet AG 1/12/2003
EU/3/03/177 3-(4´aminoisoindoline-l´-one)-1-piperidine-2,6-dione Treatment of multiple myeloma Celgene Europe Limited 12/12/2003 Revlimid
EU/1/07/391/...		 14/06/2007
EU/3/03/178 Sildenafil citrate Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Pfizer Ltd 12/12/2003 Revatio
EU/1/05/318/...		 28/10/2005
EU/3/03/178 Sildenafil citrate Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Pfizer Ltd 12/12/2003 Revatio
EU/1/05/318/...		 28/10/2005
EU/3/03/179 Recombinant human factor XIII (composed of two A subunits) Treatment of hereditary factor XIII deficiency Novo Nordisk A/S 12/12/2003
EU/3/03/182 5-methyl-pyridine-2-sulfonic acid {6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt Treatment of aneurysmal subarachnoid haemorrhage Axovan Europe Ltd 12/12/2003
EU/3/03/183 Temocillin sodium Treatment of Burkholderia cepacia lung infection in cystic fibrosis Belpharma N.V 14/01/2004
EU/3/03/184 Cilengitide Treatment of glioma Merck KGaA 14/01/2004
EU/3/03/185 Tacrolimus hydrate Treatment of vernal keratoconjunctivitis Sucampo Pharma Europa Ltd 14/01/2004
EU/3/04/186 Treosulfan Conditioning treatment prior to haematopoietic progenitor cell transplantation Medac Gesellschaft für klinische Spezialpräparate mbH 23/02/2004
EU/3/04/187 Human monoclonal hepatitis B immunoglobulins Prevention of hepatitis B re-infection following liver transplantation ICON Clinical Research (UK) Ltd 23/02/2004
EU/3/04/188 N-3[[4(aminoiminomethyl)benzoyl] amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8- quinolinyl)oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) Treatment of moderate and severe traumatic brain injury Xytis Pharmaceuticals Limited 23/02/2004
EU/3/04/189 Idebenone Treatment of Friedreich’s ataxia Santhera Pharmaceuticals (Deutschland) GmbH 8/03/2004
EU/3/04/190 Ethanol (96 per cent ) (gel for injection) Treatment of congenital lymphatic malformations Orfagen 8/03/2004
EU/3/04/191 Ethanol (96 per cent ) (gel for injection) Treatment of congenital venous malformations Orfagen 8/03/2004
EU/3/04/192 3-(4'aminoisoindoline-1'-one)-1-piperidine-2,6-dione Treatment of myelodysplastic syndromes Celgene Europe Limited 8/03/2004
EU/3/04/193 Anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody Treatment of ovarian cancer Fresenius Biotech GmbH 8/03/2004
EU/3/04/194 Adeno-associated viral vector expressing lipoprotein lipase Treatment of lipoprotein lipase deficiency Dr Anthony J. Gringeri 8/03/2004
EU/3/04/195 2-Methoxy-5-[(1Z)-2-(3,4,5-trimethoxyphenyl)ethenyl]-phenol Treatment of anaplastic thyroid cancer Dr David Chaplin 14/04/2004
EU/3/04/197 Treprostinil sodium Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 14/04/2004
EU/3/04/198 Human monoclonal antibody against CD4 Treatment of cutaneous T-cell lymphoma Genmab A/S 14/04/2004
EU/3/04/199 Tetrahydrobiopterin Treatment of hyperphenylalaninemia Merck KGaA 8/06/2004 Kuvan
EU/1/08/481/...		 2/12/2008
EU/3/04/200 (2-aminoethyl) carbamic acid (2R,5S,8S,11S,14R,17S,19aS)-11-(4-aminobutyl)-5-benzyl-8-(4-benzyloxy benzyl)-14-(1H-indol-3-ylmethyl)-4,7,10,13,16,19-hexaoxo-17-phenyloctadecahydro-3a,6,9,12,15,18-hexaazacyclopentacyclooctadecen-2-yl ester, di[(S)-2-aminosu Treatment of functional gastro-entero-pancreatic endocrine tumours Novartis Europharm Limited 8/06/2004
EU/3/04/201 Vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collar Prevention of stenosis in synthetic grafts used in haemodialysis Ark Therapeutics Ltd 8/06/2004
EU/3/04/202 HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor Treatment of MART-1 positive malignant melanoma in HLA-A2 positive patients Cellcure A/S 21/06/2004
EU/3/04/203 5’-CTG CCA CGT TCT CCT GC-

(2’ methoxy)A-(2’ methoxy)C-(2’ methoxy)C-3’

 Treatment of myasthenia gravis PPD Global Ltd 21/06/2004
EU/3/04/204 Aztreonam lysinate (inhalation use) Treatment of gram negative bacteria lung infections in cystic fibrosis Gilead Sciences International Limited 21/06/2004
EU/3/04/205 Suberoylanilide hydroxamic acid Treatment of cutaneous T-cell lymphoma Merck Sharp & Dohme Ltd 21/06/2004
EU/3/04/206 Muramyl tripeptide phosphatidyl ethanolamine Treatment of osteosarcoma IDM Pharma S.A. 21/06/2004
EU/3/04/207 Sorafenib tosylate Treatment of renal cell carcinoma Bayer Schering Pharma AG 29/07/2004 Nexavar
EU/1/06/342/...		 19/07/2006
EU/3/04/208 Acetylsalicylic acid Treatment of polycythemia vera Bayer HealthCare AG 29/07/2004
EU/3/04/209 Ciclosporin (inhalation use) Prevention of graft rejection after lung transplantation PARI Aerosol Research Institute 29/07/2004
EU/3/04/210 Ciclosporin (inhalation use) Treatment of graft rejection after lung transplantation PARI Aerosol Research Institute 29/07/2004
EU/3/04/211 Defibrotide Prevention of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004
EU/3/04/212 Defibrotide Treatment of hepatic veno-occlusive disease Gentium S.p.A. 29/07/2004
EU/3/04/213 Mepolizumab Treatment of hypereosinophilic syndrome Glaxo Group Limited 29/07/2004
EU/3/04/214 Midostaurin Treatment of acute myeloid leukaemia Novartis Europharm Limited 29/07/2004
EU/3/04/215 Porfimer sodium (for use with photodynamic therapy) Treatment of cholangiocarcinoma Axcan Pharma International BV 29/07/2004
EU/3/04/216 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Prevention of respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
EU/3/04/217 Sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid Treatment of respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Pharm Research Associates (UK) Limited 29/07/2004
EU/3/04/218 (R, S)-3-(bromomethyl)-3-butanol-1-yl-diphosphate Treatment of renal cell carcinoma Innate Pharma SAS 29/07/2004
EU/3/04/219 HLA-B27 derived peptide (amino acid 125-138) Treatment of autoimmune uveitis Dr Gerhild Wildner 2/09/2004
EU/3/04/220 Anti epidermal growth factor receptor antibody h-R3 Treatment of glioma Oncoscience AG 2/09/2004
EU/3/04/222 Pancreatic enzymes (cross linked enzyme crystal lipase, protease, amylase) Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Gregory Fryer Associates Ltd 2/09/2004
EU/3/04/223 Heparin sodium Treatment of idiopathic pulmonary fibrosis Prof. Dr Seeger 2/09/2004
EU/3/04/224 Homoharringtonine Treatment of chronic myeloid leukaemia ChemGenex Europe SAS 2/09/2004
EU/3/04/226 Recombinant human interleukin-21 Treatment of renal cell carcinoma Quintiles Limited 2/09/2004
EU/3/04/227 l, 1´-[1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane Treatment to mobilize progenitor cells prior to stem cell transplantation Genzyme Europe B.V. 20/10/2004
EU/3/04/228 Homoharringtonine Treatment of acute myeloid leukaemia ChemGenex Europe SAS 20/10/2004
EU/3/04/229 Doxorubicin polyisohexylcyanoacrylate nanoparticles Treatment of the hepatocellular carcinoma BioAlliance Pharma 21/10/2004
EU/3/04/230 Dexamethasone sodium phosphate encapsulated in human erythrocytes Treatment of cystic fibrosis Sorin Group Italia S.r.l. 20/10/2004
EU/3/04/231 Deferoxamine mesilate Treatment of traumatic spinal cord injury SCT Spinal Cord Therapeutics GmbH 20/10/2004
EU/3/04/232 Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium Treatment of glioma Sigma Tau Industrie Farmaceutiche Riunite S.p.A 20/10/2004
EU/3/04/233 Adeno-associated viral vector containing the human gamma-sarcoglycan gene Treatment of gamma-sarcoglycanopathy Généthon 21/10/2004
EU/3/04/234 Sitaxentan sodium Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Encysive (UK) Limited 21/10/2004 Thelin
EU/1/06/353/...		 10/08/2006
EU/3/04/240 Rufinamide Treatment of Lennox-Gastaut syndrome Eisai Limited 20/10/2004 Inovelon
EU/1/06/378/...		 16/01/2007
EU/3/04/241 Pirfenidone Treatment of idiopathic pulmonary fibrosis Intermune Europe Limited 16/11/2004
EU/3/04/242 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of mastocytosis OxThera AB 16/11/2004
EU/3/04/243 Alpha-1 antitrypsin (inhalation use) Treatment of cystic fibrosis The Weinberg Group L.L.C. 16/11/2004
EU/3/04/244 Alpha-1 antitrypsin (inhalation use) Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency The Weinberg Group L.L.C. 16/11/2004
EU/3/04/245 Aplidine Treatment of multiple myeloma Pharma Mar SA Sociedad Unipersonal 16/11/2004
EU/3/04/246 Eptacog alfa (activated) Treatment of Familial Adenomatous Polyposis TopoTarget Germany AG 30/11/2004
EU/3/04/247 EU/3/04/247 Treatment of multiple myeloma Bristol-Myers Squibb International Corporation 21/12/2004
EU/3/04/248 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of multiple myeloma CellGenix Technologie Transfer GmbH 21/12/2004
EU/3/04/249 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of follicular lymphoma CellGenix Technologie Transfer GmbH 23/12/2004
EU/3/04/250 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of mantle cell lymphoma CellGenix Technologie Transfer GmbH 21/12/2004
EU/3/04/251 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of malignant gastro intestinal stromal tumours Dr Geoffrey Allan 21/12/2004
EU/3/04/256 17-allylamino-17-demethoxygeldanamycin Treatment of chronic myeloid leukemia Bristol-Myers Squibb International Corporation 26/01/2005
EU/3/04/257 Recombinant human bile salt-stimulated lipase Treatment of cystic fibrosis Arexis AB 26/01/2005
EU/3/04/258 L-Asparaginase Treatment of acute lymphoblastic leukaemia Medac Gesellschaft für klinische Spezialpräparate mbH 26/01/2005
EU/3/04/260 Recombinant human alpha-Mannosidase Treatment of alpha-Mannosidosis Zymenex A/S 26/01/2005
EU/3/05/261 Fluocinolone acetonide (prolonged-release intravitreal implant) Treatment of non-infectious uveitis affecting the posterior segment of the eye Bausch & Lomb Ireland 7/03/2005
EU/3/05/262 Titanium dioxide and bisoctrizole Treatment of UV-A and visible light-induced photosensitivity disorders (chronic actinic dermatitis, cutaneous porphyrias, actinic prurigo and solar urticaria) Orfagen 3/03/2005
EU/3/05/263 dimethyl sulfoxide Treatment of severe closed traumatic brain injury AOP Orphan Pharmaceuticals AG 3/03/2005
EU/3/05/264 Cholest-4-en-3-one, oxime Treatment of 5q spinal muscular atrophies Trophos SA 10/03/2005
EU/3/05/265 ciclosporin (inhalation use) Treatment of graft rejection after lung transplantation Chiron Corporation Limited 10/03/2005
EU/3/05/266 Ciclosporin (inhalation use) Prevention of graft rejection after lung transplantation Chiron Corporation Limited (trading as Chiron Biopharmaceuticals) 10/03/2005
EU/3/05/269 Tipifarnib Treatment of acute myeloid leukaemia Janssen-Cilag International NV 10/03/2005
EU/3/05/270 Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex Treatment of renal cell carcinoma Antigenics Therapeutics Limited 11/04/2005
EU/3/05/271 Paromomycin sulphate Treatment of visceral leishmaniasis OneWorld Health 11/04/2005
EU/3/05/272 Histamine dihydrochloride Treatement of acute myeloid leukaemia EpiCept GmbH 11/04/2005 Ceplene
EU/1/08/477/...		 7/10/2008
EU/3/05/273 Ambrisentan Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension European Medical Advisory Services Limited 11/04/2005 Volibris
EU/1/08/451/...		 21/04/2008
EU/3/05/274 melatonin Non-24-Hour Sleep-Wake Disorder in blind people with no light perception ICON Clinical Research (UK) Limited 11/04/2005
EU/3/05/275 Estradiol Hemihydrate and Progesterone Prevention of bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age B. Braun Melsungen AG 11/04/2005
EU/3/05/276 Humanized Agonistic Anti-CD28 Monoclonal Antibody Treatment of B-cell Chronic Lymphocytic Leukaemia (B-CLL) TeGenero AG 11/04/2005
EU/3/05/277 3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid Treatment of cystic fibrosis Voisin Consulting S.A.R.L. 27/05/2005
EU/3/05/278 3-[5-(2-fluoro-phenyl)-[1,2,4]oxadiazole-3-yl]-benzoic acid Treatment of Duchenne muscular dystrophy Voisin Consulting S.A.R.L. 27/05/2005
EU/3/05/279 (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23-tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone Treatment of cutaneous T-cell lymphoma Gloucester Pharmaceuticals Limited 27/05/2005
EU/3/05/280 Acadesine Treatment of B-cell chronic lymphocytic leukemia (B-CLL) Advancell - Advanced In Vitro Cell Technologies, S.A. 27/05/2005
EU/3/05/282 miltefosine Treatment of Acanthamoeba keratitis Orphanidis Pharma Research GmbH 27/05/2005
EU/3/05/283 Recombinant megakaryopoeisis-stimulating protein Treatment of idiopathic thrombocytopenic purpura Amgen Europe B.V. 27/05/2005
EU/3/05/284 Sodium butyrate (rectal use) Prevention of radiation proctitis Promefarm srl 27/05/2005
EU/3/05/285 Bimosiamose disodium Treatment of acute lung injury Revotar Biopharmaceuticals AG 27/05/2005
EU/3/05/286 N-(methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole Treatment of multiple myeloma Dr Geoffrey Allan 20/06/2005
EU/3/05/287 Bovine bile extract Treatment of pancreatic cancer Dr Ulrich Granzer 20/06/2005
EU/3/05/288 4-[3-(methylsulfonyl)phenyl]-1-propylpiperidine x HC1 Treatment of Huntington´s disease NSAB, Filial af NeuroSearch Sweden AB, Sverige 20/06/2005
EU/3/05/289 Pegylated arginine deiminase Treatment of hepatocellular carcinoma Dr Francesco Izzo 20/06/2005
EU/3/05/290 Humanised antibody fragment (Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein Treatment of Ep-CAM-positive squamous cell carcinoma of the head and neck Viventia Biotech (EU) Limited 20/06/2005
EU/3/05/292 H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-D-Thr-D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg-D-Lys-D-Lys-D-Arg-D-Gly-NH2 Treatment of acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Auris Medical Limited 16/06/2005
EU/3/05/293 nelarabine Treatment of acute lymphoblastic leukaemia Glaxo Group Limited 16/06/2005 Atriance
EU/1/07/403/...		 22/08/2007
EU/3/05/294 Soluble yeast beta-1,3/1,6-glucan Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Biotec Pharmacon ASA 16/06/2005
EU/3/05/295 Hepatitis C Immunoglobulin Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 8/07/2005
EU/3/05/295 Hepatitis C Immunoglobulin Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Biotest Pharma GmbH 8/07/2005
EU/3/05/296 Hydrocortisone (modified release tablet) Treatment of congenital adrenal hyperplasia Diurnal Limited 27/07/2005
EU/3/05/297 Adeno-associated viral vector containing a modified U7-snRNA gene Treatment of Duchenne muscular dystrophy Généthon 27/07/2005
EU/3/05/298 Mycophenolate mofetil Treatment of Cushing’s syndrome secondary to ectopic ACTH secretion Laboratoire HRA Pharma 27/07/2005
EU/3/05/299 4-imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one Treatment of pancreatic cancer ICON Clinical Research (UK) Ltd 27/07/2005
EU/3/05/300 Nemorubicin hydrochloride Treatment of hepatocellular carcinoma Nerviano Medical Sciences Srl 28/07/2005
EU/3/05/301 Chimeric monoclonal antibody to shiga-toxin 1 and 2 Treatment of shiga-toxin producing bacterial infection. Albany Regulatory Consulting Ltd 26/08/2005
EU/3/05/302 Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower Treatment of sickle cell disease Xechem UK Ltd 26/08/2005
EU/3/05/303 Human autologous mesenchymal adult stem cells extracted from adipose tissue Treatment of anal fistula CELLERIX S.A. 26/08/2005
EU/3/05/304 Imatinib mesilate Treatment of acute lymphoblastic leukaemia Novartis Europharm Limited 26/08/2005
EU/3/05/305 Imatinib mesilate Treatment of dermatofibrosarcoma protuberans Novartis Europharm Limited 26/08/2005
EU/3/05/307 Mecasermin Treatment of primary growth hormone insensitivity syndrome Ipsen Pharma 26/08/2005
EU/3/05/308 Sapropterin Treatment of hyperphenylalaninemia Dr Gunter Schaub 26/08/2005
EU/3/05/309 Sodium valproate Treatement of 5q muscular atrophy The Jennifer Trust for Spinal Muscular Atrophy 26/08/2005
EU/3/05/310 Treprostinil diethanolamine (oral use) Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension United Therapeutics Europe Ltd 26/08/2005
EU/3/05/312 (1R,2R,4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E, 17E,19E,21S,23S,26R,27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26 ,27,28,29,31,32,33,34,34a-tetra-cos Treatment of soft tissue sarcoma Merck Sharp & Dohme Limited 26/08/2005
EU/3/05/313 Autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency Fondazione Telethon 26/08/2005
EU/3/05/314 (1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol Treatment of tuberculosis Tibotec BVBA 26/08/2005
EU/3/05/315 (2S)-2-[(4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide Treatment of progressive myoclonic epilepsies UCB Pharma SA. 26/08/2005
EU/3/05/316 2-{4-[(5,6-diphenylpyrazin-2-yl)(isopropyl)amino]butoxy}-N-(methylsulfonyl)acetamide Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Actelion Registration Ltd 26/08/2005
EU/3/05/317 A mixture of anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein Treatment of graft-versus-host-disease Henogen S.A. 26/08/2005
EU/3/05/318 Recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A Prevention of tuberculosis disease in BCG vaccinated individuals Emergent Product Development UK Limited 28/10/2005
EU/3/05/319 Human Staphylococcus aureus immunoglobulin Treatment of Staphylococcus aureus bacteremia Biotest Pharma GmbH 28/10/2005
EU/3/05/320 Imatinib mesilate Treatment of chronic eosinophilic leukaemia and the hypereosinophilic syndrome Novartis Europharm Limited 28/10/2005
EU/3/05/321 (1R,2R,4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E, 17E,19E,21S,23S,26R,27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo-1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26 ,27,28,29,31,32,33,34,34a-tetra-cos Treatment of primary malignant bone tumours Merck Sharp & Dohme Limited 28/10/2005
EU/3/05/323 Bacterial lipase Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency Nordmark Arzneimittel GmbH u. Co. KG 7/11/2005
EU/3/05/324 Levamisol hydrochloride Treatment of nephrotic syndrome Addmedica 28/10/2005
EU/3/05/325 Mannitolum Treatment of cystic fibrosis Pharmaxis Pharmaceuticals Limited 7/11/2005
EU/3/05/326 Peptide 144 TGF-beta1-inhibitor (TSLDASIIWAMMQN) Treatment of systemic sclerosis Digna Biotech S.L. 28/10/2005
EU/3/05/327 Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt Treatment of glioma Oligovax 28/10/2005
EU/3/05/328 (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23-tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Gloucester Pharmaceuticals Limited 28/10/2005
EU/3/05/329 Peptide 144 TGF-beta1-inhibitor (TSLDASIIWAMMQN) Treatment of the localised scleroderma Digna Biotech S.L. 28/10/2005
EU/3/05/331 Recombinant microbial lipase Treatment of malasbsorption due to exocrine pancreatic enzyme insufficiency Solvay Pharmaceuticals GmbH 28/10/2005
EU/3/05/332 1,2-bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine Treatment of acute myeloid leukaemia Vion (UK) Limited, ? i3 Research 14/12/2005
EU/3/05/333 Eptacog alfa (activated) Treatment of diffuse alveolar haemorrhage Pharmaorigin ApS 14/12/2005
EU/3/05/334 Human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein Treatment of X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome) Apoxis (UK) Ltd 14/12/2005
EU/3/05/336 Brostallicin Treatment of soft tissue sarcoma AAIPharma S.A. 23/12/2005
EU/3/05/337 Heparin sodium (inhalation use) Treatment of cystic fibrosis Vectura Group plc 23/12/2005
EU/3/05/338 Dasatinib Treatment of acute lymphoblastic leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005
EU/3/05/339 Dasatinib Treatment of chronic myeloid leukaemia Bristol-Myers Squibb Pharma EEIG 23/12/2005 Sprycel
EU/1/06/363/...		 20/11/2006
EU/3/05/340 Imatinib mesilate Treatment of myelodysplastic / myeloproliferative diseases Novartis Europharm Limited 23/12/2005
EU/3/05/341 Imexon Treatment of ovarian cancer ICON Clinical Research (UK) Ltd 23/12/2005
EU/3/05/342 Denufosol tetrasodium Treatment of cystic fibrosis Envestia Limited 23/12/2005
EU/3/05/343 Enzastaurin hydrochloride Treatment of glioma Eli Lilly Nederland B.V. 23/12/2005
EU/3/05/344 Vandetanib Treatment of medullary thyroid carcinoma AstraZeneca UK Limited 24/01/2006
EU/3/05/345 Lentiviral vector containing the human Wiskott Aldrich syndrome protein gene Treatment of Wiskott-Aldrich syndrome Généthon 24/01/2006
EU/3/05/346 E. Coli heat-shock protein 70 with bovine retinal S-antigen Treatment of autoimmune uveitis Biotech Tools SA 24/01/2006
EU/3/06/349 Apomorphine hydrochloride (inhalation use) Treatment of off-periods in Parkinson’s disease not responding to oral treatment Vectura Group plc 16/02/2006
EU/3/06/350 Alpha-1 proteinase inhibitor Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency Octapharma (IP) Limited 16/02/2006
EU/3/06/351 Miglustat Treatment of Niemann-Pick Disease, type C Actelion Registration Ltd 16/02/2006
EU/3/06/352 26 base single stranded phosphodiester DNA oligonucleotide Treatment of pancreatic cancer Antisoma Research Ltd 16/02/2006
EU/3/06/353 26 base single stranded phosphodiester DNA oligonucleotide Treatment of renal cell carcinoma Antisoma Research Ltd 16/02/2006
EU/3/06/354 Oxalobacter formigenes strain HC-1 Treatment of primary hyperoxaluria OxThera AB 17/02/2006
EU/3/06/355 Zosuquidar trihydrochloride Treatment of acute myeloid leukaemia Kanisa Europe Limited, Mofo Notices Limited, C/Morrison & Foerster MNP 17/02/2006
EU/3/06/356 4-amino-5-oxo-4 (pyridinium-1-ylmethyl) proline Treatment of renal cell carcinoma Prodimed S.A. 16/02/2006
EU/3/06/359 Adeno associated viral vector containing the human calpain 3 gene Treatment of calpainopathy Généthon 6/04/2006
EU/3/06/360 Ciclosporin Treatment of vernal keratoconjunctivitis Novagali Pharma SA 6/04/2006
EU/3/06/361 Glutathione Treatment of cystic fibrosis Mukoviszidose e.V. 11/04/2006
EU/3/06/362 Human heterologous liver cells (for infusion) Treatment of acute liver failure Cytonet GmbH & Co. KG 11/04/2006
EU/3/06/363 4-[131I]iodo-L-phenylalanine Treatment of glioma Therapeia GmbH & Co. KG 11/04/2006
EU/3/06/364 Sorafenib tosylate Treatment of hepatocellular carcinoma Bayer Schering Pharma AG 11/04/2006
EU/3/06/365 Temsirolimus Treatment of renal cell carcinoma Wyeth Europa Limited 6/04/2006 TORISEL
EU/1/07/424/...		 19/11/2007
EU/3/06/366 Tobramycin (liposomal) ?reatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Axentis Pharma Limited 11/04/2006
EU/3/06/367 Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex Treatment of solitary bone cysts Kuros Biosurgery International AG 11/04/2006
EU/3/06/368 1-deoxygalactonojirimycin hydrochloride Treatment of Fabry disease Shire Pharmaceutical Development Limited 22/05/2006
EU/3/06/369 Bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix Treatment of epidermolysis bullosa CELLERIX S.A. 22/05/2006
EU/3/06/370 Decitabine Treatment of acute myeloid leukaemia Janssen-Cilag International NV 8/06/2006
EU/3/06/371 Heparin sodium Treatment of cystic fibrosis Ockham Biotech Limited 22/05/2006
EU/3/06/372 Hydrocortisone (modified release tablet) Treatment of adrenal insufficiency DuoCort Pharma AB 22/05/2006
EU/3/06/373 Mecasermin Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects Ipsen Pharma 22/05/2006
EU/3/06/374 Methoxsalen Treatment of Graft-versus-Host disease Johnson & Johnson Medical Ltd 22/05/2006
EU/3/06/375 Nilotinib Treatment of chronic myeloid leukaemia Novartis Europharm Limited 22/05/2006
EU/3/06/376 Recombinant P-selectin glycoprotein immunoglobulin Prevention of post transplantation graft dysfunction RJM Consultancy Ltd 22/05/2006
EU/3/06/379 Diphenylcyclopropenone Treatment of alopecia totalis Orfagen 29/06/2006
EU/3/06/380 Diphenylcyclopropenone Treatment of alopecia universalis Orfagen 29/06/2006
EU/3/06/381 Human monoclonal antibody against Pseudomonas aeruginosa serotype O11 Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa Voisin Consulting 29/06/2006
EU/3/06/382 Pazopanib hydrochloride Treatment of renal cell carcinoma Glaxo Group Limited 29/06/2006
EU/3/06/383 Siplizumab Treatment of T-cell and NK-cell neoplasms MedImmune, LLC 29/06/2006
EU/3/06/384 Human telomerase reverse transcriptase peptide (611-626) Treatment of pancreatic cancer Gemvax A/S 25/07/2006
EU/3/06/386 4-[123I]iodo-L-phenylalanine diagnosis of glioma Therapeia GmbH & Co. KG 25/07/2006
EU/3/06/387 Amikacin sulfate (liposomal) ?reatment of Pseudomonas aeruginosa lung infection in cystic fibrosis Transave Inhalation Biotherapeutics Limited 25/07/2006
EU/3/06/388 Becatecarin Treatment of cancers of the biliary tree Helsinn Birex Pharmaceuticals Ltd 25/07/2006
EU/3/06/389 Lestaurtinib Treatment of acute myeloid leukaemia Cephalon Europe 25/07/2006
EU/3/06/390 4-amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride Treatment of moderate and severe traumatic brain injury vasopharm GmbH 28/08/2006
EU/3/06/391 Amphotericin B (for inhalation use) Prevention of pulmonary fungal infection in patients deemed at risk Nektar Therapeutics UK Ltd 28/08/2006
EU/3/06/392 Human monoclonal antibody against inhibitory killer cell lg-like receptors Treatment of acute myeloid leukaemia Innate Pharma 28/08/2006
EU/3/06/394 Autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin Treatment of follicular lymphoma Analytica International GmbH 28/08/2006
EU/3/06/395 Aviptadil Treatment of acute lung injury mondoBIOTECH Laboratories Anstalt 28/08/2006
EU/3/06/396 Cardiotrophin-1 Prevention of the ischemia/reperfusion injury associated with solid organ transplantation Digna Biotech S.L. 28/08/2006
EU/3/06/397 Cholest-4-en-3-one, oxime Treatment of amyotrophic lateral sclerosis Trophos SA 28/08/2006
EU/3/06/399 Mecasermin rinfabate Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Premacure AB 28/08/2006
EU/3/06/400 Metastable technetium 99 [99mTc] demogastrin 2 Diagnosis of medullary thyroid carcinoma Biomedica Life Sciences S.A. 28/08/2006
EU/3/06/401 N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate Treatment of familial amyloid polyneuropathy FoldRx Pharmaceuticals Limited 28/08/2006
EU/3/06/403 5-(2,6-Difluoro-phenoxy)-3(R,S)-{2(S)-[2(S)-(3-methoxycarbonyl-2(S)-{3-methyl-2(S)-[(quinoline-2-carbonyl)-amino]-butyrylamino}-propionylamino)-3-methyl-butyrylamino]-propionylamino}-4-oxo-pentanoic acid methyl ester Treatment of neonatal brain injury Theraptosis 23/10/2006
EU/3/06/404 Adenoviral vector containing human p53 gene Treatment of Li Fraumeni Syndrome Gendux Molecular Limited 23/10/2006
EU/3/06/405 Genetically modified allogeneic (human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) Treatment of renal cell carcinoma MOLOGEN AG 23/10/2006
EU/3/06/406 Arimoclomol Treatment of amyotrophic lateral sclerosis Wainwright Associates Ltd 26/10/2006
EU/3/06/407 Heparin-binding epidermal growth factor-like growth factor (HB-EGF), amino acids 74-148 Prevention of necrotizing enterocolitis Dr Michael Moore 31/10/2006
EU/3/06/408 Human cytomegalovirus immunoglobulin Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection Biotest Pharma GmbH 31/10/2006
EU/3/06/409 L-asparaginase encapsulated in erythrocytes Treatment of acute lymphoblastic leukaemia Erytech Pharma S.A. 27/10/2006
EU/3/06/410 Doxorubicin hydrochloride (liposomal) Treatment of soft tissue sarcoma GP-Pharm S.A. 27/10/2006
EU/3/06/411 Recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule Prevention of Graft-versus-Host disease Apogenix GmbH 31/10/2006
EU/3/06/412 4,7,10,13,16,19-docosahexaenoic acid Treatment of retinitis pigmentosa Jose Manuel Cela Lopez 3/11/2006
EU/3/06/413 Budesonide (oral use) Treatment of Graft-versus-Host disease Dr Falk, Pharma GmbH 3/11/2006
EU/3/06/414 Catumaxomab Treatment of gastric cancer Fresenius Biotech GmbH 3/11/2006
EU/3/06/415 Ciclosporin (implant) Prevention of rejection of corneal transplant Lux Biosciences GmbH 3/11/2006
EU/3/06/416 Antisense oligonucleotide 5'-d[P-Thio](CCCTG CTCCC CCCTG GCTCC)-3' Treatment of acute myeloid leukaemia EleosInc Limited 3/11/2006
EU/3/06/417 Human Interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) Treatment of renal cell carcinoma Immunservice GmbH 27/10/2006
EU/3/06/418 Iodine (131I) anti-tenascin monoclonal antibody 81C6 Treatment of glioma The Weinberg Group L.L.C. 30/10/2006
EU/3/06/419 Paclitaxel (liposomal) Ttreatment of pancreatic cancer MediGene AG 31/10/2006
EU/3/06/420 Temsirolimus Treatment of mantle cell lymphoma Wyeth Europa Limited 6/11/2006
EU/3/06/421 Forodesine hydrochloride Treatment of acute lymphoblastic leukaemia Napp Pharmaceuticals Research Limited 18/12/2006
EU/3/06/422 Paclitaxel (micellar) Treatment of ovarian cancer Oasmia Pharmaceutical AB 18/12/2006
EU/3/06/423 Tazarotene Treatment of congenital ichthyoses Orfagen 18/12/2006
EU/3/06/424 Thiotepa Conditioning treatment prior to haematopoietic progenitor cell transplantation Adienne S.r.l. 29/01/2007
EU/3/06/425 Complement factor H Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system Laboratoire français du Fractionnement et des Biotechnologies (LFB) S.A. 26/01/2007
EU/3/06/426 Fenretinide Treatment of primary malignant bone tumours Cancer Research UK 26/01/2007
EU/3/06/427 Fenretinide Treatment of soft tissue sarcoma Cancer Research UK 30/01/2007
EU/3/06/428 Forodesine hydrochloride Treatment of cutaneous T-cell lymphoma Napp Pharmaceuticals Research Limited 29/01/2007
EU/3/06/429 Recombinant modified vaccinia Ankara expressing human 5T4 Treatment of renal cell carcinoma Oxford Biomedica (UK) Ltd 26/01/2007
EU/3/07/430 artesunate Treatment of malaria Pharmaorigin ApS 20/02/2007
EU/3/07/431 Autologous dendritic cells pulsed with autologous tumour cell lysate Treatment of glioma Dorian Regulatory Affairs BV 15/02/2007
EU/3/07/432 Ex-vivo cultured adult human mesenchymal stem cells Treatment of Graft-versus-Host disease Genzyme Europe BV 20/02/2007
EU/3/07/433 HLA class I/II binding tumour associated peptides (ADF-APO-CCN-GUC-K67-MET- MMP-MUC-RGS) Treatment of renal cell carcinoma Immatics Biotechnologies GmbH 15/02/2007
EU/3/07/434 Idebenone Treatment of Leber's hereditary optic neuropathy Santhera Pharmaceuticals (Deutschland) GmbH 15/02/2007
EU/3/07/435 Recombinant human C1-inhibitor Prevention of delayed graft function after solid organ transplantation Pharming Group N.V. 20/02/2007
EU/3/07/436 Eptacog alfa (activated) Treatment of post-neonatal intracerebral haemorrhage Novo Nordisk A/S 20/03/2007
EU/3/07/437 Idebenone Treatment of Duchenne muscular dystrophy Santhera Pharmaceuticals (Deutschland) GmbH 20/03/2007
EU/3/07/438 Zanolimumab Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Genmab A/S 20/03/2007
EU/3/07/439 Recombinant human monoclonal antibody to human IL-1beta of the IgG1/K class Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Novartis Europharm Limited 20/03/2007
EU/3/07/440 Recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene Treatment of congenital alpha-1 antitrypsin deficiency TMC Pharma Services Ltd. 20/03/2007
EU/3/07/441 Hydrocortisone (modified release tablet) Treatment of adrenal insufficiency Diurnal Limited 20/03/2007
EU/3/07/442 Enzastaurin hydrochloride Treatment of diffuse large B cell lymphoma Eli Lilly Nederland B.V. 20/03/2007
EU/3/07/443 Elafin Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Proteo Biotech AG 20/03/2007
EU/3/07/444 Pralatrexate Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Organon N.V. 13/04/2007
EU/3/07/445 Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) Prevention of corneal graft rejection Gene Signal SAS 17/04/2007
EU/3/07/446 Autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA Treatment of metachromatic leukodystrophy Fondazione Telethon 13/04/2007
EU/3/07/447 Nilotinib hydrochloride monohydrate Treatment of gastro intestinal stromal tumours Novartis Europharm Limited 13/04/2007 Tasigna
EU/1/07/422/...		 19/11/2007
EU/3/07/448 Talactoferrinum alfa Treatment of renal cell carcinoma Agennix Limited 5/06/2007
EU/3/07/449 everolimus Treatment of renal cell carcinoma Novartis Europharm Limited 5/06/2007
EU/3/07/450 5(S)-(2´-hydroxy ethoxy)-20(S)- camptothecin Treatment of osteosarcoma ClinTec International Ltd 8/06/2007
EU/3/07/451 Cisplatin (liposomal) Treatment of pancreatic cancer Regulon AE 8/06/2007
EU/3/07/452 R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H-1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea Treatment of gastric carcinoid Trio Medicines Ltd 14/06/2007
EU/3/07/453 Recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 Treatment of haemophilia B (congenital factor IX deficiency) Biovitrum AB 8/06/2007
EU/3/07/454 Recombinant adeno-associated viral vector containing human acid alpha-glucosidase-gene Treatment of glycogen storage disease type II (Pompe's disease) TMC Pharma Services Ltd. 9/07/2007
EU/3/07/455 Ciclosporin Prevention of corneal graft rejection Novagali Pharma SA 22/10/2007
EU/3/07/456 Rilonacept Treatment of cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA) Regeneron UK Limited 10/07/2007
EU/3/07/458 fampridine Treatment of Guillain-Barré syndrome Dr Ulrich Granzer 10/07/2007
EU/3/07/459 1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride Treatment of narcolepsy Bioprojet 10/07/2007
EU/3/07/460 Arsenic trioxide Treatment of acute myeloid leukaemia Cephalon Europe 2/08/2007
EU/3/07/461 Human plasminogen Treatment of ligneous conjunctivitis Kedrion S.p.A. 3/08/2007
EU/3/07/462 Recombinant human soluble Fc-gamma receptor Iib Treatment of idiopathic thrombocytopenic purpura SuppreMol GmbH 2/08/2007
EU/3/07/463 Pyridoxalated haemoglobin polyoxyethylene Treatment of cardiogenic shock Curacyte AG 2/08/2007
EU/3/07/464 Panobinostat lactate Treatment of cutaneous T-cell lymphoma Novartis Europharm Limited 2/08/2007
EU/3/07/465 L-threo-3,4-dihydroxyphenylserine Treatment of orthostatic hypotension in patients with pure autonomic failure The Weinberg Group L.L.C. 2/08/2007
EU/3/07/466 L-threo-3,4-dihydroxyphenylserine Treatment of orthostatic hypotension in patients with multiple system atrophy The Weinberg Group L.L.C. 2/08/2007
EU/3/07/467 Eltrombopag olamine Treatment of idiopathic thrombocytopenic purpura GlaxoSmithKline Trading Services Limited 3/08/2007
EU/3/07/468 Dihydroartemisinin, piperaquine Treatment of malaria Sigma Tau Industrie Farmaceutiche Riunite S.p.A 3/08/2007
EU/3/07/469 Ciprofloxacin (inhalation use) Treatment of cystic fibrosis Bayer Schering Pharma AG 3/08/2007
EU/3/07/470 Human heterologous liver cells (for infusion) Treatment of ornithine-transcarbamylase deficiency Cytonet GmbH & Co. KG 14/09/2007
EU/3/07/471 Human coagulation factor X Treatment of hereditary factor X deficiency Bio Products Laboratory 17/09/2007
EU/3/07/472 Cyclo {{(E,Z)-(2S,3R,4R)-3-hydroxy-4-methyl-2-(methylamino)nona-6,8-dienoyl}-L-2-aminobutyryl-N-methyl-glycyl-N-methyl-L-leucyl-L-valyl-N-methyl-L-leucyl-L-alanyl-D-alanyl-N-methyl-L-leucyl-N-methyl-L-leucyl-N-methyl-L-valyl} Treatment of chronic non-infectious uveitis Lux Biosciences GmbH 14/09/2007
EU/3/07/473 Aviptadil Treatment of sarcoidosis mondoBIOTECH Laboratories Anstalt 14/09/2007
EU/3/07/474 Alpha-1 proteinase inhibitor (inhalation use) Treatment of cystic fibrosis CSL Behring GmbH 14/09/2007
EU/3/07/475 Alginate oligosaccharide (G-block) fragment Treatment of cystic fibrosis AlgiPharma AS 14/09/2007
EU/3/07/476 5´-O-(trans-9´-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine Treatment of acute myleoid leukaemia Clavis Pharma ASA 14/09/2007
EU/3/07/477 4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-ß-D-arabinofuranosyl]-2(1H)-pyrimidinone Treatment of hepatocellular carcinoma Interface International Consultancy Limited 14/09/2007
EU/3/07/478 N-(2-amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Treatment of Hodgkin lymphoma CanReg (Europe) Limited 14/09/2007
EU/3/07/479 N-adamantanyl-N'-geranyl-ethylenediamine Treatment of tuberculosis RLM Consulting 14/09/2007
EU/3/07/480 Naptumomab estafenatox Treatment of renal cell carcinoma Active Biotech Research AB 14/09/2007
EU/3/07/481 R-salbutamol sulphate Treatment of cutaneous forms of lupus erythematosus Astion Pharma A/S 14/09/2007
EU/3/07/483 Amonafide L-malate Treatment of acute myeloid leukaemia Antisoma Research Limited 22/10/2007
EU/3/07/484 Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Treatment of Leber's congenital amaurosis Centre Hospitalier Universitaire de Nantes 22/10/2007
EU/3/07/485 Alvocidib Treatment of chronic lymphocytic leukaemia Sanofi Aventis 23/10/2007
EU/3/07/486 Adenovirus associated viral vector serotype 4 containing the human RPE65 gene Treatment of retinitis pigmentosa Centre Hospitalier Universitaire de Nantes 14/11/2007
EU/3/07/487 4-ethoxy-2-(piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol Treatment of chronic lymphocytic leukaemia BlackSwan Pharma GmbH 14/11/2007
EU/3/07/488 everolimus Treatment of gastro-entero-pancreatic neuroendocrine tumours Novartis Europharm Limited 14/11/2007
EU/3/07/489 Ciclosporin Treatment of Herpes simplex virus stromal keratitis Novagali Pharma SA 29/10/2007
EU/3/07/490 Human autologous bone-forming cells derived from bone marrow stem cells Treatment of non-traumatic osteonecrosis Bone Therapeutics SA 29/10/2007
EU/3/07/491 Interferon gamma Treatment of idiopathic pulmonary fibrosis Foundation For Fatal Rare Diseases 29/10/2007
EU/3/07/492 Iodine (131I) chlorotoxin Treatment of glioma The Weinberg Group L.L.C. 22/10/2007
EU/3/07/493 Isofagomine tartrate Treatment of Gaucher Disease Shire Pharmaceutical Development Limited 23/10/2007
EU/3/07/494 Lenalidomide Treatment of chronic lymphocytic leukaemia Celgene Europe Limited 19/11/2007
EU/3/07/495 Methotrexate (oral liquid) Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 24/10/2007
EU/3/07/496 Mercaptopurine (oral liquid) Treatment of acute lymphoblastic leukaemia Only for Children Pharmaceuticals 22/10/2007
EU/3/07/497 4-[3,5-bis(trimethylsilyl)benzamido]

benzoic acid

 Treatment of hepatocellular carcinoma Quintiles Ireland Ltd 22/10/2007
EU/3/07/498 Polihexanide Treatment of Acanthamoeba keratitis S.I.F.I. Società Industria Farmaceutica Italiana S.p.A. 14/11/2007
EU/3/07/499 Terguride Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Ergonex Licensing and Regulatory Services AG 29/11/2007
EU/3/07/500 Recombinant human rod-derived cone viability factor Treatment of retinitis pigmentosa Fovea Pharmaceuticals SA 29/11/2007
EU/3/07/501 Olaparib Treatment of ovarian cancer AstraZeneca AB 6/12/2007
EU/3/07/502 Picoplatin Treatment of small cell lung cancer Kendle International Ltd 6/12/2007
EU/3/07/503 Recombinant human hepatitis C monoclonal antibody against C4 region of E1 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 6/12/2007
EU/3/07/503 Recombinant human hepatitis C monoclonal antibody against C4 region of E1 Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients GENimmune N.V 6/12/2007
EU/3/07/504 Irinotecan hydrochloride (drug eluting beads) Treatment of glioma CellMed AG 29/11/2007
EU/3/07/505 Interferon beta Treatment of acute lung injury Faron Pharmaceuticals Limited 29/11/2007
EU/3/07/506 Heterologous human adult liver derived stem cells Treatment of Crigler-Najjar syndrome Prof. Etienne Sokal 29/11/2007
EU/3/07/507 Doxorubicin hydrochloride (drug eluting beads) Treatment of glioma CellMed AG 29/11/2007
EU/3/07/508 Chimeric-anti-interleukin-6 monoclonal antibody Treatment of Castleman’s disease Centocor B.V. 30/11/2007
EU/3/07/509 Azacitidine Treatment of acute myeloid leukaemia Celgene Europe Limited 29/11/2007
EU/3/07/510 artesunate Treatment of malaria Sigma-tau Pharma UK 6/12/2007
EU/3/07/511 3-methoxy-pregnenolone Treatment of spinal cord injury MAPREG SAS 4/12/2007
EU/3/07/512 17-(allylamino)-17-demethoxygeldanamycin hydroquinone hydrochloride Treatment of malignant gastro intestinal stromal tumours Voisin Consulting S.A.R.L. 29/11/2007
EU/3/07/513 (S)-2-nitro-6-(4-(trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine Treatment of tuberculosis Dr Ulrich Granzer 29/11/2007
EU/3/07/514 (1R, 2R)-Octanoic acid [2-(2’,3’-dihydro-benzo [1,4] dioxin-6’-yl)-2-hydroxy-1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt Treatment of Gaucher Disease Genzyme Europe BV 4/12/2007
EU/3/07/515 Tegafur, gimeracil, oteracil potassium Treatment of gastric cancer Taiho Pharma Europe Limited 20/12/2007
EU/3/07/516 Recombinant human histone H1.3 and recombinant human N-bis-met-histone H1.3 Treatment of acute myeloid leukaemia SymbioTec GmbH 20/12/2007
EU/3/07/517 N-[4-(3-amino-1H-indazol-4-yl)phenyl]-N´-(2-fluoro-5-methylphenyl) urea Treatment of hepatocellular carcinoma Abbott Laboratories Limited 20/12/2007
EU/3/07/518 Methyl 4,6-diamino-2-[1-(2-fluorobenzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate Treatment of pulmonary arterial hypertension including treatment of chronic thromboembolic pulmonary hypertension Bayer Schering Pharma AG 20/12/2007
EU/3/07/519 Maribavir Prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk ViroPharma SPRL 18/12/2007
EU/3/07/520 EU/3/07/520 Treatment of epithelial neoplasia of the vulva positive for human papilloma virus ISA Pharmaceuticals BV 20/12/2007
EU/3/07/521 H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt Treatment of TERT positive non-small cell lung cancer in HLA-A2 positive patients Vaxon Biotech 18/12/2007
EU/3/07/522 (manganese, dichloro [(4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21a-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-?N5, ?N13, ?N18, ?N21, ?N22]-) Prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Celtic Bio-Pharma Services Ltd 31/01/2008
EU/3/07/523 Lutetium (177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7)disulfide Treatment of gastro-entero-pancreatic neuroendocrine tumours BioSynthema Global Operations B.V 31/01/2008
EU/3/07/524 (R)-2-Methyl-6-nitro-2-{4-[4-(4-trifluoromethoxyphenoxy)

piperidin-1-yl]phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole

 Treatment of tuberculosis Otsuka Pharmaceutical Europe Ltd 1/02/2008
EU/3/07/525 Iodine (131I) iobenguane Treatment of neuroblastoma Molecular Insight Limited 31/01/2008
EU/3/07/526 N-(2-amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Treatment of acute myeloid leukaemia CanReg (Europe) Limited 31/01/2008
EU/3/08/527 Recombinant human monoclonal antibody to human IL-1beta of the IgG1/K class Treatment of systemic-onset juvenile idiopathic arthritis Novartis Europharm Limited 4/02/2008
EU/3/08/528 Lumiliximab Treatment of chronic lymphocytic leukaemia Biogen Idec Limited 4/02/2008
EU/3/08/529 Tretazicar Treatment of visceral leishmaniasis Morvus Technology Limited 4/02/2008
EU/3/08/530 Heterologous human adult liver derived stem cells

Heterologous human adult liver derived stem cells		 Treatment of ornithinine transcarbamylase deficiency Prof. Etienne Sokal 4/02/2008
EU/3/08/531 ascorbic acid Treatment of Charcot-Marie-Tooth disease type 1A Murigenetics SAS 1/04/2008
EU/3/08/532 filgrastim Treatment of amyotrophic lateral sclerosis Sygnis Bioscience GmbH & Co. KG 1/04/2008
EU/3/08/533 Recombinant human monoclonal antibody against transforming growth factor beta-1, 2 and 3 Treatment of idiopathic pulmonary fibrosis Genzyme Europe BV 1/04/2008
EU/3/08/534 Allogeneic human umbilical cord tissue-derived cells Treatment of retinitis pigmentosa Centocor, B.V. 1/04/2008
EU/3/08/535 Humanised monoclonal antibody to the folate receptor alpha Treatment of ovarian cancer Chiltern International Limited 1/04/2008
EU/3/08/536 Chimeric antibody to mesothelin Treatment of pancreatic cancer Chiltern International Limited 17/03/2008
EU/3/08/537 Autologous urothelial and smooth muscle cells Treatment of spina bifida Choice Pharma Limited 17/03/2008
EU/3/08/538 Amrubicin hydrochloride Treatment of small cell lung cancer Celgene Europe Limited 2/04/2008
EU/3/08/539 Ammonium tetrathiomolybdate Treatment of Wilson´s disease JJGConsultancy Ltd 1/04/2008
EU/3/08/540 Omigapil maleate Treatment of congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy). Santhera Pharmaceuticals (Deutschland) GmbH 8/05/2008
EU/3/08/541 [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone Treatment of erythropoietic protoporphyria Clinuvel (UK) Limited 8/05/2008
EU/3/08/542 Ribonucleotide reductase R2 specific phosphorothioate oligonucleotide Treatment of acute myeloid leukaemia Dr Ulrich Granzer 8/05/2008
EU/3/08/543 Sarsasapogenin Treatment of amyotrophic lateral sclerosis Phytopharm plc 8/05/2008
EU/3/08/544 Omigapil maleate Treatment of congenital muscular dystrophy with merosin (laminin alpha 2) deficiency Santhera Pharmaceuticals (Deutschland) GmbH 8/05/2008
EU/3/08/545 [Nle4, D-Phe7]-alpha-melanocyte stimulating hormone Treatment of congenital erythropoietic porphyria Clinuvel (UK) Limited 8/05/2008
EU/3/08/546 Alpha-1 proteinase inhibitor (inhalation use) Treatment of congenital alpha-1 antitrypsin deficiency Talecris Biotherapeutics GmbH 3/06/2008
EU/3/08/547 Anti-von Willebrand Aptamer Treatment of thrombotic thrombocytopenic purpura FGK Representative Service GmbH 3/06/2008
EU/3/08/548 Carfilzomib Treatment of multiple myeloma Nexus Oncology Ltd 3/06/2008
EU/3/08/549 NGR-human tumour necrosis factor Treatment of malignant mesothelioma MolMed S.p.A. 3/06/2008
EU/3/08/550 Nimotuzumab Treatment of pancreatic cancer Oncoscience AG 3/06/2008
EU/3/08/551 Pegylated recombinant factor VIIa Treatment of haemophilia A Novo Nordisk A/S 4/06/2008
EU/3/08/552 Pegylated recombinant factor VIIa Treatment of haemophilia B Novo Nordisk A/S 3/06/2008
EU/3/08/553 Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL] Treatment of glioma Gregory Fryer Associates Ltd 3/06/2008
EU/3/08/554 Beraprost sodium (modified release tablet) Treatment of pulmonary arterial hypertension Lung Rx Limited 10/07/2008
EU/3/08/555 Vincristine sulphate liposomes Treatment of acute lymphoblastic leukaemia Fulcrum Pharma (Europe) Ltd 8/07/2008
EU/3/08/556 N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide Treatment of cystic fibrosis Voisin Consulting S.A.R.L. 8/07/2008
EU/3/08/557 Sapacitabine Treatment of myelodysplastic syndromes Cyclacel Limited 8/07/2008
EU/3/08/558 Sapacitabine Treatment of acute myeloid leukaemia Cyclacel Limited 10/07/2008
EU/3/08/559 bosentan Treatment of idiopathic pulmonary fibrosis Actelion Registration Limited 5/09/2008
EU/3/08/560 (-)-(2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate Treatment of moderate and severe closed traumatic brain injury KeyNeurotek Pharmaceuticals AG 5/09/2008
EU/3/08/561 Donor lymphocyte preparation depleted of functional alloreactive T-cells Prevention of Graft-versus-Host disease Kiadis Pharma Netherlands B.V. 5/09/2008
EU/3/08/562 Topotecan hydrochloride (liposomal) Treatment of glioma Dr Matthias Luz 5/09/2008
EU/3/08/563 Recombinant derivative of C3 transferase Treatment of traumatic spinal cord injury Triskel EU Services 5/09/2008
EU/3/08/564 Avian polyclonal IgY antibody against Pseudomonas aeruginosa Treatment of cystic fibrosis Immunsystem I.M.S. AB 23/09/2008
EU/3/08/565 Drotrecogin alfa (activated) Treatment of acute respiratory distress syndrome Drugrecure Aps 22/09/2008
EU/3/08/566 Levofloxacin hemihydrate Treatment of cystic fibrosis Mpex London Ltd 23/09/2008
EU/3/08/567 miltefosine Treatment of cutaneous T-cell lymphoma ExperGen Drug Development GmbH 22/09/2008
EU/3/08/568 N'-(5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazide Treatment of partial deep dermal and full thickness burn wounds Innate Pharmaceuticals AB 22/09/2008
EU/3/08/569 Pegylated L-asparaginase Treatment of acute lymphoblastic leukaemia Enzon (UK) Limited 22/09/2008
EU/3/08/570 Recombinant human CXCL8 mutant Prevention of delayed graft function after solid organ transplantation ProtAffin Biotechnologie AG 22/09/2008
EU/3/08/571 Recombinant Human minibody against complement component C5 Treatment of atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system Adienne S.r.l. 22/09/2008
EU/3/08/572 (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate Treatment of chronic idiopathic myelofibrosis Incyte Corporation Ltd 7/11/2008
EU/3/08/573 Adeno-associated viral vector containing the human alpha-sarcoglycan gene Treatment of alpha-sarcoglycanopathy Généthon 7/11/2008
EU/3/08/574 Autologous urothelial and smooth muscle cells Treatment of spinal cord injury Choice Pharma Limited 7/11/2008
EU/3/08/575 vildagliptin Treatment of isovaleric acidaemia Orphan Europe SARL 7/11/2008
EU/3/08/576 Carglumic acid Treatment of methylmalonic acidaemia Orphan Europe SARL 7/11/2008
EU/3/08/577 Carglumic acid Treatment of propionic acidaemia Orphan Europe SARL 7/11/2008
EU/3/08/578 Cysteamine hydrochloride Treatment of cystinosis Orphan Europe SARL 7/11/2008
EU/3/08/579 Ex vivo expanded autologous human corneal epithelium containing stem cells Treatment of corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns<br> Chiesi Farmaceutici S.P.A. 7/11/2008
EU/3/08/580 Filgrastim Treatment of spinal cord injury Sygnis Bioscience GmbH & Co. KG 7/11/2008
EU/3/08/581 Ofatumumab Treatment of chronic lymphocytic leukaemia Glaxo Group Limited 7/11/2008
EU/3/08/582 Recombinant human heparan-N-sulfatase Treatment of mucopolysaccharidosis, type IIIA (Sanfilippo A syndrome) Shire Pharmaceutical Development Limited 7/11/2008
EU/3/08/583 Gadodiamide (liposomal) Treatment of glioma Dr Matthias Luz 3/12/2008
EU/3/08/584 Palifosfamide Treatment of soft tissue sarcoma Ziopharm Oncology Limited 3/12/2008
EU/3/08/585 Daunorubicin (liposomal) Treatment of acute myeloid leukaemia Diatos S. A. 3/12/2008
EU/3/08/586 RNA, [P-deoxy-P-(dimethylamino)] (2´,3´-dideoxy-2´,3´-imino-2´,3´-seco) (2´a-5´)(C-m5U-C-C-A-A-C-A-m5U-C-A-A-G-G-A-A-G-A-m5U-G-G-C-A-m5U-m5U-m5U-C-m5U-A-G), P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy] Treatment of Duchenne muscular dystrophy AVI BioPharma International Ltd 3/12/2008
EU/3/08/587 Cenersen Treatment of chronic lymphocytic leukaemia EleosInc Limited 3/12/2008
EU/3/08/588 Recombinant human ADAMTS-13 Treatment of thrombotic thrombocytopenic purpura Baxter AG 3/12/2008
EU/3/08/589 Yttrium (90Y) edotreotide Treatment of gastro-entero-pancreatic neuroendocrine tumours Molecular Insight Pharmaceuticals GmbH 4/12/2008
EU/3/08/590 2-[[3-({4-[(5-{2-[(3-Fluorophenyl)amino]-2-oxoethyl}-1H-pyrazol-3-yl)amino]-quinazolin-7-yl}oxy)propyl](ethyl)amino]ethyl dihydrogen phosphate trihydrate Treatment of acute myeloid leukaemia AstraZeneca AB 5/12/2008
EU/3/08/591 5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d]oxazole Treatment of Duchenne muscular dystrophy BioMarin Europe Ltd 4/12/2008
EU/3/08/592 Murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 Treatment of hairy cell leukaemia MEDIMMUNE Limited 4/12/2008
EU/3/08/593 N2´-Deacetyl-N2´-[4-methyl-4-(oxobutyldithio)-1-oxopentyl]-maytansine-chimerised anti-CD138 IgG4 Monoclonal Antibody Treatment of multiple myeloma Biotest AG 3/12/2008
EU/3/08/594 Recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein Treatment of hypophosphatasia Europa Rx Limited 3/12/2008
EU/3/08/595 Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E Treatment of anaplastic large cell lymphoma Seattle Genetics UK Limited 15/01/2009
EU/3/08/596 Monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E Treatment of Hodgkin lymphoma Seattle Genetics UK Limited 15/01/2009
EU/3/08/597 2,3,4,5 tetrahydro-2,8-dimethyl-5-[2-(6-methyl-3-pyridinyl)ethyl]-1H-pyrido[4,3-b]indole dihydrochloride Treatment of Huntington&acute;s disease Innovative Drug European Associates Limited 20/01/2009
EU/3/08/598 Exon 44 specific phosphorothioate oligonucleotide Treatment of Duchenne muscular dystrophy Prosensa Therapeutics B.V. 27/02/2009
EU/3/08/600 Human anti-intercellular adhesion molecule-1 monoclonal antibody Treatment of multiple myeloma BioInvent International AB 20/01/2009
EU/3/08/601 Milatuzumab Treatment of multiple myeloma Immunomedics GmbH 19/01/2009
EU/3/08/602 Milatuzumab Treatment of chronic lymphocytic leukaemia Immunomedics GmbH 19/01/2009
EU/3/08/603 Pralatrexate Treatment of non-papillary transitional cell carcinoma of the urinary bladder European Medical Advisory Services Limited 19/01/2009
EU/3/08/604 Recombinant human minibody against complement component C5 fused with RGD-motif Prevention of the ischemia/reperfusion injury associated with solid organ transplantation ADIENNE S.r.l. 20/01/2009
EU/3/08/605 Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class / Recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/kappa class Treatment of spinal cord injury Novartis Europharm Limited 19/01/2009
EU/3/08/606 Recombinant human residue 41 glutamic acid to glutamine variant of Interferon-alfa-2b Treatment of Beh&ccedil;et’s disease Creabilis Therapeutics S.p.A. 19/01/2009
EU/3/08/607 Type I native bovine skin collagen Treatment of systemic sclerosis arGentis Autoimmune Europe Limited 9/02/2009
EU/3/08/608 Yttrium (90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 Treatment of pancreatic cancer Immunomedics GmbH 6/02/2009
EU/3/08/609 Adeno-associated viral vector serotype 5 containing the human ABCA4 gene Treatment of Stargardt’s disease Fondazione Telethon 6/02/2009
EU/3/08/610 Cyclopropane-1,1-dicarboxylic acid [4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt Treatment of medullary thyroid carcinoma PPD Global Ltd 6/02/2009
EU/3/08/611 Recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein Treatment of acute liver failure Alfact Innovation SAS 11/02/2009
EU/3/08/612 Recombinant human proinsulin Treatment of retinitis pigmentosa ProRetina Therapeutics S.L. 11/02/2009
EU/3/09/613 Tobramycin (inhalation use) ?reatment of Pseudomonas aeruginosa lung infection in cystic fibrosis PARI Pharma GmbH 27/02/2009
EU/3/09/614 Mifepristone Treatment of hypercortisolism (Cushing&acute;s syndrome) of endogenous origin EXELGYN 27/02/2009
EU/3/09/615 N-terminal hexaglutamine-tagged recombinant human N-acetylgalactosamine-6-sulfate sulfatase Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) Dr Gosse B. Bruinsma 27/02/2009
EU/3/09/616 (6R)-4, 5, 6, 7-tetrahydro-N6-propyl-2, 6-benzothiazolediamine dihydrochloride monohydrate Treatment of amyotrophic lateral sclerosis Knopp Neurosciences Sub Ltd 27/02/2009
EU/3/09/617 2,2-dimethylbutyric acid, sodium salt Treatment of beta-thalassaemia intermedia and major   Isabelle Ramirez 27/02/2009
EU/3/09/618 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of acute lymphoblastic leukaemia Teva Pharma GmbH 27/02/2009
EU/3/09/619 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of acute myeloid leukaemia Teva Pharma GmbH 27/02/2009
EU/3/09/620 (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate Treatment of myelofibrosis secondary to polycythemia vera or essential thrombocythemia Incyte Corporation Ltd 3/04/2009
EU/3/09/621 2,2-dimethylbutyric acid, sodium salt Treatment of sickle cell disease Isabelle Ramirez 18/03/2009
EU/3/09/622 N-(5-tert-Butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt Treatment of acute myeloid leukaemia Ambit Europe Limited 23/03/2009
EU/3/09/623 Autologous haematopoietic stem cells transduced with lentiviral vector encoding the human beta-globin gene Treatment of beta-thalassaemia intermedia and major   EGT San Rocco Italia SRL 29/04/2009
EU/3/09/624 Autologous tumour-derived gp96 heat shock protein-peptide complex Treatment of glioma Antigenics Therapeutics Limited 29/04/2009
EU/3/09/625 Guanabenz Treatment of traumatic spinal cord injury Acure Pharma AB 29/04/2009
EU/3/09/626 Lintuzumab Treatment of myelodysplastic syndromes Seattle Genetics UK Limited 29/04/2009
EU/3/09/627 Lintuzumab Treatment of acute myeloid leukaemia Seattle Genetics UK Limited 30/04/2009
EU/3/09/628 Mercaptopurine (oral suspension) Treatment of acute lymphoblastic leukaemia Nova Laboratories Limited 30/04/2009
EU/3/09/629 Nanobody directed towards the human A1 domain of von Willebrand factor Treatment of thrombotic thrombocytopenic purpura Ablynx NV 30/04/2009
EU/3/09/630 Skin equivalent graft genetically corrected with a COL7A1-encoding SIN retroviral vector Treatment of dystrophic epidermolysis bullosa Prof. Alain Hovnanian 30/04/2009
EU/3/09/631 Talampanel Treatment of glioma Teva Pharma GmbH 29/04/2009
EU/3/09/632 Adeno-associated viral vector containing porphobilinogen deaminase gene Treatment of acute intermittent porphyria Amsterdam Molecular Therapeutics BV 29/04/2009
EU/3/09/633 L-asparaginase encapsulated in erythrocytes Treatment of pancreatic cancer Erytech Pharma SA 15/05/2009
EU/3/09/634 S-[2,3-bispalmitoyloxy-(2R)-propyl]-cysteinyl-GNNDESNISFKEK Treatment of pancreatic cancer MBiotec GmbH 15/05/2009
EU/3/09/635 Treprostinil diethanolamine Treatment of systemic sclerosis United Therapeutics Europe Ltd 15/05/2009
EU/3/09/636 Dexamethasone phosphate (iontophoretic solution, ocular use) Treatment of corneal graft rejection<br> Voisin Consulting S.A.R.L. 15/05/2009
EU/3/09/637 2',3',5'-tri-O-acetyluridine Treatment of 5-fluorouracil overdose Wellstat Therapeutics EU Limited 15/05/2009
EU/3/09/638 Humanised IgG4 monoclonal antibody to the human toll-like receptor type 2 Prevention of the ischaemia/reperfusion injury associated with solid organ transplantation Opsona Therapeutics 15/05/2009
EU/3/09/639 4,6,8-trihydroxy-10-(3,7,11-trimethyldodeca-2,6,10-trienyl)-5,10-dihydrodibenzo[b,e][1,4]diazepin-11-one Treatment of glioma Albany Regulatory Consulting Limited 15/05/2009
EU/3/09/640 Pegylated recombinant human factor IX Treatment of haemophilia B Novo Nordisk A/S 15/05/2009
EU/3/09/641 Alicaforsen Treatment of pouchitis Atlantic Healthcare Limited 15/05/2009
EU/3/09/642 Chimeric-anti-interleukin-6 monoclonal antibody Treatment of multiple myeloma Centocor B.V. 12/06/2009
EU/3/09/643 Desipramine hydrochloride Treatment of Rett syndrome Targeon SAS 12/06/2009
EU/3/09/644 Murine monoclonal antibody to GD2 Treatment of neuroblastoma United Therapeutics Europe Ltd 12/06/2009
EU/3/09/645 Octreotide chloride (lipid depot solution) Treatment of acromegaly Camurus AB 12/06/2009
EU/3/09/646 Talampanel Treatment of amyotrophic lateral sclerosis Teva Pharma GmbH 12/06/2009
EU/3/09/647 (S)-3’-(OH)-desazadesferrithiocin-polyether, magnesium salt Treatment of chronic iron overload requiring chelation therapy FerroKin BioSciences Ltd 24/07/2009
EU/3/09/648 Afamelanotide Treatment of solar urticaria Clinuvel UK Limited 24/07/2009
EU/3/09/649 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of Hodgkin lymphoma Teva Pharma GmbH 24/07/2009
EU/3/09/650 Blinatumomab Treatment of acute lymphoblastic leukaemia Micromet AG 24/07/2009
EU/3/09/651 Ciclosporin (eye drops, solution) Treatment of atopic keratoconjunctivitis Allergan Pharmaceuticals Ireland 24/07/2009
EU/3/09/652 Ciprofloxacin (liposomal) Treatment of cystic fibrosis Interface International Consultancy Ltd 24/07/2009
EU/3/09/653 Eculizumab Treatment of atypical haemolytic uremic syndrome Alexion Europe SAS 24/07/2009
EU/3/09/654 Hypothiocyanite / lactoferrin Treatment of cystic fibrosis Alaxia 24/07/2009
EU/3/09/655 Octocog alpha (liposomal) Treatment of haemophilia A Bayer Schering Pharma AG 24/07/2009
EU/3/09/656 Recombinant histidine-tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors Treatment of diffuse large B-cell lymphoma CellGenix Technologie Transfer GmbH 24/07/2009
EU/3/09/657 Recombinant human N-acetylgalactosamine-6-sulfatase Treatment of mucopolysaccharidosis, type IVA (Morquio A Syndrome) BioMarin Europe Limited 24/07/2009
EU/3/09/658 Tamibarotene Treatment of acute promyelocytic leukaemia Eudax S.R.L. 24/07/2009
EU/3/09/659 Tosedostat Treatment of acute myeloid leukaemia Chroma Therapeutics Ltd 24/07/2009
EU/3/09/660 Trabedersen Treatment of pancreatic cancer Antisense Pharma GmbH 24/07/2009
EU/3/09/661 (S)-ethyl 2-amino-3-(4-(2-amino-6-((R)-1-(4-chloro-2-(3-methyl-1H-pyrazol-1-yl)phenyl)-2,2,2-trifluoroethoxy)pyrimidin-4-yl)phenyl)propanoate Treatment of carcinoid tumours Lexicon Celtic Limited 8/10/2009
EU/3/09/662 26 base single stranded phosphodiester DNA oligonucleotide Treatment of acute myeloid leukaemia Antisoma Research Ltd 8/10/2009
EU/3/09/663 Adeno-associated viral vector containing modified U1 snRNA Treatment of Duchenne muscular dystrophy Amsterdam Molecular Therapeutics (AMT) B.V. 8/10/2009
EU/3/09/664 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of myelodysplastic syndromes Teva Pharma GmbH 8/10/2009
EU/3/09/665 Allogeneic ex vivo expanded umbilical cord blood cells Treatment of chronic myeloid leukaemia Teva Pharma GmbH 8/10/2009
EU/3/09/666 Eicosapentaenoic acid Treatment of familial adenomatous polyposis S.L.A. Pharma (UK) Ltd 8/10/2009
EU/3/09/667 Expanded human allogeneic mesenchymal adult stem cells extracted from adipose tissue Treatment of anal fistula Cellerix S.A. 8/10/2009
EU/3/09/668 Human C1-inhibitor Treatment of angioedema caused by C1-inhibitor deficiency ViroPharma SPRL 8/10/2009
EU/3/09/669 Low molecular weight dextran sulfate Prevention of graft rejection during pancreatic islet transplantation TikoMed AB 9/10/2009
EU/3/09/670 Pasireotide Treatment of acromegaly Novartis Europharm Limited 8/10/2009
EU/3/09/671 Pasireotide Treatment of Cushing's disease Novartis Europharm Limited 8/10/2009
EU/3/09/672 Pomalidomide Treatment of multiple myeloma Celgene Europe Limited 8/10/2009
EU/3/09/673 Recombinant antibody construct against human CD30 and CD16A Treatment of Hodgkin lymphoma Affimed Therapeutics AG 9/10/2009
EU/3/09/674 Recombinant human serum amyloid P Prevention of scarring post glaucoma filtration surgery RegPak BioPharma Consulting 9/10/2009
EU/3/09/675 Sequence-modified recombinant human factor VIIa Treatment of haemophilia A Bayer Schering Pharma AG 9/10/2009
EU/3/09/676 Sequence-modified recombinant human factor VIIa Treatment of haemophilia B Bayer Schering Pharma AG 8/10/2009
EU/3/09/677 Human tumour necrosis factor alfa-derived peptide Cys-Gly-Gln-Arg-Glu-Thr-Pro-Glu-Gly-Ala-Glu-Ala-Lys-Pro-Trp-Tyr-Cys Treatment of acute lung injury Apeptico Forschung und Entwicklung GmbH 8/10/2009
EU/3/09/678 (-)-trans-3-(5,6-dihydro-4H-pyrrolo[3,2,1-ij]quinolin-1yl)-4-(1H-indol-3-yl) pyrrolidine-2, 5-dione Treatment of soft tissue sarcoma Gregory Fryer Associates Ltd 8/10/2009
EU/3/09/679 4-benzyl-2-naphtalen-1-yl-1,2,4-thiadiazolidine-3,5-dione Treatment of progressive supranuclear palsy NOSCIRA, S.A. 28/10/2009
EU/3/09/680 5'-O-(trans-9''-octadecenoyl)-1-beta-D-2'-deoxy-2',2'-difluorocytidine Treatment of pancreatic cancer Clavis Pharma ASA 28/10/2009
EU/3/09/681 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide Treatment of Huntington's disease Siena Biotech SpA 28/10/2009
EU/3/09/682 Anti-EphA2 monoclonal antibody conjugated to maleimidocaproyl monomethylauristatin phenylalanine Treatment of ovarian cancer MedImmune Ltd 28/10/2009
EU/3/09/683 Cholic acid Treatment of inborn errors of primary bile acid synthesis responsive to treatment with cholic acid Special Products Ltd. 28/10/2009
EU/3/09/684 Masitinib mesilate Treatment of pancreatic cancer AB Science 28/10/2009
EU/3/09/685 N-[(2S)-2,3-dihydroxypropyl]-3-[(2-fluoro-4-iodophenyl)amino]isonicotinamide hydrochloride Treatment of pancreatic cancer Merck KGaA 9/11/2009
EU/3/09/686 NGR-human tumour necrosis factor Treatment of hepatocellular carcinoma MolMed S.p.A. 9/11/2009
EU/3/09/687 Patupilone Treatment of primary peritoneal cancer Novartis Europharm Limited 5/11/2009
EU/3/09/688 Patupilone Treatment of fallopian tube cancer Novartis Europharm Limited 5/11/2009
EU/3/09/689 Peptides mimicking antigen receptors on autoimmune B cells and autoimmune T cells associated with myasthenia gravis Treatment of myasthenia gravis CuraVac Europe SPRL 9/11/2009
EU/3/09/690 Human anthrax immunoglobulin Post-exposure prophylaxis of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 9/11/2009
EU/3/09/691 Human anthrax immunoglobulin Treatment of inhalation anthrax disease Emergent Sales and Marketing Germany GmbH 5/11/2009


Last update: 19/11/2009 | Top